@article{cotton_ariel_chen_walcott_dixit_breau_hinesley_kedziora_tang_zheng_et al._2024, title={An in vitro platform for quantifying cell cycle phase lengths in primary human intestinal epithelial cells}, volume={14}, ISSN={["2045-2322"]}, DOI={10.1038/s41598-024-66042-9}, abstractNote={Abstract The intestinal epithelium dynamically controls cell cycle, yet no experimental platform exists for directly analyzing cell cycle phases in non-immortalized human intestinal epithelial cells (IECs). Here, we present two reporters and a complete platform for analyzing cell cycle phases in live primary human IECs. We interrogate the transcriptional identity of IECs grown on soft collagen, develop two fluorescent cell cycle reporter IEC lines, design and 3D print a collagen press to make chamber slides for optimal imaging while supporting primary human IEC growth, live image cell cycle dynamics, then assemble a computational pipeline building upon free-to-use programs for semi-automated analysis of cell cycle phases. The PIP-FUCCI construct allows for assigning cell cycle phase from a single image of living cells, and our PIP-H2A construct allows for semi-automated direct quantification of cell cycle phase lengths using our publicly available computational pipeline. Treating PIP-FUCCI IECs with oligomycin demonstrates that inhibiting mitochondrial respiration lengthens G1 phase, and PIP-H2A cells allow us to measure that oligomycin differentially lengthens S and G2/M phases across heterogeneous IECs. These platforms provide opportunities for future studies on pharmaceutical effects on the intestinal epithelium, cell cycle regulation, and more.}, number={1}, journal={SCIENTIFIC REPORTS}, author={Cotton, Michael J. and Ariel, Pablo and Chen, Kaiwen and Walcott, Vanessa A. and Dixit, Michelle and Breau, Keith A. and Hinesley, Caroline M. and Kedziora, Katarzyna M. and Tang, Cynthia Y. and Zheng, Anna and et al.}, year={2024}, month={Jul} }
 @article{tong_pang_hu_huang_sun_wang_burclaff_mills_wang_miao_2024, title={Gastric intestinal metaplasia: progress and remaining challenges}, volume={1}, ISSN={["1435-5922"]}, DOI={10.1007/s00535-023-02073-9}, journal={JOURNAL OF GASTROENTEROLOGY}, author={Tong, Qi-Yue and Pang, Min-Jiao and Hu, Xiao-Hai and Huang, Xuan-Zhang and Sun, Jing-Xu and Wang, Xin-Yu and Burclaff, Joseph and Mills, Jason C. and Wang, Zhen-Ning and Miao, Zhi-Feng}, year={2024}, month={Jan} }
 @article{adkins-threats_arimura_huang_divenko_to_mao_zeng_hwang_burclaff_jain_et al._2024, title={Metabolic regulator ERRy governs gastric stem cell differentiation into acid-secreting parietal cells}, volume={31}, ISSN={["1875-9777"]}, DOI={10.1016/j.stem.2024.04.016}, number={6}, journal={CELL STEM CELL}, author={Adkins-Threats, Mahliyah and Arimura, Sumimasa and Huang, Yang-Zhe and Divenko, Margarita and To, Sarah and Mao, Heather and Zeng, Yongji and Hwang, Jenie Y. and Burclaff, Joseph R. and Jain, Shilpa and et al.}, year={2024}, month={Jun} }
 @article{dixit_burclaff_2024, title={The keratin cytoskeleton emerges as a regulator of mitochondria in the colonic epithelium}, volume={327}, ISSN={["1522-1547"]}, DOI={10.1152/ajpgi.00228.2024}, number={5}, journal={AMERICAN JOURNAL OF PHYSIOLOGY-GASTROINTESTINAL AND LIVER PHYSIOLOGY}, author={Dixit, Michelle and Burclaff, Joseph}, year={2024}, month={Nov}, pages={G699–G700} }
 @article{rivera_bilton_burclaff_czerwinski_liu_trueblood_hinesley_breau_deal_joshi_et al._2023, title={Hypoxia Primes Human ISCs for Interleukin-Dependent Rescue of Stem Cell Activity}, volume={16}, ISSN={["2352-345X"]}, DOI={10.1016/j.jcmgh.2023.07.012}, abstractNote={Background and AimsHypoxia in the intestinal epithelium can be caused by acute ischemic events or chronic inflammation in which immune cell infiltration produces inflammatory hypoxia starving the mucosa of oxygen. The epithelium has the capacity to regenerate after some ischemic and inflammatory conditions suggesting that intestinal stem cells (ISCs) are highly tolerant to acute and chronic hypoxia; however, the impact of hypoxia on human ISC (hISC) function has not been reported. Here we present a new microphysiological system (MPS) to investigate how hypoxia affects hISCs from healthy donors and test the hypothesis that prolonged hypoxia modulates how hISCs respond to inflammation-associated interleukins (ILs).MethodshISCs were exposed to <1.0% oxygen in the MPS for 6, 24, 48, and 72 hours. Viability, hypoxia-inducible factor 1a (HIF1a) response, transcriptomics, cell cycle dynamics, and response to cytokines were evaluated in hISCs under hypoxia. HIF stabilizers and inhibitors were screened to evaluate HIF-dependent responses.ResultsThe MPS enables precise, real-time control and monitoring of oxygen levels at the cell surface. Under hypoxia, hISCs maintain viability until 72 hours and exhibit peak HIF1a at 24 hours. hISC activity was reduced at 24 hours but recovered at 48 hours. Hypoxia induced increases in the proportion of hISCs in G1 and expression changes in 16 IL receptors. Prolyl hydroxylase inhibition failed to reproduce hypoxia-dependent IL-receptor expression patterns. hISC activity increased when treated IL1β, IL2, IL4, IL6, IL10, IL13, and IL25 and rescued hISC activity caused by 24 hours of hypoxia.ConclusionsHypoxia pushes hISCs into a dormant but reversible proliferative state and primes hISCs to respond to a subset of ILs that preserves hISC activity. These findings have important implications for understanding intestinal epithelial regeneration mechanisms caused by inflammatory hypoxia. Hypoxia in the intestinal epithelium can be caused by acute ischemic events or chronic inflammation in which immune cell infiltration produces inflammatory hypoxia starving the mucosa of oxygen. The epithelium has the capacity to regenerate after some ischemic and inflammatory conditions suggesting that intestinal stem cells (ISCs) are highly tolerant to acute and chronic hypoxia; however, the impact of hypoxia on human ISC (hISC) function has not been reported. Here we present a new microphysiological system (MPS) to investigate how hypoxia affects hISCs from healthy donors and test the hypothesis that prolonged hypoxia modulates how hISCs respond to inflammation-associated interleukins (ILs). hISCs were exposed to <1.0% oxygen in the MPS for 6, 24, 48, and 72 hours. Viability, hypoxia-inducible factor 1a (HIF1a) response, transcriptomics, cell cycle dynamics, and response to cytokines were evaluated in hISCs under hypoxia. HIF stabilizers and inhibitors were screened to evaluate HIF-dependent responses. The MPS enables precise, real-time control and monitoring of oxygen levels at the cell surface. Under hypoxia, hISCs maintain viability until 72 hours and exhibit peak HIF1a at 24 hours. hISC activity was reduced at 24 hours but recovered at 48 hours. Hypoxia induced increases in the proportion of hISCs in G1 and expression changes in 16 IL receptors. Prolyl hydroxylase inhibition failed to reproduce hypoxia-dependent IL-receptor expression patterns. hISC activity increased when treated IL1β, IL2, IL4, IL6, IL10, IL13, and IL25 and rescued hISC activity caused by 24 hours of hypoxia. Hypoxia pushes hISCs into a dormant but reversible proliferative state and primes hISCs to respond to a subset of ILs that preserves hISC activity. These findings have important implications for understanding intestinal epithelial regeneration mechanisms caused by inflammatory hypoxia.}, number={5}, journal={CELLULAR AND MOLECULAR GASTROENTEROLOGY AND HEPATOLOGY}, author={Rivera, Kristina R. and Bilton, R. Jarrett and Burclaff, Joseph and Czerwinski, Michael J. and Liu, Jintong and Trueblood, Jessica M. and Hinesley, Caroline M. and Breau, Keith A. and Deal, Halston E. and Joshi, Shlok and et al.}, year={2023}, pages={823–846} }
