@article{bing_willard_manesh_laemthong_crosby_adams_kelly_2023, title={Complete Genome Sequences of Caldicellulosiruptor acetigenus DSM 7040, Caldicellulosiruptor morganii DSM 8990 (RT8.B8), and Caldicellulosiruptor naganoensis DSM 8991 (NA10)}, volume={2}, ISSN={["2576-098X"]}, DOI={10.1128/mra.01292-22}, abstractNote={The genome sequences of three extremely thermophilic, lignocellulolytic Caldicellulosiruptor species were closed, improving previously reported multiple-contig assemblies. All 14 classified Caldicellulosiruptor spp. now have closed genomes. Genome closure will enhance bioinformatic analysis of the species, including identification of carbohydrate-active enzymes (CAZymes) and comparison against other Caldicellulosiruptor species and lignocellulolytic microorganisms.}, journal={MICROBIOLOGY RESOURCE ANNOUNCEMENTS}, author={Bing, Ryan G. G. and Willard, Daniel J. J. and Manesh, Mohamad J. H. and Laemthong, Tunyaboon and Crosby, James R. R. and Adams, Michael W. W. and Kelly, Robert M. M.}, year={2023}, month={Feb} }
 @article{bing_willard_manesh_laemthong_crosby_adams_kelly_2023, title={Complete Genome Sequences of Two Thermophilic Indigenous Bacteria Isolated from Wheat Straw, Thermoclostridium stercorarium subsp. Strain RKWS1 and Thermoanaerobacter sp. Strain RKWS2}, volume={12}, ISSN={["2576-098X"]}, DOI={10.1128/mra.01193-22}, abstractNote={Reported here are complete genome sequences for two anaerobic, thermophilic bacteria isolated from wheat straw, i.e., the (hemi)cellulolytic Thermoclostridium stercorarium subspecies strain RKWS1 (3,029,933 bp) and the hemicellulolytic Thermoanaerobacter species strain RKWS2 (2,827,640 bp). Discovery of indigenous thermophiles in plant biomass suggests that high-temperature microorganisms are more ubiquitous than previously thought.}, number={3}, journal={MICROBIOLOGY RESOURCE ANNOUNCEMENTS}, author={Bing, Ryan G. and Willard, Daniel J. and Manesh, Mohamad J. H. and Laemthong, Tunyaboon and Crosby, James R. and Adams, Michael W. W. and Kelly, Robert M.}, year={2023}, month={Mar} }
 @article{bing_carey_laemthong_willard_crosby_sulis_wang_adams_kelly_2023, title={Fermentative conversion of unpretreated plant biomass: A thermophilic threshold for indigenous microbial growth}, volume={367}, ISSN={["1873-2976"]}, url={http://europepmc.org/abstract/med/36347479}, DOI={10.1016/j.biortech.2022.128275}, abstractNote={Naturally occurring, microbial contaminants were found in plant biomasses from common bioenergy crops and agricultural wastes. Unexpectedly, indigenous thermophilic microbes were abundant, raising the question of whether they impact thermophilic consolidated bioprocessing fermentations that convert biomass directly into useful bioproducts. Candidate microbial platforms for biomass conversion, Acetivibrio thermocellus (basionym Clostridium thermocellum; Topt 60 °C) and Caldicellulosiruptor bescii (Topt 78 °C), each degraded a wide variety of plant biomasses, but only A. thermocellus was significantly affected by the presence of indigenous microbial populations harbored by the biomass. Indigenous microbial growth was eliminated at ≥75 °C, conditions where C. bescii thrives, but where A. thermocellus cannot survive. Therefore, 75 °C is the thermophilic threshold to avoid sterilizing pre-treatments on the biomass that prevents native microbes from competing with engineered microbes and forming undesirable by-products. Thermophiles that naturally grow at and above 75 °C offer specific advantages as platform microorganisms for biomass conversion into fuels and chemicals.}, journal={BIORESOURCE TECHNOLOGY}, author={Bing, Ryan G. and Carey, Morgan J. and Laemthong, Tunyaboon and Willard, Daniel J. and Crosby, James R. and Sulis, Daniel B. and Wang, Jack P. and Adams, Michael W. W. and Kelly, Robert M.}, year={2023}, month={Jan} }
 @article{srougi_corbett_garcia_sabaoun_santisteban_sivaraman_chen_goller_kelly_2023, title={Innovating Life Sciences Laboratory Training: Molecular Biology Laboratory Education Modules (MBLEMs) as a Model for Advanced Training at Diverse Institutions}, volume={299}, ISSN={["1083-351X"]}, DOI={10.1016/j.jbc.2023.103522}, number={3}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Srougi, Melissa and Corbett, Anita and Garcia, Christina and Sabaoun, Michelle and Santisteban, Maria and Sivaraman, Vijay and Chen, Stefanie and Goller, Carlos and Kelly, Robert}, year={2023}, pages={S260–S260} }
 @article{cooper_lewis_notey_mukherjee_willard_blum_kelly_2023, title={Interplay between transcriptional regulators and VapBC toxin-antitoxin loci during thermal stress response in extremely thermoacidophilic archaea}, volume={2}, ISSN={["1462-2920"]}, DOI={10.1111/1462-2920.16350}, abstractNote={Thermoacidophilic archaea lack sigma factors and the large inventory of heat shock proteins (HSPs) widespread in bacterial genomes, suggesting other strategies for handling thermal stress are involved. Heat shock transcriptomes for the thermoacidophilic archaeon Saccharolobus (f. Sulfolobus) solfataricus 98/2 revealed genes that were highly responsive to thermal stress, including transcriptional regulators YtrASs (Ssol_2420) and FadRSs (Ssol_0314), as well as type II toxin–antitoxin (TA) loci VapBC6 (Ssol_2337, Ssol_2338) and VapBC22 (Ssol_0819, Ssol_0818). The role, if any, of type II TA loci during stress response in microorganisms, such as Escherichia coli, is controversial. But, when genes encoding YtrASs, FadRSs, VapC22, VapB6, and VapC6 were systematically mutated in Sa. solfataricus 98/2, significant up-regulation of the other genes within this set was observed, implicating an interconnected regulatory network during thermal stress response. VapBC6 and VapBC22 have close homologues in other Sulfolobales, as well as in other archaea (e.g. Pyrococcus furiosus and Archaeoglobus fulgidus), and their corresponding genes were also heat shock responsive. The interplay between VapBC TA loci and heat shock regulators in Sa solfataricus 98/2 not only indicates a cellular mechanism for heat shock response that differs from bacteria but one that could have common features within the thermophilic archaea.}, journal={ENVIRONMENTAL MICROBIOLOGY}, author={Cooper, Charlotte R. and Lewis, April M. and Notey, Jaspreet S. and Mukherjee, Arpan and Willard, Daniel J. and Blum, Paul H. and Kelly, Robert M.}, year={2023}, month={Feb} }
 @article{lipscomb_crowley_nguyen_keller_hailey c. o'quinn_tanwee_vailionis_zhang_zhang_kelly_et al._2023, title={Manipulating Fermentation Pathways in the Hyperthermophilic Archaeon Pyrococcus furiosus for Ethanol Production up to 95 degrees C Driven by Carbon Monoxide Oxidation}, volume={5}, ISSN={["1098-5336"]}, DOI={10.1128/aem.00012-23}, abstractNote={Previously, the highest temperature for biological ethanol production was 85°C. Here, we have engineered ethanol production at 95°C by the hyperthermophilic archaeon Pyrococcus furiosus .}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Lipscomb, Gina L. and Crowley, Alexander T. and Nguyen, Diep M. N. and Keller, Matthew W. and Hailey C. O'Quinn and Tanwee, Tania N. N. and Vailionis, Jason L. and Zhang, Ke and Zhang, Ying and Kelly, Robert M. and et al.}, year={2023}, month={May} }
 @article{vailionis_zhao_zhang_rodionov_lipscomb_tanwee_hailey c. o'quinn_bing_kelly_adams_et al._2023, title={Optimizing Strategies for Bio-Based Ethanol Production Using Genome-Scale Metabolic Modeling of the Hyperthermophilic Archaeon, Pyrococcus furiosus}, volume={6}, ISSN={["1098-5336"]}, DOI={10.1128/aem.00563-23}, abstractNote={A genome-scale metabolic model, encompassing a total of 623 genes, 727 reactions, and 865 metabolites, was developed for Pyrococcus furiosus, an archaeon that grows optimally at 100°C by carbohydrate and peptide fermentation. The model uses subsystem-based genome annotation, along with extensive manual curation of 237 gene-reaction associations including those involved in central carbon metabolism, amino acid metabolism, and energy metabolism. The redox and energy balance of P. furiosus was investigated through random sampling of flux distributions in the model during growth on disaccharides. The core energy balance of the model was shown to depend on high acetate production and the coupling of a sodium-dependent ATP synthase and membrane-bound hydrogenase, which generates a sodium gradient in a ferredoxin-dependent manner, aligning with existing understanding of P. furiosus metabolism. The model was utilized to inform genetic engineering designs that favor the production of ethanol over acetate by implementing an NADPH and CO-dependent energy economy. The P. furiosus model is a powerful tool for understanding the relationship between generation of end products and redox/energy balance at a systems-level that will aid in the design of optimal engineering strategies for production of bio-based chemicals and fuels. IMPORTANCE The bio-based production of organic chemicals provides a sustainable alternative to fossil-based production in the face of today's climate challenges. In this work, we present a genome-scale metabolic reconstruction of Pyrococcus furiosus, a well-established platform organism that has been engineered to produce a variety of chemicals and fuels. The metabolic model was used to design optimal engineering strategies to produce ethanol. The redox and energy balance of P. furiosus was examined in detail, which provided useful insights that will guide future engineering designs.}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Vailionis, Jason L. and Zhao, Weishu and Zhang, Ke and Rodionov, Dmitry A. and Lipscomb, Gina L. and Tanwee, Tania N. N. and Hailey C. O'Quinn and Bing, Ryan G. and Kelly, Robert M. and Adams, Michael W. W. and et al.}, year={2023}, month={Jun} }
 @article{laemthong_bing_crosby_manesh_adams_kelly_2023, title={Role of cell-substrate association during plant biomass solubilization by the extreme thermophile Caldicellulosiruptor bescii}, volume={27}, ISSN={["1433-4909"]}, DOI={10.1007/s00792-023-01290-7}, number={1}, journal={EXTREMOPHILES}, author={Laemthong, Tunyaboon and Bing, Ryan G. and Crosby, James R. and Manesh, Mohamad J. H. and Adams, Michael W. W. and Kelly, Robert M.}, year={2023}, month={Apr} }