 @article{a proximal-to-distal survey of healthy adult human small intestine and colon epithelium by single-cell transcriptomics._2022, url={https://europepmc.org/articles/PMC9043569}, DOI={10.1016/j.jcmgh.2022.02.007}, abstractNote={Background & AimsSingle-cell transcriptomics offer unprecedented resolution of tissue function at the cellular level, yet studies analyzing healthy adult human small intestine and colon are sparse. Here, we present single-cell transcriptomics covering the duodenum, jejunum, ileum, and ascending, transverse, and descending colon from 3 human beings.MethodsA total of 12,590 single epithelial cells from 3 independently processed organ donors were evaluated for organ-specific lineage biomarkers, differentially regulated genes, receptors, and drug targets. Analyses focused on intrinsic cell properties and their capacity for response to extrinsic signals along the gut axis across different human beings.ResultsCells were assigned to 25 epithelial lineage clusters. Multiple accepted intestinal stem cell markers do not specifically mark all human intestinal stem cells. Lysozyme expression is not unique to human Paneth cells, and Paneth cells lack expression of expected niche factors. Bestrophin 4 (BEST4)+ cells express Neuropeptide Y (NPY) and show maturational differences between the small intestine and colon. Tuft cells possess a broad ability to interact with the innate and adaptive immune systems through previously unreported receptors. Some classes of mucins, hormones, cell junctions, and nutrient absorption genes show unappreciated regional expression differences across lineages. The differential expression of receptors and drug targets across lineages show biological variation and the potential for variegated responses.ConclusionsOur study identifies novel lineage marker genes, covers regional differences, shows important differences between mouse and human gut epithelium, and reveals insight into how the epithelium responds to the environment and drugs. This comprehensive cell atlas of the healthy adult human intestinal epithelium resolves likely functional differences across anatomic regions along the gastrointestinal tract and advances our understanding of human intestinal physiology. Single-cell transcriptomics offer unprecedented resolution of tissue function at the cellular level, yet studies analyzing healthy adult human small intestine and colon are sparse. Here, we present single-cell transcriptomics covering the duodenum, jejunum, ileum, and ascending, transverse, and descending colon from 3 human beings. A total of 12,590 single epithelial cells from 3 independently processed organ donors were evaluated for organ-specific lineage biomarkers, differentially regulated genes, receptors, and drug targets. Analyses focused on intrinsic cell properties and their capacity for response to extrinsic signals along the gut axis across different human beings. Cells were assigned to 25 epithelial lineage clusters. Multiple accepted intestinal stem cell markers do not specifically mark all human intestinal stem cells. Lysozyme expression is not unique to human Paneth cells, and Paneth cells lack expression of expected niche factors. Bestrophin 4 (BEST4)+ cells express Neuropeptide Y (NPY) and show maturational differences between the small intestine and colon. Tuft cells possess a broad ability to interact with the innate and adaptive immune systems through previously unreported receptors. Some classes of mucins, hormones, cell junctions, and nutrient absorption genes show unappreciated regional expression differences across lineages. The differential expression of receptors and drug targets across lineages show biological variation and the potential for variegated responses. Our study identifies novel lineage marker genes, covers regional differences, shows important differences between mouse and human gut epithelium, and reveals insight into how the epithelium responds to the environment and drugs. This comprehensive cell atlas of the healthy adult human intestinal epithelium resolves likely functional differences across anatomic regions along the gastrointestinal tract and advances our understanding of human intestinal physiology.}, journal={Cellular and molecular gastroenterology and hepatology}, year={2022}, month={Feb} }
 @article{a metformin-responsive metabolic pathway controls distinct steps in gastric progenitor fate decisions and maturation._2020, url={https://doi.org/10.1016/j.stem.2020.03.006}, DOI={10.1016/j.stem.2020.03.006}, abstractNote={<h2>Summary</h2> Cellular metabolism plays important functions in dictating stem cell behaviors, although its role in stomach epithelial homeostasis has not been evaluated in depth. Here, we show that the energy sensor AMP kinase (AMPK) governs gastric epithelial progenitor differentiation. Administering the AMPK activator metformin decreases epithelial progenitor proliferation and increases acid-secreting parietal cells (PCs) in mice and organoids. AMPK activation targets Krüppel-like factor 4 (KLF4), known to govern progenitor proliferation and PC fate choice, and PGC1α, which we show controls PC maturation after their specification. PC-specific deletion of AMPKα or PGC1α causes defective PC maturation, which could not be rescued by metformin. However, metformin treatment still increases KLF4 levels and suppresses progenitor proliferation. Thus, AMPK activates KLF4 in progenitors to reduce self-renewal and promote PC fate, whereas AMPK-PGC1α activation within the PC lineage promotes maturation, providing a potential suggestion for why metformin increases acid secretion and reduces gastric cancer risk in humans.}, journal={Cell stem cell}, year={2020}, month={Apr} }