 @article{lewis_willard_manesh_sivabalasarma_albers_kelly_2023, title={Stay or Go: Sulfolobales Biofilm Dispersal Is Dependent on a Bifunctional VapB Antitoxin}, volume={4}, ISSN={["2150-7511"]}, DOI={10.1128/mbio.00053-23}, abstractNote={A type II VapB14 antitoxin regulates biofilm dispersal in the archaeal thermoacidophile Sulfolobus acidocaldarius through traditional toxin neutralization but also through noncanonical transcriptional regulation. Type II VapC toxins are ribonucleases that are neutralized by their proteinaceous cognate type II VapB antitoxin. VapB antitoxins have a flexible tail at their C terminus that covers the toxin's active site, neutralizing its activity. VapB antitoxins also have a DNA-binding domain at their N terminus that allows them to autorepress not only their own promoters but also distal targets. VapB14 antitoxin gene deletion in S. acidocaldarius stunted biofilm and planktonic growth and increased motility structures (archaella). Conversely, planktonic cells were devoid of archaella in the ΔvapC14 cognate toxin mutant. VapB14 is highly conserved at both the nucleotide and amino acid levels across the Sulfolobales, extremely unusual for type II antitoxins, which are typically acquired through horizontal gene transfer. Furthermore, homologs of VapB14 are found across the Crenarchaeota, in some Euryarchaeota, and even bacteria. S. acidocaldarius vapB14 and its homolog in the thermoacidophile Metallosphaera sedula (Msed_0871) were both upregulated in biofilm cells, supporting the role of the antitoxin in biofilm regulation. In several Sulfolobales species, including M. sedula, homologs of vapB14 and vapC14 are not colocalized. Strikingly, Sulfuracidifex tepidarius has an unpaired VapB14 homolog and lacks a cognate VapC14, illustrating the toxin-independent conservation of the VapB14 antitoxin. The findings here suggest that a stand-alone VapB-type antitoxin was the product of selective evolutionary pressure to influence biofilm formation in these archaea, a vital microbial community behavior. IMPORTANCE Biofilms allow microbes to resist a multitude of stresses and stay proximate to vital nutrients. The mechanisms of entering and leaving a biofilm are highly regulated to ensure microbial survival, but are not yet well described in archaea. Here, a VapBC type II toxin-antitoxin system in the thermoacidophilic archaeon Sulfolobus acidocaldarius was shown to control biofilm dispersal through a multifaceted regulation of the archaeal motility structure, the archaellum. The VapC14 toxin degrades an RNA that causes an increase in archaella and swimming. The VapB14 antitoxin decreases archaella and biofilm dispersal by binding the VapC14 toxin and neutralizing its activity, while also repressing the archaellum genes. VapB14-like antitoxins are highly conserved across the Sulfolobales and respond similarly to biofilm growth. In fact, VapB14-like antitoxins are also found in other archaea, and even in bacteria, indicating an evolutionary pressure to maintain this protein and its role in biofilm formation.}, journal={MBIO}, author={Lewis, April M. and Willard, Daniel J. and Manesh, Mohamad J. H. J. and Sivabalasarma, Shamphavi and Albers, Sonja-Verena and Kelly, Robert M.}, year={2023}, month={Apr} }
 @article{bing_willard_crosby_adams_kelly_2023, title={Whither the genus Caldicellulosiruptor and the order Thermoanaerobacterales: phylogeny, taxonomy, ecology, and phenotype}, volume={14}, ISSN={["1664-302X"]}, DOI={10.3389/fmicb.2023.1212538}, abstractNote={The order Thermoanaerobacterales currently consists of fermentative anaerobic bacteria, including the genus Caldicellulosiruptor . Caldicellulosiruptor are represented by thirteen species; all, but one, have closed genome sequences. Interest in these extreme thermophiles has been motivated not only by their high optimal growth temperatures (≥70°C), but also by their ability to hydrolyze polysaccharides including, for some species, both xylan and microcrystalline cellulose. Caldicellulosiruptor species have been isolated from geographically diverse thermal terrestrial environments located in New Zealand, China, Russia, Iceland and North America. Evidence of their presence in other terrestrial locations is apparent from metagenomic signatures, including volcanic ash in permafrost. Here, phylogeny and taxonomy of the genus Caldicellulosiruptor was re-examined in light of new genome sequences. Based on genome analysis of 15 strains, a new order, Caldicellulosiruptorales, is proposed containing the family Caldicellulosiruptoraceae , consisting of two genera, Caldicellulosiruptor and Anaerocellum . Furthermore, the order Thermoanaerobacterales also was re-assessed, using 91 genome-sequenced strains, and should now include the family Thermoanaerobacteraceae containing the genera Thermoanaerobacter, Thermoanaerobacterium, Caldanaerobacter, the family Caldanaerobiaceae containing the genus Caldanaerobius , and the family Calorimonaceae containing the genus Calorimonas . A main outcome of ANI/AAI analysis indicates the need to reclassify several previously designated species in the Thermoanaerobacterales and Caldicellulosiruptorales by condensing them into strains of single species. Comparative genomics of carbohydrate-active enzyme inventories suggested differentiating phenotypic features, even among strains of the same species, reflecting available nutrients and ecological roles in their native biotopes.}, journal={FRONTIERS IN MICROBIOLOGY}, author={Bing, Ryan G. G. and Willard, Daniel J. J. and Crosby, James R. R. and Adams, Michael W. W. and Kelly, Robert M. M.}, year={2023}, month={Aug} }
 @article{bing_straub_sulis_wang_adams_kelly_2022, title={<p>Plant biomass fermentation by the extreme thermophile Caldicellulosiruptor bescii for co-production of green hydrogen and acetone: Technoeconomic analysis</p>}, volume={348}, ISSN={["1873-2976"]}, url={http://europepmc.org/abstract/med/35093526}, DOI={10.1016/j.biortech.2022.126780}, abstractNote={A variety of chemical and biological processes have been proposed for conversion of sustainable low-cost feedstocks into industrial products. Here, a biorefinery concept is formulated, modeled, and analyzed in which a naturally (hemi)cellulolytic and extremely thermophilic bacterium, Caldicellulosiruptor bescii, is metabolically engineered to convert the carbohydrate content of lignocellulosic biomasses (i.e., soybean hulls, transgenic poplar) into green hydrogen and acetone. Experimental validation of C. bescii fermentative performance demonstrated 82% carbohydrate solubilization of soybean hulls and 55% for transgenic poplar. A detailed technical design, including equipment specifications, provides the basis for an economic analysis that establishes metabolic engineering targets. This robust industrial process leveraging metabolically engineered C. bescii yields 206 kg acetone and 25 kg H2 per metric ton of soybean hull, or 174 kg acetone and 21 kg H2 per metric ton transgenic poplar. Beyond this specific case, the model demonstrates industrial feasibility and economic advantages of thermophilic fermentation.}, journal={BIORESOURCE TECHNOLOGY}, author={Bing, Ryan G. and Straub, Christopher T. and Sulis, Daniel B. and Wang, Jack P. and Adams, Michel W. W. and Kelly, Robert M.}, year={2022}, month={Mar} }
 @article{crosby_laemthong_bing_zhang_tanwee_lipscomb_rodionov_zhang_adams_kelly_2022, title={Biochemical and Regulatory Analyses of Xylanolytic Regulons in Caldicellulosiruptor bescii Reveal Genus-Wide Features of Hemicellulose Utilization}, volume={10}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01302-22}, abstractNote={Caldicellulosiruptor species scavenge carbohydrates from runoff containing plant biomass that enters hot springs and from grasses that grow in more moderate parts of thermal features. While only a few Caldicellulosiruptor species can degrade cellulose, all known species are hemicellulolytic. The most well-characterized species, Caldicellulosiruptor bescii, decentralizes its hemicellulase inventory across five different genomic loci and two isolated genes. Transcriptomic analyses, comparative genomics, and enzymatic characterization were utilized to assign functional roles and determine the relative importance of its six putative endoxylanases (five glycoside hydrolase family 10 [GH10] enzymes and one GH11 enzyme) and two putative exoxylanases (one GH39 and one GH3) in C. bescii. Two genus-wide conserved xylanases, C. bescii XynA (GH10) and C. bescii Xyl3A (GH3), had the highest levels of sugar release on oat spelt xylan, were in the top 10% of all genes transcribed by C. bescii, and were highly induced on xylan compared to cellulose. This indicates that a minimal set of enzymes are used to drive xylan degradation in the genus Caldicellulosiruptor, complemented by hemicellulolytic inventories that are tuned to specific forms of hemicellulose in available plant biomasses. To this point, synergism studies revealed that the pairing of specific GH family proteins (GH3, -11, and -39) with C. bescii GH10 proteins released more sugar in vitro than mixtures containing five different GH10 proteins. Overall, this work demonstrates the essential requirements for Caldicellulosiruptor to degrade various forms of xylan and the differences in species genomic inventories that are tuned for survival in unique biotopes with variable lignocellulosic substrates. IMPORTANCE Microbial deconstruction of lignocellulose for the production of biofuels and chemicals requires the hydrolysis of heterogeneous hemicelluloses to access the microcrystalline cellulose portion. This work extends previous in vivo and in vitro efforts to characterize hemicellulose utilization by integrating genomic reconstruction, transcriptomic data, operon structures, and biochemical characteristics of key enzymes to understand the deployment and functionality of hemicellulases by the extreme thermophile Caldicellulosiruptor bescii. Furthermore, comparative genomics of the genus revealed both conserved and divergent mechanisms for hemicellulose utilization across the 15 sequenced species, thereby paving the way to connecting functional enzyme characterization with metabolic engineering efforts to enhance lignocellulose conversion.}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Crosby, James R. and Laemthong, Tunyaboon and Bing, Ryan G. and Zhang, Ke and Tanwee, Tania N. N. and Lipscomb, Gina L. and Rodionov, Dmitry A. and Zhang, Ying and Adams, Michael W. W. and Kelly, Robert M.}, year={2022}, month={Oct} }
 @article{laemthong_bing_crosby_adams_kelly_2022, title={Engineering Caldicellulosiruptor bescii with Surface Layer Homology Domain-Linked Glycoside Hydrolases Improves Plant Biomass Solubilization}, volume={9}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01274-22}, abstractNote={Caldicellulosiruptor species hold promise as microorganisms that can solubilize the carbohydrate portion of lignocellulose and subsequently convert fermentable sugars into bio-based chemicals and fuels. Members of the genus have surface layer (S-layer) homology domain-associated glycoside hydrolases (SLH-GHs) that mediate attachment to biomass as well as hydrolysis of carbohydrates. Caldicellulosiruptor bescii , the most studied member of the genus, has only one SLH-GH.}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Laemthong, Tunyaboon and Bing, Ryan G. and Crosby, James R. and Adams, Michael W. W. and Kelly, Robert M.}, year={2022}, month={Sep} }
 @article{nayfach_roux_seshadri_udwary_varghese_schulz_wu_paez-espino_chen_huntemann_et al._2021, title={A genomic catalog of Earth’s microbiomes}, volume={39}, DOI={10.1038/s41587-020-0718-6}, abstractNote={Abstract The reconstruction of bacterial and archaeal genomes from shotgun metagenomes has enabled insights into the ecology and evolution of environmental and host-associated microbiomes. Here we applied this approach to >10,000 metagenomes collected from diverse habitats covering all of Earth’s continents and oceans, including metagenomes from human and animal hosts, engineered environments, and natural and agricultural soils, to capture extant microbial, metabolic and functional potential. This comprehensive catalog includes 52,515 metagenome-assembled genomes representing 12,556 novel candidate species-level operational taxonomic units spanning 135 phyla. The catalog expands the known phylogenetic diversity of bacteria and archaea by 44% and is broadly available for streamlined comparative analyses, interactive exploration, metabolic modeling and bulk download. We demonstrate the utility of this collection for understanding secondary-metabolite biosynthetic potential and for resolving thousands of new host linkages to uncultivated viruses. This resource underscores the value of genome-centric approaches for revealing genomic properties of uncultivated microorganisms that affect ecosystem processes.}, journal={Nature Biotechnology}, publisher={Nat Biotechnol}, author={Nayfach, S. and Roux, S. and Seshadri, R. and Udwary, D. and Varghese, N. and Schulz, F. and Wu, D. and Paez-Espino, D. and Chen, I-M and Huntemann, M. and et al.}, year={2021}, pages={499–509} }
 @inbook{laemthong_lewis_crosby_bing_schneider_willard_counts_kelly_2021, place={St. Louis, MO}, title={Enzymes from extremely thermophilic bacteria and archaea: Current status and future prospects}, ISBN={9780323902748}, booktitle={Extremozymes and their Industrial Applications}, publisher={Elsevier Academic Press}, author={Laemthong, T. and Lewis, A.M. and Crosby, J.R. and Bing, R.G. and Schneider, W.H. and Willard, D.J. and Counts, J.A. and Kelly, R.M.}, editor={Arora, N.A. and Agnihotri, S. and Mishra, J.Editors}, year={2021} }
 @article{counts_vitko_kelly_2021, title={Fox Cluster determinants for iron biooxidation in the extremely thermoacidophilic Sulfolobaceae}, volume={8}, ISSN={["1462-2920"]}, DOI={10.1111/1462-2920.15727}, abstractNote={Within the extremely thermoacidophilic Sulfolobaceae, the capacity to oxidize iron varies considerably. While some species are prolific iron oxidizers (e.g. Metallosphaera sedula), other species do not oxidize iron at all (e.g. Sulfolobus acidocaldarius). Iron oxidation capacity maps to a genomic locus, referred to previously as the 'Fox Cluster', that encodes putative proteins that are mostly unique to the Sulfolobaceae. The role of putative proteins in the Fox Cluster has not been confirmed, but proteomic analysis here of iron-oxidizing membranes from M. sedula indicates that FoxA2 and FoxB (both cytochrome c oxidase-like subunits) and FoxC (CbsA/cytochrome b domain-containing) are essential. Furthermore, comparative genomics (locus organization and gene disruptions) and transcriptomics (polarity effects and differential expression) connect these genomic determinants with disparate iron biooxidation and respiration measurements among Sulfolobaceae species. While numerous homologous proteins can be identified for FoxA in genome databases (COX-like domains are prevalent across all domains of life), few homologues exist for FoxC or for most other Fox Cluster proteins. Phylogenetic reconstructions suggest this locus may have existed in early Sulfolobaceae, while the only other close homologues to the locus appear in the recently discovered candidate phylum Marsarchaota.}, journal={ENVIRONMENTAL MICROBIOLOGY}, author={Counts, James A. and Vitko, Nicholas P. and Kelly, Robert M.}, year={2021}, month={Aug} }
 @article{rodionov_rodionova_rodionov_arzamasov_zhang_rubinstein_tanwee_bing_crosby_nookaew_et al._2021, title={Genome-Scale Metabolic Model of
            Caldicellulosiruptor bescii
            Reveals Optimal Metabolic Engineering Strategies for Bio-based Chemical Production}, volume={6}, ISSN={2379-5077}, url={http://dx.doi.org/10.1128/msystems.01351-20}, DOI={10.1128/msystems.01351-20}, abstractNote={The extremely thermophilic cellulolytic bacterium, Caldicellulosiruptor bescii , degrades plant biomass at high temperatures without any pretreatments and can serve as a strategic platform for industrial applications. The metabolic engineering of C. bescii , however, faces potential bottlenecks in bio-based chemical productions.}, number={3}, journal={mSystems}, publisher={American Society for Microbiology}, author={Rodionov, Dmitry A. and Rodionova, Irina A. and Rodionov, Vladimir A. and Arzamasov, Aleksandr A. and Zhang, Ke and Rubinstein, Gabriel M. and Tanwee, Tania N. N. and Bing, Ryan G. and Crosby, James R. and Nookaew, Intawat and et al.}, editor={Summers, Zarath M.Editor}, year={2021}, month={Jun} }
 @article{goller_srougi_chen_schenkman_kelly_2021, place={SWITZERLAND}, title={Integrating Bioinformatics Tools into Inquiry-based Molecular Biology Laboratory Education Modules}, volume={6}, ISSN={2504-284X}, DOI={10.3389/feduc.2021.711403}, abstractNote={The accelerating expansion of online bioinformatics tools has profoundly impacted molecular biology, with such tools becoming integral to the modern life sciences. As a result, molecular biology laboratory education must train students to leverage bioinformatics in meaningful ways to be prepared for a spectrum of careers. Institutions of higher learning can benefit from a flexible and dynamic instructional paradigm that blends up-to-date bioinformatics training with best practices in molecular biology laboratory pedagogy. At North Carolina State University, the campus-wide interdisciplinary Biotechnology (BIT) Program has developed cutting-edge, flexible, inquiry-based Molecular Biology Laboratory Education Modules (MBLEMs). MBLEMs incorporate relevant online bioinformatics tools using evidenced-based pedagogical practices and in alignment with national learning frameworks. Students in MBLEMs engage in the most recent experimental developments in modern biology (e.g., CRISPR, metagenomics) through the strategic use of bioinformatics, in combination with wet-lab experiments, to address research questions. MBLEMs are flexible educational units that provide a menu of inquiry-based laboratory exercises that can be used as complete courses or as parts of existing courses. As such, MBLEMs are designed to serve as resources for institutions ranging from community colleges to research-intensive universities, involving a diverse range of learners. Herein, we describe this new paradigm for biology laboratory education that embraces bioinformatics as a critical component of inquiry-based learning for undergraduate and graduate students representing the life sciences, the physical sciences, and engineering.}, number={Article Number: 711403}, journal={Frontiers in Education}, publisher={FRONTIERS MEDIA SA}, author={Goller, C.C. and Srougi, M.C. and Chen, S.H. and Schenkman, L.R. and Kelly, R.M.}, year={2021} }
 @article{willard_kelly_2021, title={Intersection of Biotic and Abiotic Sulfur Chemistry Supporting Extreme Microbial Life in Hot Acid}, volume={125}, ISSN={["1520-5207"]}, DOI={10.1021/acs.jpcb.1c02102}, abstractNote={Microbial life on Earth exists within wide ranges of temperature, pressure, pH, salinity, radiation, and water activity. Extreme thermoacidophiles, in particular, are microbes found in hot, acidic biotopes laden with heavy metals and reduced inorganic sulfur species. As chemolithoautotrophs, they thrive in the absence of organic carbon, instead using sulfur and metal oxidation to fuel their bioenergetic needs, while incorporating CO2 as a carbon source. Metal oxidation by these microbes takes place extracellularly, mediated by membrane-associated oxidase complexes. In contrast, sulfur oxidation involves extracellular, membrane-associated, and cytoplasmic biotransformations, which intersect with abiotic sulfur chemistry. This novel lifestyle has been examined in the context of early aerobic life on this planet, but it is also interesting when considering the prospects of life, now or previously, on other solar bodies. Here, extreme thermoacidophily (growth at pH below 4.0, temperature above 55 °C), a characteristic of species in the archaeal order Sulfolobales, is considered from the perspective of sulfur chemistry, both biotic and abiotic, as it relates to microbial bioenergetics. Current understanding of the mechanisms involved are reviewed which are further expanded through recent experimental results focused on imparting sulfur oxidation capacity on a natively nonsulfur oxidizing extremely thermoacidophilic archaeon, Sulfolobus acidocaldarius, through metabolic engineering.}, number={20}, journal={JOURNAL OF PHYSICAL CHEMISTRY B}, author={Willard, Daniel J. and Kelly, Robert M.}, year={2021}, month={May}, pages={5243–5257} }
 @article{willard_kelly_2021, title={Intersection of Biotic and Abiotic Sulfur Chemistry Supporting Extreme Microbial Life in Hot Acid}, volume={125}, url={http://dx.doi.org/10.1021/acs.jpcb.1c02102.s001}, DOI={10.1021/acs.jpcb.1c02102.s001}, number={20}, journal={Journal of Physical Chemistry B}, publisher={American Chemical Society (ACS)}, author={Willard, D.J. and Kelly, R.M.}, year={2021}, month={May}, pages={5243–5257} }
 @article{lewis_recalde_bräsen_counts_nussbaum_bost_schocke_shen_willard_quax_et al._2021, title={The biology of thermoacidophilic archaea from the order Sulfolobales}, volume={45}, ISSN={1574-6976}, url={http://dx.doi.org/10.1093/femsre/fuaa063}, DOI={10.1093/femsre/fuaa063}, abstractNote={Thermoacidophilic archaea belonging to the order Sulfolobales thrive in extreme biotopes, such as sulfuric hot springs and ore deposits. These microorganisms have been model systems for understanding life in extreme environments, as well as for probing the evolution of both molecular genetic processes and central metabolic pathways. Thermoacidophiles, such as the Sulfolobales, use typical microbial responses to persist in hot acid (e.g. motility, stress response, biofilm formation), albeit with some unusual twists. They also exhibit unique physiological features, including iron and sulfur chemolithoautotrophy, that differentiate them from much of the microbial world. Although first discovered >50 years ago, it was not until recently that genome sequence data and facile genetic tools have been developed for species in the Sulfolobales. These advances have not only opened up ways to further probe novel features of these microbes but also paved the way for their potential biotechnological applications. Discussed here are the nuances of the thermoacidophilic lifestyle of the Sulfolobales, including their evolutionary placement, cell biology, survival strategies, genetic tools, metabolic processes and physiological attributes together with how these characteristics make thermoacidophiles ideal platforms for specialized industrial processes.}, number={4}, journal={FEMS Microbiology Reviews}, publisher={Oxford University Press (OUP)}, author={Lewis, April M and Recalde, Alejandra and Bräsen, Christopher and Counts, James A and Nussbaum, Phillip and Bost, Jan and Schocke, Larissa and Shen, Lu and Willard, Daniel J and Quax, Tessa E F and et al.}, year={2021}, month={Jan} }