 @article{proliferation and differentiation of gastric mucous neck and chief cells during homeostasis and injury-induced metaplasia._2019, url={https://doi.org/10.1053/j.gastro.2019.09.037}, DOI={10.1053/j.gastro.2019.09.037}, abstractNote={Background & AimsAdult zymogen-producing (zymogenic) chief cells (ZCs) in the mammalian gastric gland base are believed to arise from descending mucous neck cells, which arise from stem cells. Gastric injury, such as from Helicobacter pylori infection in patients with chronic atrophic gastritis, can cause metaplasia, characterized by gastric cell expression of markers of wound-healing; these cells are called spasmolytic polypeptide-expressing metaplasia (SPEM) cells. We investigated differentiation and proliferation patterns of neck cells, ZCs, and SPEM cells in mice.MethodsC57BL/6 mice were given intraperitoneal injections of high-dose tamoxifen to induce SPEM or gavaged with H pylori (PMSS1) to induce chronic gastric injury. Mice were then given pulses of 5-bromo-2ʹ-deoxyuridine (BrdU) in their drinking water, followed by chase periods without BrdU, or combined with intraperitoneal injections of 5-ethynyl-2ʹ-deoxyuridine. We collected gastric tissues and performed immunofluorescence and immunohistochemical analyses to study gastric cell proliferation, differentiation, and turnover.ResultsAfter 8 weeks of continuous BrdU administration, fewer than 10% of homeostatic ZCs incorporated BrdU, whereas 88% of neck cells were labeled. In pulse-chase experiments, various chase periods decreased neck cell label but did not increase labeling of ZCs. When mice were given BrdU at the same time as tamoxifen, more than 90% of cells were labeled in all gastric lineages. After 3 months’ recovery (no tamoxifen), ZCs became the predominant BrdU-labeled population, whereas other cells, including neck cells, were mostly negative. When we tracked the labeled cells in such mice over time, we observed that the proportion of BrdU-positive ZCs remained greater than 60% up to 11 months. In mice whose ZCs were the principal BrdU-positive population, acute injury by tamoxifen or chronic injury by H pylori infection resulted in SPEM cells becoming the principal BrdU-positive population. After withdrawal of tamoxifen, BrdU-positive ZCs reappeared.ConclusionsWe studied mice in homeostasis or with tamoxifen- or H pylori–induced SPEM. Our findings indicated that mucous neck cells do not contribute substantially to generation of ZCs during homeostasis and that ZCs maintain their own census, likely through infrequent self-replication. After metaplasia-inducing injury, ZCs can become SPEM cells, and then redifferentiate into ZCs on injury resolution. Adult zymogen-producing (zymogenic) chief cells (ZCs) in the mammalian gastric gland base are believed to arise from descending mucous neck cells, which arise from stem cells. Gastric injury, such as from Helicobacter pylori infection in patients with chronic atrophic gastritis, can cause metaplasia, characterized by gastric cell expression of markers of wound-healing; these cells are called spasmolytic polypeptide-expressing metaplasia (SPEM) cells. We investigated differentiation and proliferation patterns of neck cells, ZCs, and SPEM cells in mice. C57BL/6 mice were given intraperitoneal injections of high-dose tamoxifen to induce SPEM or gavaged with H pylori (PMSS1) to induce chronic gastric injury. Mice were then given pulses of 5-bromo-2ʹ-deoxyuridine (BrdU) in their drinking water, followed by chase periods without BrdU, or combined with intraperitoneal injections of 5-ethynyl-2ʹ-deoxyuridine. We collected gastric tissues and performed immunofluorescence and immunohistochemical analyses to study gastric cell proliferation, differentiation, and turnover. After 8 weeks of continuous BrdU administration, fewer than 10% of homeostatic ZCs incorporated BrdU, whereas 88% of neck cells were labeled. In pulse-chase experiments, various chase periods decreased neck cell label but did not increase labeling of ZCs. When mice were given BrdU at the same time as tamoxifen, more than 90% of cells were labeled in all gastric lineages. After 3 months’ recovery (no tamoxifen), ZCs became the predominant BrdU-labeled population, whereas other cells, including neck cells, were mostly negative. When we tracked the labeled cells in such mice over time, we observed that the proportion of BrdU-positive ZCs remained greater than 60% up to 11 months. In mice whose ZCs were the principal BrdU-positive population, acute injury by tamoxifen or chronic injury by H pylori infection resulted in SPEM cells becoming the principal BrdU-positive population. After withdrawal of tamoxifen, BrdU-positive ZCs reappeared. We studied mice in homeostasis or with tamoxifen- or H pylori–induced SPEM. Our findings indicated that mucous neck cells do not contribute substantially to generation of ZCs during homeostasis and that ZCs maintain their own census, likely through infrequent self-replication. After metaplasia-inducing injury, ZCs can become SPEM cells, and then redifferentiate into ZCs on injury resolution.}, journal={Gastroenterology}, year={2019}, month={Oct} }
 @article{plasticity of differentiated cells in wound repair and tumorigenesis, part i: stomach and pancreas._2018, url={http://europepmc.org/articles/PMC6078397}, DOI={10.1242/dmm.033373}, abstractNote={For the last century or so, the mature, differentiated cells throughout the body have been regarded as largely inert with respect to their regenerative potential, yet recent research shows that they can become progenitor-like and re-enter the cell cycle. Indeed, we recently proposed that mature cells can become regenerative via a conserved set of molecular mechanisms ('paligenosis'), suggesting that a program for regeneration exists alongside programs for death (apoptosis) and division (mitosis). In two Reviews describing how emerging concepts of cellular plasticity are changing how the field views regeneration and tumorigenesis, we present the commonalities in the molecular and cellular features of plasticity at homeostasis and in response to injury in multiple organs. Here, in part 1, we discuss these advances in the stomach and pancreas. Understanding the extent of cell plasticity and uncovering its underlying mechanisms may help us refine important theories about the origin and progression of cancer, such as the cancer stem cell model, as well as the multi-hit model of tumorigenesis. Ultimately, we hope that the new concepts and perspectives on inherent cellular programs for regeneration and plasticity may open novel avenues for treating or preventing cancers.}, journal={Disease models & mechanisms}, year={2018}, month={Jul} }