 @article{bing_sulis_wang_adams_kelly_2021, title={Thermophilic microbial deconstruction and conversion of natural and transgenic lignocellulose}, volume={13}, ISSN={1758-2229 1758-2229}, url={http://dx.doi.org/10.1111/1758-2229.12943}, DOI={10.1111/1758-2229.12943}, abstractNote={The potential to convert renewable plant biomasses into fuels and chemicals by microbial processes presents an attractive, less environmentally intense alternative to conventional routes based on fossil fuels. This would best be done with microbes that natively deconstruct lignocellulose and concomitantly form industrially relevant products, but these two physiological and metabolic features are rarely and simultaneously observed in nature. Genetic modification of both plant feedstocks and microbes can be used to increase lignocellulose deconstruction capability and generate industrially relevant products. Separate efforts on plants and microbes are ongoing, but these studies lack a focus on optimal, complementary combinations of these disparate biological systems to obtain a convergent technology. Improving genetic tools for plants have given rise to the generation of low-lignin lines that are more readily solubilized by microorganisms. Most focus on the microbiological front has involved thermophilic bacteria from the genera Caldicellulosiruptor and Clostridium, given their capacity to degrade lignocellulose and to form bio-products through metabolic engineering strategies enabled by ever-improving molecular genetics tools. Bioengineering plant properties to better fit the deconstruction capabilities of candidate consolidated bioprocessing microorganisms has potential to achieve the efficient lignocellulose deconstruction needed for industrial relevance.}, number={3}, journal={Environmental Microbiology Reports}, publisher={Wiley}, author={Bing, Ryan G. and Sulis, Daniel B. and Wang, Jack P. and Adams, Michael W. W. and Kelly, Robert M.}, year={2021}, month={Mar}, pages={272–293} }
 @article{rodionov_rodionova_rodionov_arzamasov_zhang_rubinstein_tanwee_bing_crosby_nookaew_et al._2021, title={Transcriptional Regulation of Plant Biomass Degradation and Carbohydrate Utilization Genes in the Extreme Thermophile
            Caldicellulosiruptor bescii}, volume={6}, ISSN={2379-5077}, url={http://dx.doi.org/10.1128/msystems.01345-20}, DOI={10.1128/msystems.01345-20}, abstractNote={To develop functional metabolic engineering platforms for nonmodel microorganisms, a comprehensive understanding of the physiological and metabolic characteristics is critical. Caldicellulosiruptor bescii and other species in this genus have untapped potential for conversion of unpretreated plant biomass into industrial fuels and chemicals. The highly interactive and complex machinery used by C. bescii to acquire and process complex carbohydrates contained in lignocellulose was elucidated here to complement related efforts to develop a metabolic engineering platform with this bacterium.}, number={3}, journal={mSystems}, publisher={American Society for Microbiology}, author={Rodionov, Dmitry A. and Rodionova, Irina A. and Rodionov, Vladimir A. and Arzamasov, Aleksandr A. and Zhang, Ke and Rubinstein, Gabriel M. and Tanwee, Tania N. N. and Bing, Ryan G. and Crosby, James R. and Nookaew, Intawat and et al.}, editor={Summers, Zarath M.Editor}, year={2021}, month={Jun} }
 @article{rubinstein_lipscomb_williams-rhaesa_schut_kelly_adams_2020, title={Engineering the cellulolytic extreme thermophile Caldicellulosiruptor bescii to reduce carboxylic acids to alcohols using plant biomass as the energy source}, volume={47}, ISSN={1476-5535 1367-5435}, url={http://dx.doi.org/10.1007/s10295-020-02299-z}, DOI={10.1007/s10295-020-02299-z}, abstractNote={Abstract Caldicellulosiruptor bescii is the most thermophilic cellulolytic organism yet identified (Topt 78 °C). It grows on untreated plant biomass and has an established genetic system thereby making it a promising microbial platform for lignocellulose conversion to bio-products. Here, we investigated the ability of engineered C. bescii to generate alcohols from carboxylic acids. Expression of aldehyde ferredoxin oxidoreductase (aor from Pyrococcus furiosus) and alcohol dehydrogenase (adhA from Thermoanaerobacter sp. X514) enabled C. bescii to generate ethanol from crystalline cellulose and from biomass by reducing the acetate produced by fermentation. Deletion of lactate dehydrogenase in a strain expressing the AOR–Adh pathway increased ethanol production. Engineered strains also converted exogenously supplied organic acids (isobutyrate and n-caproate) to the corresponding alcohol (isobutanol and hexanol) using both crystalline cellulose and switchgrass as sources of reductant for alcohol production. This is the first instance of an acid to alcohol conversion pathway in a cellulolytic microbe.}, number={8}, journal={Journal of Industrial Microbiology and Biotechnology}, publisher={Oxford University Press (OUP)}, author={Rubinstein, Gabriel M and Lipscomb, Gina L and Williams-Rhaesa, Amanda M and Schut, Gerrit J and Kelly, Robert M and Adams, Michael W W}, year={2020}, month={Aug}, pages={585–597} }
 @article{counts_vitko_kelly_2020, title={Genome Sequences of Five Type Strain Members of the Archaeal Family Sulfolobaceae, Acidianus ambivalens, Acidianus infernus, Stygiolobus azoricus, Sulfuracidifex metallicus, and Sulfurisphaera ohwakuensis}, volume={9}, ISSN={["2576-098X"]}, DOI={10.1128/MRA.01490-19}, abstractNote={Presented are five genomes from the polyextremophilic (optimal temperature of >65°C and optimal pH of <3.5) archaeal family Sulfolobaceae , greatly expanding order-wide genomic diversity. Included are the only obligate anaerobic species, several facultative sulfur utilizers, two metal mobilizers, one facultative chemolithoautotroph with robust metabolic versatility, and some of the most thermophilic thermoacidophiles reported to date.}, number={11}, journal={MICROBIOLOGY RESOURCE ANNOUNCEMENTS}, author={Counts, James A. and Vitko, Nicholas P. and Kelly, Robert M.}, year={2020}, month={Mar} }
 @article{counts_willard_kelly_2020, title={Life in hot acid: a genome‐based reassessment of the archaeal order
            Sulfolobales}, volume={23}, ISSN={1462-2912 1462-2920}, url={http://dx.doi.org/10.1111/1462-2920.15189}, DOI={10.1111/1462-2920.15189}, abstractNote={The order Sulfolobales was one of the first named Archaeal lineages, with globally distributed members from terrestrial thermal acid springs (pH < 4; T > 65°C). The Sulfolobales represent broad metabolic capabilities, ranging from lithotrophy, based on inorganic iron and sulfur biotransformations, to autotrophy, to chemoheterotrophy in less acidophilic species. Components of the 3-hydroxypropionate/4-hydroxybutyrate carbon fixation cycle, as well as sulfur oxidation, are nearly universally conserved, although dissimilatory sulfur reduction and disproportionation (Acidianus, Stygiolobus and Sulfurisphaera) and iron oxidation (Acidianus, Metallosphaera, Sulfurisphaera, Sulfuracidifex and Sulfodiicoccus) are limited to fewer lineages. Lithotrophic marker genes appear more often in highly acidophilic lineages. Despite the presence of facultative anaerobes and one confirmed obligate anaerobe, oxidase complexes (fox, sox, dox and a new putative cytochrome bd) are prevalent in many species (even facultative/obligate anaerobes), suggesting a key role for oxygen among the Sulfolobales. The presence of fox genes tracks with a putative antioxidant OsmC family peroxiredoxin, an indicator of oxidative stress derived from mixing reactive metals and oxygen. Extreme acidophily appears to track inversely with heterotrophy but directly with lithotrophy. Recent phylogenetic re-organization efforts are supported by the comparative genomics here, although several changes are proposed, including the expansion of the genus Saccharolobus.}, number={7}, journal={Environmental Microbiology}, publisher={Wiley}, author={Counts, James A. and Willard, Daniel J. and Kelly, Robert M.}, year={2020}, month={Sep}, pages={3568–3584} }
 @article{straub_bing_otten_keller_zeldes_adams_kelly_2020, title={Metabolically engineeredCaldicellulosiruptor besciias a platform for producing acetone and hydrogen from lignocellulose}, volume={117}, ISSN={["1097-0290"]}, DOI={10.1002/bit.27529}, abstractNote={The production of volatile industrial chemicals utilizing metabolically engineered extreme thermophiles offers the potential for processes with simultaneous fermentation and product separation. An excellent target chemical for such a process is acetone (Tb = 56°C), ideally produced from lignocellulosic biomass. Caldicellulosiruptor bescii (Topt 78°C), an extremely thermophilic fermentative bacterium naturally capable of deconstructing and fermenting lignocellulose, was metabolically engineered to produce acetone. When the acetone pathway construct was integrated into a parent strain containing the bifunctional alcohol dehydrogenase from Clostridium thermocellum, acetone was produced at 9.1 mM (0.53 g/L), in addition to minimal ethanol 3.3 mM (0.15 g/L), along with net acetate consumption. This demonstrates that C. bescii can be engineered with balanced pathways in which renewable carbohydrate sources are converted to useful metabolites, primarily acetone and H2 , without net production of its native fermentation products, acetate and lactate.}, number={12}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Straub, Christopher T. and Bing, Ryan G. and Otten, Jonathan K. and Keller, Lisa M. and Zeldes, Benjamin M. and Adams, Michael W. W. and Kelly, Robert M.}, year={2020}, month={Dec}, pages={3799–3808} }
 @article{straub_schut_otten_keller_adams_kelly_2020, title={Modification of the glycolytic pathway in Pyrococcus furiosus and the implications for metabolic engineering}, volume={24}, ISSN={["1433-4909"]}, DOI={10.1007/s00792-020-01172-2}, number={4}, journal={EXTREMOPHILES}, author={Straub, Christopher T. and Schut, Gerritt and Otten, Jonathan K. and Keller, Lisa M. and Adams, Michael W. W. and Kelly, Robert M.}, year={2020}, month={Jul}, pages={511–518} }
 @article{lee_crosby_rubinstein_laemthong_bing_straub_adams_kelly_2020, title={The biology and biotechnology of the genus Caldicellulosiruptor: recent developments in 'Caldi World'}, volume={24}, ISSN={["1433-4909"]}, DOI={10.1007/s00792-019-01116-5}, number={1}, journal={EXTREMOPHILES}, author={Lee, Laura L. and Crosby, James R. and Rubinstein, Gabriel M. and Laemthong, Tunyaboon and Bing, Ryan G. and Straub, Christopher T. and Adams, Michael W. W. and Kelly, Robert M.}, year={2020}, month={Jan}, pages={1–15} }
 @article{straub_bing_wang_chiang_adams_kelly_2020, title={Use of the lignocellulose-degrading bacterium Caldicellulosiruptor bescii to assess recalcitrance and conversion of wild-type and transgenic poplar}, volume={13}, ISSN={["1754-6834"]}, url={http://europepmc.org/abstract/med/32180826}, DOI={10.1186/s13068-020-01675-2}, abstractNote={Biological conversion of lignocellulosic biomass is significantly hindered by feedstock recalcitrance, which is typically assessed through an enzymatic digestion assay, often preceded by a thermal and/or chemical pretreatment. Here, we assay 17 lines of unpretreated transgenic black cottonwood (Populus trichocarpa) utilizing a lignocellulose-degrading, metabolically engineered bacterium, Caldicellulosiruptor bescii. The poplar lines were assessed by incubation with an engineered C. bescii strain that solubilized and converted the hexose and pentose carbohydrates to ethanol and acetate. The resulting fermentation titer and biomass solubilization were then utilized as a measure of biomass recalcitrance and compared to data previously reported on the transgenic poplar samples.Of the 17 transgenic poplar lines examined with C. bescii, a wide variation in solubilization and fermentation titer was observed. While the wild type poplar control demonstrated relatively high recalcitrance with a total solubilization of only 20% and a fermentation titer of 7.3 mM, the transgenic lines resulted in solubilization ranging from 15 to 79% and fermentation titers from 6.8 to 29.6 mM. Additionally, a strong inverse correlation (R2 = 0.8) between conversion efficiency and lignin content was observed with lower lignin samples more easily converted and solubilized by C. bescii.Feedstock recalcitrance can be significantly reduced with transgenic plants, but finding the correct modification may require a large sample set to identify the most advantageous genetic modifications for the feedstock. Utilizing C. bescii as a screening assay for recalcitrance, poplar lines with down-regulation of coumarate 3-hydroxylase 3 (C3H3) resulted in the highest degrees of solubilization and conversion by C. bescii. One such line, with a growth phenotype similar to the wild-type, generated more than three times the fermentation products of the wild-type poplar control, suggesting that excellent digestibility can be achieved without compromising fitness of the tree.}, number={1}, journal={BIOTECHNOLOGY FOR BIOFUELS}, author={Straub, Christopher T. and Bing, Ryan G. and Wang, Jack P. and Chiang, Vincent L. and Adams, Michael W. W. and Kelly, Robert M.}, year={2020}, month={Mar} }
 @article{lee_hart_lunin_alahuhta_bomble_himmel_blumer-schuette_adams_kelly_2019, title={Comparative Biochemical and Structural Analysis of Novel Cellulose Binding Proteins (Tapirins) from Extremely Thermophilic Caldicellulosiruptor Species}, volume={85}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.01983-18}, abstractNote={The mechanisms by which microorganisms attach to and degrade lignocellulose are important to understand if effective approaches for conversion of plant biomass into fuels and chemicals are to be developed. Caldicellulosiruptor species grow on carbohydrates from lignocellulose at elevated temperatures and have biotechnological significance for that reason. Novel cellulose binding proteins, called tāpirins, are involved in the way that Caldicellulosiruptor species interact with microcrystalline cellulose, and additional information about the diversity of these proteins across the genus, including binding affinity and three-dimensional structural comparisons, is provided here.}, number={3}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Lee, Laura L. and Hart, William S. and Lunin, Vladimir V. and Alahuhta, Markus and Bomble, Yannick J. and Himmel, Michael E. and Blumer-Schuette, Sara E. and Adams, Michael W. W. and Kelly, Robert M.}, year={2019}, month={Feb} }
 @article{zeldes_loder_counts_haque_widney_keller_albers_kelly_2019, title={Determinants of sulphur chemolithoautotrophy in the extremely thermoacidophilic Sulfolobales}, volume={21}, ISSN={["1462-2920"]}, DOI={10.1111/1462-2920.14712}, abstractNote={Species in the archaeal order Sulfolobales thrive in hot acid and exhibit remarkable metabolic diversity. Some species are chemolithoautotrophic, obtaining energy through the oxidation of inorganic substrates, sulphur in particular, and acquiring carbon through the 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) CO2 -fixation cycle. The current model for sulphur oxidation in the Sulfolobales is based on the biochemical analysis of specific proteins from Acidianus ambivalens, including sulphur oxygenase reductase (SOR) that disproportionates S° into H2 S and sulphite (SO32- ). Initial studies indicated SOR catalyses the essential first step in oxidation of elemental sulphur, but an ancillary role for SOR as a 'recycle' enzyme has also been proposed. Here, heterologous expression of both SOR and membrane-bound thiosulphate-quinone oxidoreductase (TQO) from Sulfolobus tokodaii 'restored' sulphur oxidation capacity in Sulfolobus acidocaldarius DSM639, but not autotrophy, although earlier reports indicate this strain was once capable of chemolithoautotrophy. Comparative transcriptomic analyses of Acidianus brierleyi, a chemolithoautotrophic sulphur oxidizer, and S. acidocaldarius DSM639 showed that while both share a strong transcriptional response to elemental sulphur, S. acidocaldarius DSM639 failed to upregulate key 3-HP/4-HB cycle genes used by A. brierleyi to drive chemolithoautotrophy. Thus, the inability for S. acidocaldarius DSM639 to grow chemolithoautotrophically may be rooted more in gene regulation than the biochemical capacity.}, number={10}, journal={ENVIRONMENTAL MICROBIOLOGY}, author={Zeldes, Benjamin M. and Loder, Andrew J. and Counts, James A. and Haque, Mashkurul and Widney, Karl A. and Keller, Lisa M. and Albers, Sonja-Verena and Kelly, Robert M.}, year={2019}, month={Oct}, pages={3696–3710} }
 @article{crosby_laemthong_lewis_straub_adams_kelly_2019, title={Extreme thermophiles as emerging metabolic engineering platforms}, volume={59}, ISSN={0958-1669}, url={http://dx.doi.org/10.1016/j.copbio.2019.02.006}, DOI={10.1016/j.copbio.2019.02.006}, abstractNote={Going forward, industrial biotechnology must consider non-model metabolic engineering platforms if it is to have maximal impact. This will include microorganisms that natively possess strategic physiological and metabolic features but lack either molecular genetic tools or such tools are rudimentary, requiring further development. If non-model platforms are successfully deployed, new avenues for production of fuels and chemicals from renewable feedstocks or waste materials will emerge. Here, the challenges and opportunities for extreme thermophiles as metabolic engineering platforms are discussed.}, journal={Current Opinion in Biotechnology}, publisher={Elsevier BV}, author={Crosby, James R and Laemthong, Tunyaboon and Lewis, April M and Straub, Christopher T and Adams, Michael WW and Kelly, Robert M}, year={2019}, month={Oct}, pages={55–64} }
 @article{wheaton_vitko_counts_dulkis_podolsky_mukherjee_kelly_2019, title={Extremely Thermoacidophilic Metallosphaera Species Mediate Mobilization and Oxidation of Vanadium and Molybdenum Oxides}, volume={85}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.02805-18}, abstractNote={In order to effectively leverage extremely thermoacidophilic archaea for the microbially based solubilization of solid-phase metal substrates (e.g., sulfides and oxides), understanding the mechanisms by which these archaea solubilize metals is important. Physiological analysis of Metallosphaera species growth in the presence of molybdenum and vanadium oxides revealed an indirect mode of metal mobilization, catalyzed by iron cycling. However, since the mobilized metals exist in more than one oxidation state, they could potentially serve directly as energetic substrates. Transcriptomic response to molybdenum and vanadium oxides provided evidence for new biomolecules participating in direct metal biooxidation. The findings expand the knowledge on the physiological versatility of these extremely thermoacidophilic archaea.}, number={5}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Wheaton, Garrett H. and Vitko, Nicholas P. and Counts, James A. and Dulkis, Jessica A. and Podolsky, Igor and Mukherjee, Arpan and Kelly, Robert M.}, year={2019}, month={Mar} }
 @article{straub_khatibi_otten_adams_kelly_2019, title={Lignocellulose solubilization and conversion by extremely thermophilic Caldicellulosiruptor bescii improves by maintaining metabolic activity}, volume={116}, ISSN={["1097-0290"]}, DOI={10.1002/bit.26993}, abstractNote={The extreme thermophile Caldicellulosiruptor bescii solubilizes and metabolizes the carbohydrate content of lignocellulose, a process that ultimately ceases because of biomass recalcitrance, accumulation of fermentation products, inhibition by lignin moieties, and reduction of metabolic activity. Deconstruction of low loadings of lignocellulose (5 g/L), either natural or transgenic, whether unpretreated or subjected to hydrothermal processing, by C. bescii typically results in less than 40% carbohydrate solubilization. Mild alkali pretreatment (up to 0.09 g NaOH/g biomass) improved switchgrass carbohydrate solubilization by C. bescii to over 70% compared to less than 30% for no pretreatment, with two-thirds of the carbohydrate content in the treated switchgrass converted to acetate and lactate. C. bescii grown on high loadings of unpretreated switchgrass (50 g/L) retained in a pH-controlled bioreactor slowly purged (τ = 80 hr) with growth media without a carbon source improved carbohydrate solubilization to over 40% compared to batch culture at 29%. But more significant was the doubling of solubilized carbohydrate conversion to fermentation products, which increased from 40% in batch to over 80% in the purged system, an improvement attributed to maintaining the bioreactor culture in a metabolically active state. This strategy should be considered for optimizing solubilization and conversion of lignocellulose by C. bescii and other lignocellulolytic microorganisms.}, number={8}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Straub, Christopher T. and Khatibi, Piyum A. and Otten, Jonathan K. and Adams, Michael W. W. and Kelly, Robert M.}, year={2019}, month={Aug}, pages={1901–1908} }
 @article{straub_khatibi_wang_conway_williams-rhaesa_peszlen_chiang_adams_kelly_2019, title={Quantitative fermentation of unpretreated transgenic poplar by Caldicellulosiruptor bescii}, volume={10}, ISSN={["2041-1723"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85070390326&partnerID=MN8TOARS}, DOI={10.1038/s41467-019-11376-6}, abstractNote={Microbial fermentation of lignocellulosic biomass to produce industrial chemicals is exacerbated by the recalcitrant network of lignin, cellulose and hemicelluloses comprising the plant secondary cell wall. In this study, we show that transgenic poplar (Populus trichocarpa) lines can be solubilized without any pretreatment by the extreme thermophile Caldicellulosiruptor bescii that has been metabolically engineered to shift its fermentation products away from inhibitory organic acids to ethanol. Carbohydrate solubilization and conversion of unpretreated milled biomass is nearly 90% for two transgenic lines, compared to only 25% for wild-type poplar. Unexpectedly, unpretreated intact poplar stems achieved nearly 70% of the fermentation production observed with milled poplar as the substrate. The nearly quantitative microbial conversion of the carbohydrate content of unpretreated transgenic lignocellulosic biomass bodes well for full utilization of renewable biomass feedstocks. Metabolizing lignocellulosic feedstocks to industrial chemicals by microorganisms requires surmounting  the recalcitrance caused by lignin. Here, the authors pair transgenic lignin modified poplar lines with engineered Caldicellusiruptor bescii to achieve biomass solubilization and ethanol conversion without pretreatment.}, number={1}, journal={NATURE COMMUNICATIONS}, publisher={Springer Science and Business Media LLC}, author={Straub, Christopher T. and Khatibi, Piyum A. and Wang, Jack P. and Conway, Jonathan M. and Williams-Rhaesa, Amanda M. and Peszlen, Ilona M. and Chiang, Vincent L. and Adams, Michael W. W. and Kelly, Robert M.}, year={2019}, month={Aug} }