 @article{plasticity of differentiated cells in wound repair and tumorigenesis, part ii: skin and intestine._2018, url={http://europepmc.org/articles/PMC6177008}, DOI={10.1242/dmm.035071}, abstractNote={ABSTRACT Recent studies have identified and begun to characterize the roles of regenerative cellular plasticity in many organs. In Part I of our two-part Review, we discussed how cells reprogram following injury to the stomach and pancreas. We introduced the concept of a conserved cellular program, much like those governing division and death, which may allow mature cells to become regenerative. This program, paligenosis, is likely necessary to help organs repair the numerous injuries they face over the lifetime of an organism; however, we also postulated that rounds of paligenosis and redifferentiation may allow long-lived cells to accumulate and store oncogenic mutations, and could thereby contribute to tumorigenesis. We have termed the model wherein differentiated cells can store mutations and then unmask them upon cell cycle re-entry the ‘cyclical hit’ model of tumorigenesis. In the present Review (Part II), we discuss these concepts, and cell plasticity as a whole, in the skin and intestine. Although differentiation and repair are arguably more thoroughly studied in skin and intestine than in stomach and pancreas, it is less clear how mature skin and intestinal cells contribute to tumorigenesis. Moreover, we conclude our Review by discussing plasticity in all four organs, and look for conserved mechanisms and concepts that might help advance our knowledge of tumor formation and advance the development of therapies for treating or preventing cancers that might be shared across multiple organs.}, journal={Disease models & mechanisms}, year={2018}, month={Aug} }
 @article{regenerative proliferation of differentiated cells by mtorc1-dependent paligenosis._2018, url={http://europepmc.org/articles/PMC5881627}, DOI={10.15252/embj.201798311}, abstractNote={In 1900, Adami speculated that a sequence of context-independent energetic and structural changes governed the reversion of differentiated cells to a proliferative, regenerative state. Accordingly, we show here that differentiated cells in diverse organs become proliferative via a shared program. Metaplasia-inducing injury caused both gastric chief and pancreatic acinar cells to decrease mTORC1 activity and massively upregulate lysosomes/autophagosomes; then increase damage associated metaplastic genes such as Sox9; and finally reactivate mTORC1 and re-enter the cell cycle. Blocking mTORC1 permitted autophagy and metaplastic gene induction but blocked cell cycle re-entry at S-phase. In kidney and liver regeneration and in human gastric metaplasia, mTORC1 also correlated with proliferation. In lysosome-defective Gnptab-/- mice, both metaplasia-associated gene expression changes and mTORC1-mediated proliferation were deficient in pancreas and stomach. Our findings indicate differentiated cells become proliferative using a sequential program with intervening checkpoints: (i) differentiated cell structure degradation; (ii) metaplasia- or progenitor-associated gene induction; (iii) cell cycle re-entry. We propose this program, which we term "paligenosis", is a fundamental process, like apoptosis, available to differentiated cells to fuel regeneration following injury.}, journal={The EMBO journal}, year={2018}, month={Feb} }
 @article{burclaff_mills_2017, title={Cell biology: Healthy skin rejects cancer}, volume={548}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85027870170&partnerID=MN8TOARS}, DOI={10.1038/nature23534}, number={7667}, journal={Nature}, author={Burclaff, J. and Mills, J.C.}, year={2017}, pages={289–290} }
 @article{metaplastic cells in the stomach arise, independently of stem cells, via dedifferentiation or transdifferentiation of chief cells._2017, url={http://europepmc.org/articles/PMC5847468}, DOI={10.1053/j.gastro.2017.11.278}, abstractNote={Spasmolytic polypeptide-expressing metaplasia (SPEM) develops in patients with chronic atrophic gastritis due to infection with Helicobacter pylori; it might be a precursor to intestinal metaplasia and gastric adenocarcinoma. Lineage tracing experiments of the gastric corpus in mice have not established whether SPEM derives from proliferating stem cells or differentiated, post-mitotic zymogenic chief cells in the gland base. We investigated whether differentiated cells can give rise to SPEM using a nongenetic approach in mice. Mice were given intraperitoneal injections of 5-fluorouracil, which blocked gastric cell proliferation, plus tamoxifen to induce SPEM. Based on analyses of molecular and histologic markers, we found SPEM developed even in the absence of cell proliferation. SPEM therefore did not arise from stem cells. In histologic analyses of gastric resection specimens from 10 patients with adenocarcinoma, we found normal zymogenic chief cells that were transitioning into SPEM cells only in gland bases, rather than the proliferative stem cell zone. Our findings indicate that SPEM can arise by direct reprogramming of existing cells-mainly of chief cells.}, journal={Gastroenterology}, year={2017}, month={Dec} }
 @article{burclaff_osaki_liu_goldenring_mills_2017, title={Targeted Apoptosis of Parietal Cells Is Insufficient to Induce Metaplasia in Stomach}, volume={152}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85014316912&partnerID=MN8TOARS}, DOI={10.1053/j.gastro.2016.12.001}, abstractNote={Parietal cell atrophy is considered to cause metaplasia in the stomach. We developed mice that express the diphtheria toxin receptor specifically in parietal cells to induce their death, and found this to increase proliferation in the normal stem cell zone and neck but not to cause metaplastic reprogramming of chief cells. Furthermore, the metaplasia-inducing agents tamoxifen or DMP-777 still induced metaplasia even after previous destruction of parietal cells by diphtheria toxin. Atrophy of parietal cells alone therefore is not sufficient to induce metaplasia: completion of metaplastic reprogramming of chief cells requires mechanisms beyond parietal cell injury or death. Parietal cell atrophy is considered to cause metaplasia in the stomach. We developed mice that express the diphtheria toxin receptor specifically in parietal cells to induce their death, and found this to increase proliferation in the normal stem cell zone and neck but not to cause metaplastic reprogramming of chief cells. Furthermore, the metaplasia-inducing agents tamoxifen or DMP-777 still induced metaplasia even after previous destruction of parietal cells by diphtheria toxin. Atrophy of parietal cells alone therefore is not sufficient to induce metaplasia: completion of metaplastic reprogramming of chief cells requires mechanisms beyond parietal cell injury or death. Gastric metaplasia consistently occurs after parietal cell atrophy in autoimmune gastritis patients,1Adams J.F. et al.Lancet. 1964; 1: 401-403Abstract PubMed Scopus (27) Google Scholar in Helicobacter pylori–induced atrophic gastritis,2Lennerz J.K. et al.Am J Pathol. 2010; 177: 1514-1533Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar and in animal models of acute injury.3Huh W.J. Khurana S.S. et al.Gastroenterology. 