 @article{scott_rubinstein_poole_lipscomb_schut_williams-rhaesa_stevenson_amador-noguez_kelly_adams_2019, title={The thermophilic biomass-degrading bacterium Caldicellulosiruptor bescii utilizes two enzymes to oxidize glyceraldehyde 3-phosphate during glycolysis}, volume={294}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.RA118.007120}, abstractNote={Caldicellulosiruptor bescii is an extremely thermophilic, cellulolytic bacterium with a growth optimum at 78 °C and is the most thermophilic cellulose degrader known. It is an attractive target for biotechnological applications, but metabolic engineering will require an in-depth understanding of its primary pathways. A previous analysis of its genome uncovered evidence that C. bescii may have a completely uncharacterized aspect to its redox metabolism, involving a tungsten-containing oxidoreductase of unknown function. Herein, we purified and characterized this new member of the aldehyde ferredoxin oxidoreductase family of tungstoenzymes. We show that it is a heterodimeric glyceraldehyde-3-phosphate (GAP) ferredoxin oxidoreductase (GOR) present not only in all known Caldicellulosiruptor species, but also in 44 mostly anaerobic bacterial genera. GOR is phylogenetically distinct from the monomeric GAP-oxidizing enzyme found previously in several Archaea. We found that its large subunit (GOR-L) contains a single tungstopterin site and one iron-sulfur [4Fe-4S] cluster, that the small subunit (GOR-S) contains four [4Fe-4S] clusters, and that GOR uses ferredoxin as an electron acceptor. Deletion of either subunit resulted in a distinct growth phenotype on both C5 and C6 sugars, with an increased lag phase, but higher cell densities. Using metabolomics and kinetic analyses, we show that GOR functions in parallel with the conventional GAP dehydrogenase, providing an alternative ferredoxin-dependent glycolytic pathway. These two pathways likely facilitate the recycling of reduced redox carriers (NADH and ferredoxin) in response to environmental H2 concentrations. This metabolic flexibility has important implications for the future engineering of this and related species.}, number={25}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Scott, Israel M. and Rubinstein, Gabriel M. and Poole, Farris L., II and Lipscomb, Gina L. and Schut, Gerrit J. and Williams-Rhaesa, Amanda M. and Stevenson, David M. and Amador-Noguez, Daniel and Kelly, Robert M. and Adams, Michael W. W.}, year={2019}, month={Jun}, pages={9995–10005} }
 @article{zeldes_straub_otten_adams_kelly_2018, title={A synthetic enzymatic pathway for extremely thermophilic acetone production based on the unexpectedly thermostable acetoacetate decarboxylase from Clostridium acetobutylicum}, volume={115}, ISSN={["1097-0290"]}, DOI={10.1002/bit.26829}, abstractNote={One potential advantage of an extremely thermophilic metabolic engineering host (T opt ≥ 70°C) is facilitated recovery of volatile chemicals from the vapor phase of an active fermenting culture. This process would reduce purification costs and concomitantly alleviate toxicity to the cells by continuously removing solvent fermentation products such as acetone or ethanol, a process we are calling “bio-reactive distillation.” Although extremely thermophilic heterologous metabolic pathways can be inspired by existing mesophilic versions, they require thermostable homologs of the constituent enzymes if they are to be utilized in extremely thermophilic bacteria or archaea. Production of acetone from acetyl-CoA and acetate in the mesophilic bacterium Clostridium acetobutylicum utilizes three enzymes: thiolase, acetoacetyl-CoA: acetate CoA transferase (CtfAB), and acetoacetate decarboxylase (Adc). Previously reported biocatalytic pathways for acetone production were demonstrated only as high as 55°C. Here, we demonstrate a synthetic enzymatic pathway for acetone production that functions up to at least 70°C in vitro, made possible by the unusual thermostability of Adc from the mesophile C. acetobutylicum, and heteromultimeric acetoacetyl-CoA:acetate CoA-transferase (CtfAB) complexes from Thermosipho melanesiensis and Caldanaerobacter subterraneus, composed of a highly thermostable α-subunit and a thermally labile β-subunit. The three enzymes produce acetone in vitro at temperatures of at least 70°C, paving the way for bio-reactive distillation of acetone using a metabolically engineered extreme thermophile as a production host.}, number={12}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Zeldes, Benjamin M. and Straub, Christopher T. and Otten, Jonathan K. and Adams, Michael W. W. and Kelly, Robert M.}, year={2018}, month={Dec}, pages={2951–2961} }
 @misc{straub_counts_nguyen_wu_zeldes_crosby_conway_otten_lipscomb_schut_et al._2018, title={Biotechnology of extremely thermophilic archaea}, volume={42}, ISSN={["1574-6976"]}, DOI={10.1093/femsre/fuy012}, abstractNote={Although the extremely thermophilic archaea (Topt ≥ 70°C) may be the most primitive extant forms of life, they have been studied to a limited extent relative to mesophilic microorganisms. Many of these organisms have unique biochemical and physiological characteristics with important biotechnological implications. These include methanogens that generate methane, fermentative anaerobes that produce hydrogen gas with high efficiency, and acidophiles that can mobilize base, precious and strategic metals from mineral ores. Extremely thermophilic archaea have also been a valuable source of thermoactive, thermostable biocatalysts, but their use as cellular systems has been limited because of the general lack of facile genetics tools. This situation has changed recently, however, thereby providing an important avenue for understanding their metabolic and physiological details and also opening up opportunities for metabolic engineering efforts. Along these lines, extremely thermophilic archaea have recently been engineered to produce a variety of alcohols and industrial chemicals, in some cases incorporating CO2 into the final product. There are barriers and challenges to these organisms reaching their full potential as industrial microorganisms but, if these can be overcome, a new dimension for biotechnology will be forthcoming that strategically exploits biology at high temperatures.}, number={5}, journal={FEMS MICROBIOLOGY REVIEWS}, author={Straub, Christopher T. and Counts, James A. and Nguyen, Diep M. N. and Wu, Chang-Hao and Zeldes, Benjamin M. and Crosby, James R. and Conway, Jonathan M. and Otten, Jonathan K. and Lipscomb, Gina L. and Schut, Gerrit J. and et al.}, year={2018}, month={Sep}, pages={543–578} }
 @article{counts_vitko_kelly_2018, title={Complete Genome Sequences of Extremely Thermoacidophilic Metal-Mobilizing Type Strain Members of the Archaeal Family Sulfolobaceae, Acidianus brierleyi DSM-1651, Acidianus sulfidivorans DSM-18786, and Metallosphaera hakonensis DSM-7519}, volume={7}, ISSN={["2576-098X"]}, DOI={10.1128/MRA.00831-18}, abstractNote={The family Sulfolobaceae contains extremely thermoacidophilic archaea that are found in terrestrial environments. Here, we report three closed genomes from two currently defined genera within the family, namely, Acidianus brierleyi DSM-1651 T , Acidianus sulfidivorans DSM-18786 T , and Metallosphaera hakonensis DSM-7519 T .}, number={2}, journal={MICROBIOLOGY RESOURCE ANNOUNCEMENTS}, author={Counts, James A. and Vitko, Nicholas P. and Kelly, Robert M.}, year={2018}, month={Jul} }
 @article{williams-rhaesa_rubinstein_scott_lipscomb_poole, ii_kelly_adams_2018, title={Engineering redox-balanced ethanol production in the cellulolytic and extremely thermophilic bacterium, Caldicellulosiruptor bescii}, volume={7}, ISSN={2214-0301}, url={http://dx.doi.org/10.1016/J.MEC.2018.E00073}, DOI={10.1016/J.MEC.2018.E00073}, abstractNote={Caldicellulosiruptor bescii is an extremely thermophilic cellulolytic bacterium with great potential for consolidated bioprocessing of renewable plant biomass. Since it does not natively produce ethanol, metabolic engineering is required to create strains with this capability. Previous efforts involved the heterologous expression of the gene encoding a bifunctional alcohol dehydrogenase, AdhE, which uses NADH as the electron donor to reduce acetyl-CoA to ethanol. Acetyl-CoA produced from sugar oxidation also generates reduced ferredoxin but there is no known pathway for the transfer of electrons from reduced ferredoxin to NAD in C. bescii. Herein, we engineered a strain of C. bescii using a more stable genetic background than previously reported and heterologously-expressed adhE from Clostridium thermocellum (which grows optimally (Topt) at 60 °C) with and without co-expression of the membrane-bound Rnf complex from Thermoanaerobacter sp. X514 (Topt 60 °C). Rnf is an energy-conserving, reduced ferredoxin NAD oxidoreductase encoded by six genes (rnfCDGEAB). It was produced in a catalytically active form in C. bescii that utilized the largest DNA construct to be expressed in this organism. The new genetic lineage containing AdhE resulted in increased ethanol production compared to previous reports. Ethanol production was further enhanced by the presence of Rnf, which also resulted in decreased production of pyruvate, acetoin and an uncharacterized compound as unwanted side-products. Using crystalline cellulose as the growth substrate for the Rnf-containing strain, 75 mM (3.5 g/L) ethanol was produced at 60 °C, which is 5-fold higher than that reported previously. This underlines the importance of redox balancing and paves the way for achieving even higher ethanol titers in C. bescii.}, journal={Metabolic Engineering Communications}, publisher={Elsevier BV}, author={Williams-Rhaesa, Amanda M. and Rubinstein, Gabriel M. and Scott, Israel M. and Lipscomb, Gina L. and Poole, II, Farris L. and Kelly, Robert M. and Adams, Michael W.W.}, year={2018}, month={Dec}, pages={e00073} }
 @article{lee_blumer-schuette_izquierdo_zurawski_loder_conway_elkins_podar_clum_jones_et al._2018, title={Genus-Wide Assessment of Lignocellulose Utilization in the Extremely Thermophilic Genus Caldicellulosiruptor by Genomic, Pangenomic, and Metagenomic Analyses}, volume={84}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.02694-17}, DOI={10.1128/aem.02694-17}, abstractNote={Metagenomic data from Obsidian Pool (Yellowstone National Park, USA) and 13 genome sequences were used to reassess genus-wide biodiversity for the extremely thermophilic Caldicellulosiruptor The updated core genome contains 1,401 ortholog groups (average genome size for 13 species = 2,516 genes). The pangenome, which remains open with a revised total of 3,493 ortholog groups, encodes a variety of multidomain glycoside hydrolases (GHs). These include three cellulases with GH48 domains that are colocated in the glucan degradation locus (GDL) and are specific determinants for microcrystalline cellulose utilization. Three recently sequenced species, Caldicellulosiruptor sp. strain Rt8.B8 (renamed here Caldicellulosiruptor morganii), Thermoanaerobacter cellulolyticus strain NA10 (renamed here Caldicellulosiruptor naganoensis), and Caldicellulosiruptor sp. strain Wai35.B1 (renamed here Caldicellulosiruptor danielii), degraded Avicel and lignocellulose (switchgrass). C. morganii was more efficient than Caldicellulosiruptor bescii in this regard and differed from the other 12 species examined, both based on genome content and organization and in the specific domain features of conserved GHs. Metagenomic analysis of lignocellulose-enriched samples from Obsidian Pool revealed limited new information on genus biodiversity. Enrichments yielded genomic signatures closely related to that of Caldicellulosiruptor obsidiansis, but there was also evidence for other thermophilic fermentative anaerobes (Caldanaerobacter, Fervidobacterium, Caloramator, and Clostridium). One enrichment, containing 89.8% Caldicellulosiruptor and 9.7% Caloramator, had a capacity for switchgrass solubilization comparable to that of C. bescii These results refine the known biodiversity of Caldicellulosiruptor and indicate that microcrystalline cellulose degradation at temperatures above 70°C, based on current information, is limited to certain members of this genus that produce GH48 domain-containing enzymes.IMPORTANCE The genus Caldicellulosiruptor contains the most thermophilic bacteria capable of lignocellulose deconstruction, which are promising candidates for consolidated bioprocessing for the production of biofuels and bio-based chemicals. The focus here is on the extant capability of this genus for plant biomass degradation and the extent to which this can be inferred from the core and pangenomes, based on analysis of 13 species and metagenomic sequence information from environmental samples. Key to microcrystalline hydrolysis is the content of the glucan degradation locus (GDL), a set of genes encoding glycoside hydrolases (GHs), several of which have GH48 and family 3 carbohydrate binding module domains, that function as primary cellulases. Resolving the relationship between the GDL and lignocellulose degradation will inform efforts to identify more prolific members of the genus and to develop metabolic engineering strategies to improve this characteristic.}, number={9}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Lee, Laura L. and Blumer-Schuette, Sara E. and Izquierdo, Javier A. and Zurawski, Jeffrey V. and Loder, Andrew J. and Conway, Jonathan M. and Elkins, James G. and Podar, Mircea and Clum, Alicia and Jones, Piet C. and et al.}, editor={Cann, IsaacEditor}, year={2018}, month={May}, pages={e02694–17} }
 @article{williams-rhaesa_awuku_lipscomb_poole_rubinstein_conway_kelly_adams_2018, title={Native xylose-inducible promoter expands the genetic tools for the biomass-degrading, extremely thermophilic bacterium Caldicellulosiruptor bescii}, volume={22}, ISSN={["1433-4909"]}, DOI={10.1007/s00792-018-1023-x}, number={4}, journal={EXTREMOPHILES}, author={Williams-Rhaesa, Amanda M. and Awuku, Nanaakua K. and Lipscomb, Gina L. and Poole, Farris L. and Rubinstein, Gabriel M. and Conway, Jonathan M. and Kelly, Robert M. and Adams, Michael W. W.}, year={2018}, month={Jul}, pages={629–638} }
 @article{conway_crosby_hren_southerland_lee_lunin_alahuhta_himmel_bomble_adams_et al._2018, title={Novel multidomain, multifunctional glycoside hydrolases from highly lignocellulolytic Caldicellulosiruptor species}, volume={64}, ISSN={["1547-5905"]}, DOI={10.1002/aic.16354}, abstractNote={Biological hydrolysis of microcrystalline cellulose is an uncommon feature in the microbial world, especially among bacteria and archaea growing optimally above 70°C (the so-called extreme thermophiles). In fact, among this group only certain species in the genus Caldicellulosiruptor are capable of rapid and extensive cellulose degradation. Four novel multidomain glycoside hydrolases (GHs) from Caldicellulosiruptor morganii and Caldicellulosiruptor danielii were produced recombinantly in Caldicellulosiruptor bescii and characterized. These GHs are structurally organized with two or three catalytic domains flanking carbohydrate binding modules from Family 3. Collectively, these enzymes represent GH families 5, 9, 10, 12, 44, 48, and 74, and hydrolyze crystalline cellulose, glucan, xylan, and mannan, the primary carbohydrates in plant biomass. Degradation of microcrystalline cellulose by cocktails of GHs from three Caldicellulosiruptor species demonstrated that synergistic interactions enable mixtures of multiple enzymes to outperform single enzymes, suggesting a community mode of action for lignocellulose utilization in thermal environments. © 2018 American Institute of Chemical Engineers AIChE J, 64: 4218–4228, 2018}, number={12}, journal={AICHE JOURNAL}, author={Conway, Jonathan M. and Crosby, James R. and Hren, Andrew P. and Southerland, Robert T. and Lee, Laura L. and Lunin, Vladimir V. and Alahuhta, Petri and Himmel, Michael E. and Bomble, Yannick J. and Adams, Michael W. W. and et al.}, year={2018}, month={Dec}, pages={4218–4228} }
 @article{conway_crosby_mckinley_seals_adams_kelly_2018, title={Parsing in vivo and in vitro contributions to microcrystalline cellulose hydrolysis by multidomain glycoside hydrolases in the Caldicellulosiruptor bescii secretome}, volume={115}, ISSN={["1097-0290"]}, DOI={10.1002/bit.26773}, abstractNote={Six multidomain glycoside hydrolases (GHs), CelA (Athe_1867), CelB (Athe_1859), CelC (Athe_1857), CelD (Athe_1866), CelE (Athe_1865), and CelF (Athe_1860) are encoded in the Caldicellulosiruptor bescii glucan degradation locus (GDL). Each GH was affinity-tagged, overexpressed, and purified from recombinant C. bescii for side-by-side characterization in vitro and to examine the contribution of each of these enzymes to microcrystalline cellulose hydrolysis in vivo. All six recombinant GDL GHs were glycosylated, and deletion of glycosyltransferase Athe_1864 eliminated this posttranslational modification. A simplex centroid mixture experimental design revealed that in vitro optimal mixtures of the GDL GHs were predominantly CelA, CelC, and CelE, had low to moderate proportions of CelB and CelD, and minimal CelF. The best binary mixture contained CelA + CelB in a 3:2 molar ratio, whereas the best ternary mixture was composed of CelA + CelC + CelE in equimolar amounts. Neither the native C. bescii secretome nor cocktails of GDL GHs in vitro exceeded 25% of cellulose hydrolysis observed for wild-type C. bescii in vivo. C. bescii deletion strains lacking specific GDL GHs could be restored to wild-type degradation levels with the exogenous addition of either 5 µg/ml of recombinant GDL GH cocktails based on the natural secretome or mixtures optimized in vitro. Also, the addition of CelA up to 100 µg/ml provided no significant additional benefit. These results suggest that the C. bescii secretome is naturally balanced to achieve optimal synergy for cellulose degradation. They also reinforce the importance of microbial contributions to microcrystalline cellulose hydrolysis and suggest that mass action effects from glucan fermentation shift equilibria to drive degradation.}, number={10}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Conway, Jonathan M. and Crosby, James R. and McKinley, Bennett S. and Seals, Nathaniel L. and Adams, Michael W. W. and Kelly, Robert M.}, year={2018}, month={Oct}, pages={2426–2440} }
 @article{johnson_mach_grove_kelly_van cott_blum_2018, title={Secretion and fusion of biogeochemically active archaeal membrane vesicles}, volume={16}, ISSN={["1472-4669"]}, DOI={10.1111/gbi.12306}, abstractNote={Microbes belonging to the genus Metallosphaera oxidize sulfidic minerals. These organisms thrive at temperature extremes and are members of the archaeal phylum Crenarchaeota. Because they can employ a lithoautotrophic metabolism, energy availability likely limits their activity raising questions about how they conduct biogeochemical activity. Vesicles are membrane encapsulated structures produced by all biological lineages but using very different mechanisms. Across the Crenarchaeota, it has been proposed that a eukaryotic-like Endosomal Sorting Complex Required for Transport system promotes formation of these structures but in response to unknown signals and for undefined purposes. To address such questions, Metallosphaera sedula vesicle formation and function were studied under lithoautotrophic conditions. Energy deprivation was evaluated and found to stimulate vesicle synthesis while energy excess repressed vesicle formation. Purified vesicles adhered rapidly to the primary copper ore, chalcopyrite, and formed compact monolayers. These vesicle monolayers catalyzed iron oxidation and solubilization of mineralized copper in a time-dependent process. As these activities were membrane associated, their potential transfer by vesicle fusion to M. sedula cells was examined. Fluorophore-loaded vesicles rapidly transferred fluorescence under environmentally relevant conditions. Vesicles from a related archaeal species were also capable of fusion; however, this process was species-specific as vesicles from different species were incapable of fusion. In addition, vesicles produced by a copper-resistant M. sedula cell line transferred copper extrusion capacity along with improved viability over mutant M. sedula cells lacking copper transport proteins. Membrane vesicles may therefore play a role in modulating energy-related traits in geochemical environments by fusion-mediated protein delivery.}, number={6}, journal={GEOBIOLOGY}, author={Johnson, Tyler B. and Mach, Collin and Grove, Ryan and Kelly, Robert and Van Cott, Kevin and Blum, Paul}, year={2018}, month={Nov}, pages={659–673} }