2012; 142: 21-24.e27Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 4Nomura S. Yamaguchi H. et al.Am J Physiol Gastrointest Liver Physiol. 2005; 288: G362-G375Crossref PubMed Scopus (120) Google Scholar Thus, it has been proposed that parietal cell death causes metaplasia, perhaps because parietal cells elaborate gastric-differentiation–promoting factors whose loss elicits aberrant (metaplastic) differentiation of remaining cells. Alternatively, parietal cell death could cause a metaplasia-promoting immune response, or injured parietal cells might release metaplasia-promoting factors before dying. Here, to test the role of parietal cells in metaplasia, we developed a method to precisely kill parietal cells in adults. We bred parietal cell–specific, Cre-inducible simian diphtheria toxin receptor (Atp4b-Cre;LSL-DTR) mice (DTR mice) (Supplementary Figure 1), in which parietal cells alone respond to apoptosis-inducing diphtheria toxin. As a positive control for parietal cell atrophy and spasmolytic polypeptide-expressing metaplasia (SPEM), the metaplasia seen in direct temporal and spatial correlation with human and mouse parietal cell atrophy,2Lennerz J.K. et al.Am J Pathol. 2010; 177: 1514-1533Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar we used a previously described system3Huh W.J. Khurana S.S. et al.Gastroenterology. 2012; 142: 21-24.e27Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 5Saenz J.B. et al.Methods Mol Biol. 2016; 1422: 329-339Crossref PubMed Google Scholar, 6Matsuo J. et al.Gastroenterology. 2017; 152: 218-231.e14Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar involving 3 daily injections of high-dose (5 mg/20 g body mass) tamoxifen (TAM). Consistent with previous results, TAM caused more than 90% parietal cell atrophy and increased proliferation throughout the gastric unit. The pathognomonic pattern for SPEM was identified in more than 75% of units: gastric intrinsic factor (GIF+) chief cells at the unit base co-expressing the epitope for the Griffonia simplicifolia lectin II (GSII). Many SPEM cells were proliferative (Figure 1A and B, yellow arrowheads). Three daily injections with 225 ng DT also killed more than 90% of parietal cells and increased proliferation from the isthmus through the neck (Figure 1A–C). Both atrophy and proliferation were maintained for up to 14 days, whereas complete recovery occurred at that time point if injections were ceased at day 3 (Figure 1C). To confirm that DT directly targeted parietal cells, we grew gastroids from DTR × Rosa26/loxP-membrane tdTomato-loxP-membrane green fluorescent protein (mTmG) reporter mice in which DTR-expressing parietal cells also express membrane-associated enhanced green fluorescent protein (eGFP) (Supplementary Figure 1). Control gastroids showed negligible death (Supplementary Figure 2), whereas DT caused specific extrusion of enhanced GFP+ cells without change in gastroid size or number. Thus, DT specifically kills parietal cells. In contrast to TAM, DT never caused substantial SPEM at any time point (N > 40 total mice examined). Proliferation occurred in the isthmus and neck, but not in the base (Figure 1A and B). SPEM is thought to arise in part from re-entry of chief cells into the cell cycle.7Mills J.C. Sansom O.J. Sci Signal. 2015; 8: re8Crossref PubMed Scopus (95) Google Scholar, 8Nam K.T. et al.Gastroenterology. 2010; 139: 2028-2037 e2029Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar We observed that chief cells after TAM had the expected simple columnar morphology, with scant GIF observed in SPEM cells, whereas chief cells after DT maintained largely normal morphology with apical GIF granules still apparent, even through day 14 (Figure 1D and Supplementary Figure 3A). We quantified neck cells (GSII+), chief cells (GIF+), and GSII+/GIF+ cells, and their proliferative activity (Figure 1E and F). DT did not significantly change GIF+ or GSII+/GIF+ cell census vs control; however, TAM caused loss of chief cells and increased co-staining cells. DT and TAM both increased proliferation in unlabeled isthmal and neck cells, whereas TAM also increased proliferating, GSII+/GIF+ SPEM cells. We next analyzed additional markers of SPEM. The mouse ortholog of CD44 variant 9,9Wada T. et al.Cancer Sci. 2013; 104: 1323-1329Crossref PubMed Scopus (64) Google Scholar neck cell marker trefoil factor 2 (TFF2), and secreted SPEM marker Clusterin10Weis V.G. et al.Gut. 2013; 62: 1270-1279Crossref PubMed Scopus (75) Google Scholar all were increased only in the proliferative neck of DT-treated mice, whereas TAM increased expression in both the neck and base (Supplementary Figure 3B–D). Thus, by all markers, parietal cell apoptosis alone was insufficient to cause metaplasia. We next performed quantitative analyses of normal and metaplastic differentiation markers. GIF and the critical chief cell differentiation factor MIST1 (BHLHA15) decreased across the gastric corpus in DT mice; however, both were substantially lower in TAM mice (Supplementary Figure 4). SPEM markers Clusterin and HE4 (Wfdc2)11Nozaki K. et al.Gastroenterology. 2008; 134: 511-522Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar also were increased significantly only after TAM (Supplementary Figure 4). TAM alone caused significantly increased expression of 6 other genes involved in metaplasia and the immune response (Cd14, Ceacam10, Cftr, Ctss, Dmbt1, and Vil1), with both treatments increasing proliferation-related transcripts (Ccnb2 and Chek2) (Supplementary Figure 4). These results argued against the model wherein parietal cells constitutively elaborate differentiation-promoting factors because chief cells were maintained after parietal cell death. However, it still was possible that parietal cell atrophy caused metaplasia: perhaps parietal cells dying via H pylori infection or TAM, but not DT, release metaplasia-inducing signals when injured. If true, metaplasia should not occur in mice with parietal cells already killed. Thus, we injected DTR mice with DT to kill parietal cells first and then co-injected DT and TAM for 3 days (DT+TAM). Five days of DT injection caused increased isthmal/neck proliferation without SPEM; however, TAM after DT caused proliferative SPEM similar to TAM alone (Figure 2A–C). Similar results were obtained with another atrophy/SPEM-inducing agent: DMP-777 ([S-(R∗,S∗)]-N-[1-(1,3-benzodioxol-5-yl)butyl]-3,3-diethyl-2- [4-[(4-methyl-1-piperazinyl)carbonyl]phenoxy]-4-oxo-1-azetidine carboxamide).4Nomura S. Yamaguchi H. et al.Am J Physiol Gastrointest Liver Physiol. 2005; 288: G362-G375Crossref PubMed Scopus (120) Google Scholar DMP-777 treatment caused SPEM equally effectively even with parietal cells already killed (Figure 2D–F and Supplementary Figure 5). Therefore, SPEM can occur without substances released from injured parietal cells. Overall, our results show that parietal cell atrophy alone is insufficient to induce metaplasia, and signals from injured/dying parietal cells are not necessary for metaplasia induction. In addition, DTR mice increased proliferation only in the isthmal progenitor zone and neck, whereas TAM/DMP777 treatment showed these plus proliferative basal metaplastic cells. The number of metaplastic (GIF+/GSII+) cells arising in the base was approximately equivalent to the decrease in differentiated GIF+ GSII− only chief cells (Figure 1E and F). Thus, parietal cell atrophy alone can cause isthmal stem cell and mucous neck cell proliferation; however, the rapid emergence of basal metaplastic cells likely involves an additional basal cellular source. Our results, therefore, favor a model (supported by Matsuo et al6Matsuo J. et al.Gastroenterology. 2017; 152: 218-231.e14Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar) identifying 2 distinct zones of proliferation that can expand during injury: the isthmus/neck,12Hayakawa Y. Ariyama H. et al.Cancer Cell. 2015; 28: 800-814Abstract Full Text Full Text PDF PubMed Scopus (203) Google Scholar, 13Khurana S.S. et al.J Biol Chem. 2013; 288: 16085-16097Crossref PubMed Scopus (85) Google Scholar and a more mature cell of the chief cell lineage that reprograms to co-label with neck cell markers and re-enter the cell cycle.6Matsuo J. et al.Gastroenterology. 2017; 152: 218-231.e14Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 7Mills J.C. Sansom O.J. Sci Signal. 2015; 8: re8Crossref PubMed Scopus (95) Google Scholar, 8Nam K.T. et al.Gastroenterology. 2010; 139: 2028-2037 e2029Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar The re-entry of differentiated secretory cells to serve as progenitors resonates with emerging work on pancreatic acinar cell plasticity and quiescent intestinal stem cells.7Mills J.C. Sansom O.J. Sci Signal. 2015; 8: re8Crossref PubMed Scopus (95) Google Scholar Earlier work showed that, with constitutive absence of parietal cells throughout development, mature chief cells never emerge, and gastric units show abundant isthmal, pre-neck, neck, and neck/chief co-labeled cells.14Li Q. et al.J Biol Chem. 1996; 271: 3671-3676Crossref PubMed Scopus (184) Google Scholar It is unclear whether that signifies SPEM or simply a failure of units without parietal cells to ever adopt the adult pattern with distinct neck and chief cell zones (juvenile gastric units are SPEM-like15Keeley T.M. Samuelson L.C. Am J Physiol Gastrointest Liver Physiol. 2010; 299: G1241-G1251Crossref PubMed Scopus (41) Google Scholar). The usefulness of those mice as a model for adult-onset atrophy/metaplasia thus may be limited. Future progress in understanding the process of chief cell reprogramming will require a system allowing perpetual induced parietal cell atrophy to determine if long-term parietal cell absence is sufficient to induce SPEM. In any case, our current results suggest that parietal cell loss alone is insufficient to directly induce SPEM and that metaplasia induction may require additional unidentified factors (eg, cytokines or specific immune cell activation) that recruit chief cells back into the cell cycle. Joseph Burclaff was responsible for the study concept and design, data acquisition, analysis, and interpretation of all mouse work, and drafting the manuscript; Luciana H. Osaki and Dengqun Liu were responsible for data collection and analysis; James R. Goldenring performed data interpretation, supplied a reagent, and edited the manuscript; and Jason C. Mills was responsible for the study concept and design, analysis and interpretation of data, statistical analysis, funding, supervision, and editing. All experiments involving animals were performed according to protocols approved by the Washington University School of Medicine Animal Studies Committee. Mice were maintained in a specified pathogen-free barrier facility under a 12-hour light cycle. Wild-type C57BL/6, Gt(ROSA)26Sortm1(HBEGF)Awai (inducible DTR),1Buch T. et al.Nat Methods. 2005; 2: 419-426Crossref PubMed Scopus (600) Google Scholar and B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J (mT/mG)2Muzumdar M.D. et al.Genesis. 2007; 45: 593-605Crossref PubMed Scopus (2258) Google Scholar mice all were purchased from Jackson Laboratories (Bar Harbor, ME). ATP4b-Cre mice3Syder A.J. et al.Proc Natl Acad Sci U S A. 2004; 101: 4471-4476Crossref PubMed Scopus (87) Google Scholar were crossed with inducible DTR mice, which express the inducible simian diphtheria toxin receptor under the control of the Rosa26 promoter. Littermate controls were housed together when possible to minimize differences in gastric microflora. To selectively kill parietal cells, diphtheria toxin (225 ng/mouse; Sigma, St Louis, MO) was injected intraperitoneally 1 or 3 times per day. Because parietal cells die at a comparable rate with those previously published with D3 TAM, most analysis was performed at day 3 of DT. Diphtheria toxin was dissolved in sterile 0.9% sodium chloride saline. To induce SPEM, tamoxifen (5 mg/20 g body weight; Toronto Research Chemicals, Inc, Toronto, Canada) was injected intraperitoneally daily for 3 days4Saenz J.B. et al.Methods Mol Biol. 2016; 1422: 329-339Crossref PubMed Scopus (35) Google Scholar or DMP-777 (7 mg/20 g body weight, a gift from DuPont-Merck Corporation, Rahway, NJ) was gavaged daily for 14 days. Tamoxifen was dissolved in a vehicle of 10% ethanol and 90% sunflower oil (Sigma), and DMP-777 was suspended in 1% methylcellulose (Sigma) in distilled H2O. Mice were given an intraperitoneal injection containing 5-bromo-2’-deoxyuridine (120 mg/kg) and 5-fluoro-2’-deoxyuridine (12 mg/kg) in sterile water 90 minutes before death. After death, stomachs immediately were excised and flushed with phosphate-buffered saline, then pinned out and fixed in freshly prepared methacarn (60% methanol, 30% chloroform, and 10% glacial acetic acid) for 20 minutes, and stored overnight in 70% ethanol. Tissues were arranged in 3% agar in a tissue cassette, underwent routine paraffin processing, and 5-μm sections were cut and mounted on glass slides. Sections underwent a standard deparaffinization and rehydration protocol, were blocked in 1% bovine serum albumin and 0.3% Triton X-100 in phosphate-buffered saline, left overnight with primary antibodies, washed in phosphate-buffered saline, and incubated for 1 hour with secondary antibodies, washed, incubated for 5 minutes in 1 g/mL bisbenzimide (Molecular Probes, Eugene, OR), washed, and then mounted using glycerol:phosphate-buffered saline. Primary antibodies used in this study were as follows: rabbit anti-human gastric intrinsic factor (1:10,000; a gift from Dr David Alpers, Washington University, St Louis, MO), goat anti–5-bromo-2’-deoxyuridine (1:20,000; a gift from Dr Jeff Gordon, Washington University, St Louis, MO), goat anti–vascular endothelial factor B (1:100; Santa Cruz Biotechnology, Santa Cruz, CA), goat anti-clusterin (1:100; Santa Cruz Biotechnology), mouse anti–E-cadherin (1:200; BD Biosciences, Franklin Lanes, NJ), rabbit anti-GFP (1:100; Santa Cruz Biotechnology), mouse anti–trefoil factor 2 (1:500; Abcam, Cambridge, MA), rat anti-CD44 v10-e16, ortholog of human v9 (1:200; Cosmo Bio, Tokyo, Japan), or 1 g/mL fluorescently labeled GSII lectin (Alexa Fluor 488 and 594; Molecular Probes). Secondary antibodies included AlexaFluor (488, 594, or 647) conjugated donkey anti-goat, anti-rabbit, or anti-mouse (1:500; Molecular Probes). All time points were quantified with at least 3 mice, with representatives from both sexes. Stomachs were stained fluorescently with bisbenzimide and either anti–5-bromo-2’-deoxyuridine or anti–vascular endothelial growth factor B markers along with the neck cell marker GSII lectin and zymogenic cell marker anti-GIF. Images were captured as TIFF files from a Zeiss Axiovert 200 microscope with an Axiocam MRM camera with an Apotome optical sectioning filter (Carl Zeiss, Jena, Germany). Each stomach had at least 5 images taken containing 10 or more well-oriented gastric units each. Units were counted using the neck staining, and total quantifications of proliferating cells (5-bromo-2’-deoxyuridine+) or parietal cells (vascular endothelial growth factor B+)5Mills J.C. et al.J Biol Chem. 2003; 278: 46138-46145Crossref PubMed Scopus (32) Google Scholar were averaged over the total unit numbers per mouse. For quantifying units showing SPEM, SPEM was defined exclusively in corpus gastric units as either 5 or more cells per unit co-expressing GSII and GIF or GSII-expressing cells extending to the base of the unit. Tissue was lysed with Direct polymerase chain reaction reagent (Viagen Biotech, Inc, Los Angeles, CA) with added Proteinase K (New England BioLabs, Ipswich, MA) at 55°C for 11 hours, then at 85°C for 15 minutes. Genotyping polymerase chain reaction was run with Redtaq (Sigma). The primers used were as follows: H+/K+ATPase-Cre forward: AGGGATCGCCAGGCGTTTTC, reverse: GTTTTCTTTTCGGATCCGCC. Gastric glands from the corpus of the stomach were isolated from Atp4b-Cre;LSL-DTR; ROSAmT/mG mice2Muzumdar M.D. et al.Genesis. 2007; 45: 593-605Crossref PubMed Scopus (2258) Google Scholar according to Barker et al6Barker N. et al.Cell Stem Cell. 2010; 6: 25-36Abstract Full Text Full Text PDF PubMed Scopus (1115) Google Scholar and Stange et al.7Stange D.E. et al.Cell. 2013; 155: 357-368Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar Whole gastric glands were mixed with Matrigel (BD Biosciences, Franklin Lanes, NJ), distributed in 48-well plates, and grown in Advanced Dulbecco's modified Eagle medium/F12 medium (Invitrogen, Carlsbad, CA), 50% Wnt3a conditioned medium, 10% R-Spondin1, and Noggin conditioned medium supplemented with 10 mmol/L HEPES, 1× N-2, 1× B27, 1× glutaMAX (Invitrogen), 2.5 mmol/L N-Acetylcysteine (Sigma-Aldrich, St Louis, MO), 50 ng/mL epidermal growth factor, 100 ng/mL fibroblast growth factor 10 (Peprotech, Rocky Hill, NJ), and 10 nmol/L gastrin (Sigma-Aldrich). A total of 10 μmol/L Rho-associated, coiled-coil containing protein kinase (ROCK) inhibitor (Y-27632; Sigma-Aldrich) was provided for the first 3 days. Three days after initial culturing, gastroids were treated with 10 ng/mL diphtheria toxin in the absence of Wnt3a, R-Spondin 1, and Noggin. Fresh medium containing DT was added the following day. By using Cytation 3 (Biotek, Winooski, VT), all wells were scanned microscopically every 24 hours throughout the whole experiment, and the number of dead gastroids was scored. Total RNA was extracted from corpus stomach tissue using the RNeasy Mini Kit (Qiagen, Valencia, CA). RNA was treated with DNAse I, and then complementary DNA was synthesized with Superscript III (Invitrogen) and random primers. Quantitative reverse-transcription polymerase chain reaction was performed using PowerUp SYBR Green Master Mix (ThermoFisher, Waltham, MA) and gene-specific primers (Supplementary Table 1) on a QuantStudio 3 polymerase chain reaction system (ThermoFisher), and data were analyzed using QuantStudio Design and Analysis Software. Every run was standardized to TATA box binding protein primers. All primers were exon-spanning when possible (ie, for genes having multiple exons of sufficient length). For a full list of primers, see Supplementary Table 1. All graphs and statistics were completed in GraphPad Prism (La Jolla, CA), using 1-way analysis of variance with either the Dunnett or the Tukey post hoc multiple comparison tests to determine significance.Supplementary Figure 2DT specifically kills parietal cells in gastroids. (A) Gastroids from DTR mice with the Atp4b+ parietal cell lineage fluorescing green (Atp4b-Cre;LSL-DTR;ROSAmTmG mice) and all other lineages in red. The same gastroids were monitored over 3 days of control or DT treatment. Note that DT treatment does not affect gastroid survival, but parietal cells specifically are extruded into lumen of gastroids by day 1 (inset: arrowheads), and then are largely gone by day 3. Parietal cells extrusion, which is consistent with cell death in these cultures, does not occur in controls. (B) Immunofluorescence co-staining with anti-GFP (green) and anti–parietal cell marker H+/K+ATPase (red) antibodies. ATPase, adenosine triphosphatase.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure 3Changes in protein localization for markers of SPEM and chief cell differentiation after TAM and DT. (A) Base of day 14 DT-treated unit with anti–E-cadherin (green) and anti-GIF (red). (B–D) Immunofluorescence of stomachs after 3 days of vehicle, DT, or TAM injections. (B) Red, CD44v; green, GSII; magenta, 5-bromo-2’-deoxyuridine. (C) Red, GIF; green, trefoil factor 2. (D) Red, GIF; green, clusterin.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure 4Quantitative real-time polymerase chain reaction of selected transcripts implicated in SPEM. Transcripts were analyzed from RNA isolated from the whole gastric corpus of mice treated with vehicle, DT, or TAM for 3 days. Twelve transcripts with significant changes in experimental groups compared with control. *P ≤ .05 and **P ≤ .01.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure 5DMP-777 control showing deletion of parietal cells. Immunofluorescence of stomachs after 16 days control, DT, or DT then DMP-777 for the parietal cells marker vascular endothelial growth factor B (VEGFB) (red).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Table 1Quantitative RT-PCR Primer SequencesGeneForward primer 5′→3′Reverse primer 3′→5′TBPCAAACCCAGAATTGTTCTCCTTATGTGGTCTTCCTGAATCCCTGIFGAAAAGTGGATCTGTGCTACTTGCTAGACAATAAGGCCCCAGGATGMist1GAGCGAGAGAGGCAGCGGATGAGTAAGTATGGTGGCGGTCAGTFF2TGCTTTGATCTTGGATGCTGGGAAAAGCAGCAGTTTCGACClusterinCCAGCCTTTCTTTGAGATGACTCCTGGCACTTTTCACACTWfdc2/HE4TGCCTGCCTGTCGCCTCTGTGTCCGCACAGTCCTTGTCCAMal2GCTTTCGTCTGTCTGGAGATTGACACAAACATGACCCATCCTTGArhgap9TGCTGCCTGACTTTCGTGATGGCGGTCATTCGGTTCTTATCCCasp1GAAAGACAAGCCCAAGGTGATGGTGTTGAAGAGCAGAAAGCACcnb2TGAAGTCCTGGAAGTCATGCGAGGCCAGGTCTTTGATGATCD14CTCTGTCCTTAAAGCGGCTTACGTTGCGGAGGTTCAAGATGTTCeacam1CCTCAGCACATCTCCACAAAGTATAGCCGTAGTGTTTCCCTTGCeacam10CTCCGATTTCTGTGCGATTTCGTCCGTGGCAGATTGTGAACCenpkAATACTGGACACTCTTAACGGGATCTTAGTTGTCAGTTCATCFTRCTGGACCACACCAATTTTGAGGGCGTGGATAAGCTGGGGATChek2TCGGCTATGGGCTCTTCACGTCCTTCTCAACAGTGGTCCtssTCTATGACGACCCCTCCTGTTGCCATCCGAATGTATCCTTCxcl17AGGTGGCTCTTGGAAGGTGCTCTGGAGGGTCTTTGCGADmbt1ACCTCCTCACGGTGCTACAGGCTTCTTCACATCCTCCACTGETV5GCTCTTGGTGCTAAGTAGGATCTGATGGGTGGGTGACAFignl1TTATATTCCCCTCCCAGAAGCGCCAGAAAACCCATCAGACTGlipr1CCAGCTTCGGTCAAAAGTGAGTGGGTGTATCCGTGAATGCAGGpx2CAGGGCTGTGCTGATTGAGCGGACATACTTGAGGCTGTTCLy6aGACTTCTTGCCCATCAATTACCTTAGTACCCAGGATCTCCATACLyz2GCCAGAACTCTGAAAAGGAATGCTTTGGTCTCCACGGTTGTAGMad2l1TGCTTACAACTACTGACCCCGACTGCCATCTTTCAAGGACTTCMmp12CATGAAGCGTGAGGATGTAGACCTAGTGTACCACCTTTGCCAMs4a6bTCCCTCCAATCTACACTTTACCGACTTTGTCTCCGTGACGATGMs4a6cAAAAGACGAGTCCCAGCCTACATGGGACAGGAGGAACAGATGMuc4GCTGCCTGTATTCTTGCCTATGTTCTGGTGCTGCTGGAPigrGATTTGGGAGGCAATGACAACGCTTTCTTGGATTCTTCTGGCProm1TGGATAACACAGGAAGGAAGAGCAGGGTAGAGGCAAATGTCAGSlfn9TCCTTAGTGGTGAAACGGTCTTCAGGTTGCTCACTCTGGTTGTmem48GCTGCTACAAATGGGAGGATCACGGAAGGCGTCTGACTATop2aCGAAATGGCTATGGAGCTAATATCTTTGTCCAGGCTTTGCTraf4CAGGTGTTAGGCTTGGCTATCCGATTAGGGCAGGGGACTATyrobpGGTGTTGACTCTGCTGATTGCAAGCTCCTGATAAGGCGACTCUbe2cCAACATCTGCCTGGACATCCCTGCTTTGAATAGGTTTCTTGCVil1TCAAAGGCTCTCTCAACATCACGGTGCTGGAAGGAACAGG Open table in a new tab}, number={4}, journal={Gastroenterology}, author={Burclaff, J. and Osaki, L.H. and Liu, D. and Goldenring, J.R. and Mills, J.C.}, year={2017}, pages={762–766} }
 @article{lim_burclaff_he_mills_long_2017, title={Unintended targeting of Dmp1-Cre reveals a critical role for Bmpr1a signaling in the gastrointestinal mesenchyme of adult mice}, volume={5}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85011306014&partnerID=MN8TOARS}, DOI={10.1038/boneres.2016.49}, abstractNote={Cre/loxP technology has been widely used to study cell type-specific functions of genes. Proper interpretation of such data critically depends on a clear understanding of the tissue specificity of Cre expression. The Dmp1-Cre mouse, expressing Cre from a 14-kb DNA fragment of the mouse Dmp1 gene, has become a common tool for studying gene function in osteocytes, but the presumed cell specificity is yet to be fully established. By using the Ai9 reporter line that expresses a red fluorescent protein upon Cre recombination, we find that in 2-month-old mice, Dmp1-Cre targets not only osteocytes within the bone matrix but also osteoblasts on the bone surface and preosteoblasts at the metaphyseal chondro-osseous junction. In the bone marrow, Cre activity is evident in certain stromal cells adjacent to the blood vessels, but not in adipocytes. Outside the skeleton, Dmp1-Cre marks not only the skeletal muscle fibers, certain cells in the cerebellum and the hindbrain but also gastric and intestinal mesenchymal cells that express Pdgfra. Confirming the utility of Dmp1-Cre in the gastrointestinal mesenchyme, deletion of Bmpr1a with Dmp1-Cre causes numerous large polyps along the gastrointestinal tract, consistent with prior work involving inhibition of BMP signaling. Thus, caution needs to be exercised when using Dmp1-Cre because it targets not only the osteoblast lineage at an earlier stage than previously appreciated, but also a number of non-skeletal cell types.}, journal={Bone Research}, author={Lim, J. and Burclaff, J. and He, G. and Mills, J.C. and Long, F.}, year={2017} }
 @inbook{saenz_burclaff_mills_2016, place={New York, NY}, title={Modeling Murine Gastric Metaplasia Through Tamoxifen-Induced Acute Parietal Cell Loss}, url={http://dx.doi.org/10.1007/978-1-4939-3603-8_28}, DOI={10.1007/978-1-4939-3603-8_28}, abstractNote={Parietal cell loss represents the initial step in the sequential progression toward gastric adenocarcinoma. In the setting of chronic inflammation, the expansion of the mucosal response to parietal cell loss characterizes a crucial transition en route to gastric dysplasia. Here, we detail methods for using the selective estrogen receptor modulator tamoxifen as a novel tool to rapidly and reversibly induce parietal cell loss in mice in order to study the mechanisms that underlie these pre-neoplastic events.}, booktitle={Gastrointestinal Physiology and Diseases: Methods and Protocols}, publisher={Springer New York}, author={Saenz, Jose B. and Burclaff, Joseph and Mills, Jason C.}, editor={Ivanov, I. AndreiEditor}, year={2016}, pages={329–339} }
 @article{li_burclaff_anderson_2016, title={Mutations in Mtr4 structural domains reveal their important role in regulating tRNA<inf>i</inf><sup>Met</sup> turnover in saccharomyces cerevisiae and Mtr4p enzymatic activities in vitro}, volume={11}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84958211904&partnerID=MN8TOARS}, DOI={10.1371/journal.pone.0148090}, abstractNote={RNA processing and turnover play important roles in the maturation, metabolism and quality control of a large variety of RNAs thereby contributing to gene expression and cellular health. The TRAMP complex, composed of Air2p, Trf4p and Mtr4p, stimulates nuclear exosome-dependent RNA processing and degradation in Saccharomyces cerevisiae. The Mtr4 protein structure is composed of a helicase core and a novel so-called arch domain, which protrudes from the core. The helicase core contains highly conserved helicase domains RecA-1 and 2, and two structural domains of unclear functions, winged helix domain (WH) and ratchet domain. How the structural domains (arch, WH and ratchet domain) coordinate with the helicase domains and what roles they are playing in regulating Mtr4p helicase activity are unknown. We created a library of Mtr4p structural domain mutants for the first time and screened for those defective in the turnover of TRAMP and exosome substrate, hypomodified tRNAiMet. We found these domains regulate Mtr4p enzymatic activities differently through characterizing the arch domain mutants K700N and P731S, WH mutant K904N, and ratchet domain mutant R1030G. Arch domain mutants greatly reduced Mtr4p RNA binding, which surprisingly did not lead to significant defects on either in vivo tRNAiMet turnover, or in vitro unwinding activities. WH mutant K904N and Ratchet domain mutant R1030G showed decreased tRNAiMet turnover in vivo, as well as reduced RNA binding, ATPase and unwinding activities of Mtr4p in vitro. Particularly, K904 was found to be very important for steady protein levels in vivo. Overall, we conclude that arch domain plays a role in RNA binding but is largely dispensable for Mtr4p enzymatic activities, however the structural domains in the helicase core significantly contribute to Mtr4p ATPase and unwinding activities.}, number={1}, journal={PLoS ONE}, author={Li, Y and Burclaff, J and Anderson, JT}, year={2016}, pages={0148090,} }