 @article{peng_kelly_han_2018, title={Sequential processing with fermentative Caldicellulosiruptor kronotskyensis and chemolithoautotrophic Cupriavidus necator for converting rice straw and CO2 to polyhydroxybutyrate}, volume={115}, ISSN={["1097-0290"]}, DOI={10.1002/bit.26578}, abstractNote={Unpretreated rice straw was fermented by the extremely thermophilic bacterium Caldicellulosiruptor kronotskyensis, generating solubilized carbohydrates, organic acids, lignin-derived aromatics, H2, and CO2, which were subsequently used to produce polyhydroxybutyrate (PHB) by the chemolithoautotrophic bacterium Cupriavidus necator. The fermented liquid significantly enhanced the growth of C. necator, leading to a five-fold cell biomass yield, and a nine-fold PHB yield compared to what was obtained from conventional mineral media. This integrated process utilized all products of lignocellulose fermentation without H (electron) loss and carbon emission, while concomitantly enhancing CO2 fixation by C. necator for PHB production. The sequential coupling of C. kronotskyensis and C. necator provides not only a new biorefinery paradigm characterized by reduced pretreatment and saccharification requirements but also an efficient way for enhancing CO2 fixation.}, number={6}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Peng, Xiaowei and Kelly, Robert M. and Han, Yejun}, year={2018}, month={Jun}, pages={1624–1629} }
 @article{jia_kelly_han_2018, title={Simultaneous biosynthesis of (R)-acetoin and ethylene glycol from D-xylose through in vitro metabolic engineering}, volume={7}, ISSN={2214-0301}, url={http://dx.doi.org/10.1016/J.MEC.2018.E00074}, DOI={10.1016/J.MEC.2018.E00074}, abstractNote={(R)-acetoin is a four-carbon platform compound used as the precursor for synthesizing novel optically active materials. Ethylene glycol (EG) is a large-volume two-carbon commodity chemical used as the anti-freezing agent and building-block molecule for various polymers. Currently established microbial fermentation processes for converting monosaccharides to either (R)-acetoin or EG are plagued by the formation of undesirable by-products. We show here that a cell-free bioreaction scheme can generate enantiomerically pure acetoin and EG as co-products from biomass-derived D-xylose. The seven-step, ATP-free system included in situ cofactor regeneration and recruited enzymes from Escherichia coli W3110, Bacillus subtilis shaijiu 32 and Caulobacter crescentus CB 2. Optimized in vitro biocatalytic conditions generated 3.2 mM (R)-acetoin with stereoisomeric purity of 99.5% from 10 mM D-xylose at 30 °C and pH 7.5 after 24 h, with an initial (R)-acetoin productivity of 1.0 mM/h. Concomitantly, EG was produced at 5.5 mM, with an initial productivity of 1.7 mM/h. This in vitro biocatalytic platform illustrates the potential for production of multiple value-added biomolecules from biomass-based sugars with no ATP requirement.}, journal={Metabolic Engineering Communications}, publisher={Elsevier BV}, author={Jia, Xiaojing and Kelly, Robert M. and Han, Yejun}, year={2018}, month={Dec}, pages={e00074} }
 @article{poudel_giannone_basen_nookaew_poole_kelly_adams_hettich_2018, title={The diversity and specificity of the extracellular proteome in the cellulolytic bacterium Caldicellulosiruptor bescii is driven by the nature of the cellulosic growth substrate}, volume={11}, ISSN={["1754-6834"]}, DOI={10.1186/s13068-018-1076-1}, abstractNote={Caldicellulosiruptor bescii is a thermophilic cellulolytic bacterium that efficiently deconstructs lignocellulosic biomass into sugars, which subsequently can be fermented into alcohols, such as ethanol, and other products. Deconstruction of complex substrates by C. bescii involves a myriad of highly abundant, substrate-specific extracellular solute binding proteins (ESBPs) and carbohydrate-active enzymes (CAZymes) containing carbohydrate-binding modules (CBMs). Mass spectrometry-based proteomics was employed to investigate how these substrate recognition proteins and enzymes vary as a function of lignocellulosic substrates. Proteomic analysis revealed several key extracellular proteins that respond specifically to either C5 or C6 mono- and polysaccharides. These include proteins of unknown functions (PUFs), ESBPs, and CAZymes. ESBPs that were previously shown to interact more efficiently with hemicellulose and pectin were detected in high abundance during growth on complex C5 substrates, such as switchgrass and xylan. Some proteins, such as Athe_0614 and Athe_2368, whose functions are not well defined were predicted to be involved in xylan utilization and ABC transport and were significantly more abundant in complex and C5 substrates, respectively. The proteins encoded by the entire glucan degradation locus (GDL; Athe_1857, 1859, 1860, 1865, 1867, and 1866) were highly abundant under all growth conditions, particularly when C. bescii was grown on cellobiose, switchgrass, or xylan. In contrast, the glycoside hydrolases Athe_0609 (Pullulanase) and 0610, which both possess CBM20 and a starch binding domain, appear preferential to C5/complex substrate deconstruction. Some PUFs, such as Athe_2463 and 2464, were detected as highly abundant when grown on C5 substrates (xylan and xylose), also suggesting C5-substrate specificity. This study reveals the protein membership of the C. bescii secretome and demonstrates its plasticity based on the complexity (mono-/disaccharides vs. polysaccharides) and type of carbon (C5 vs. C6) available to the microorganism. The presence or increased abundance of extracellular proteins as a response to specific substrates helps to further elucidate C. bescii’s utilization and conversion of lignocellulosic biomass to biofuel and other valuable products. This includes improved characterization of extracellular proteins that lack discrete functional roles and are poorly/not annotated.}, journal={BIOTECHNOLOGY FOR BIOFUELS}, author={Poudel, Suresh and Giannone, Richard J. and Basen, Mirko and Nookaew, Intawat and Poole, Farris L., II and Kelly, Robert M. and Adams, Michael W. W. and Hettich, Robert L.}, year={2018}, month={Mar} }
 @article{singh_white_demirel_kelly_noll_blum_2018, title={Uncoupling Fermentative Synthesis of Molecular Hydrogen from Biomass Formation in Thermotoga maritima}, volume={84}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.00998-18}, abstractNote={Biorenewable energy sources are of growing interest to mitigate climate change, but like other commodities with nominal value, require innovation to maximize yields. Energetic considerations constrain production of many biofuels, such as molecular hydrogen (H 2 ) because of the competing needs for cell mass synthesis and metabolite formation. Here we describe cell lines of the extremophile Thermotoga maritima that exceed the physiologic limits for H 2 formation arising from genetic changes in fermentative metabolism. These cell lines were produced using a novel method called transient gene inactivation combined with adaptive laboratory evolution. Genome resequencing revealed unexpected changes in a maltose transport protein. Reduced rates of sugar uptake were accompanied by lower rates of growth and enhanced productivity of H 2 .}, number={17}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Singh, Raghuveer and White, Derrick and Demirel, Yasar and Kelly, Robert and Noll, Kenneth and Blum, Paul}, year={2018}, month={Sep} }
 @article{zurawski_khatibi_akinosho_straub_compton_conway_lee_ragauskas_davison_adams_et al._2017, title={Bioavailability of Carbohydrate Content in Natural and Transgenic Switchgrasses for the Extreme Thermophile Caldicellulosiruptor bescii}, volume={83}, ISSN={["1098-5336"]}, DOI={10.1128/aem.00969-17}, abstractNote={ABSTRACT Improving access to the carbohydrate content of lignocellulose is key to reducing recalcitrance for microbial deconstruction and conversion to fuels and chemicals. Caldicellulosiruptor bescii completely solubilizes naked microcrystalline cellulose, yet this transformation is impeded within the context of the plant cell wall by a network of lignin and hemicellulose. Here, the bioavailability of carbohydrates to C. bescii at 70°C was examined for reduced lignin transgenic switchgrass lines COMT3(+) and MYB Trans, their corresponding parental lines (cultivar Alamo) COMT3(−) and MYB wild type (WT), and the natural variant cultivar Cave-in-Rock (CR). Transgenic modification improved carbohydrate solubilization by C. bescii to 15% (2.3-fold) for MYB and to 36% (1.5-fold) for COMT, comparable to the levels achieved for the natural variant, CR (36%). Carbohydrate solubilization was nearly doubled after two consecutive microbial fermentations compared to one microbial step, but it never exceeded 50% overall. Hydrothermal treatment (180°C) prior to microbial steps improved solubilization 3.7-fold for the most recalcitrant line (MYB WT) and increased carbohydrate recovery to nearly 50% for the least recalcitrant lines [COMT3(+) and CR]. Alternating microbial and hydrothermal steps (T→M→T→M) further increased bioavailability, achieving carbohydrate solubilization ranging from 50% for MYB WT to above 70% for COMT3(+) and CR. Incomplete carbohydrate solubilization suggests that cellulose in the highly lignified residue was inaccessible; indeed, residue from the T→M→T→M treatment was primarily glucan and inert materials (lignin and ash). While C. bescii could significantly solubilize the transgenic switchgrass lines and natural variant tested here, additional or alternative strategies (physical, chemical, enzymatic, and/or genetic) are needed to eliminate recalcitrance. IMPORTANCE Key to a microbial process for solubilization of plant biomass is the organism's access to the carbohydrate content of lignocellulose. Economically viable routes will characteristically minimize physical, chemical, and biological pretreatment such that microbial steps contribute to the greatest extent possible. Recently, transgenic versions of plants and trees have been developed with the intention of lowering the barrier to lignocellulose conversion, with particular focus on lignin content and composition. Here, the extremely thermophilic bacterium Caldicellulosiruptor bescii was used to solubilize natural and genetically modified switchgrass lines, with and without the aid of hydrothermal treatment. For lignocellulose conversion, it is clear that the microorganism, plant biomass substrate, and processing steps must all be considered simultaneously to achieve optimal results. Whether switchgrass lines engineered for low lignin or natural variants with desirable properties are used, conversion will depend on microbial access to crystalline cellulose in the plant cell wall.}, number={17}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Zurawski, Jeffrey V. and Khatibi, Piyum A. and Akinosho, Hannah O. and Straub, Christopher T. and Compton, Scott H. and Conway, Jonathan M. and Lee, Laura L. and Ragauskas, Arthur J. and Davison, Brian H. and Adams, Michael W. W. and et al.}, year={2017}, month={Sep} }
 @article{blumer‐schuette_zurawski_conway_khatibi_lewis_li_chiang_kelly_2017, title={C
              aldicellulosiruptor saccharolyticus
            
            transcriptomes reveal consequences of chemical pretreatment and genetic modification of lignocellulose}, volume={10}, ISSN={1751-7915 1751-7915}, url={http://dx.doi.org/10.1111/1751-7915.12494}, DOI={10.1111/1751-7915.12494}, abstractNote={Summary Recalcitrance of plant biomass is a major barrier for commercially feasible cellulosic biofuel production. Chemical and enzymatic assays have been developed to measure recalcitrance and carbohydrate composition; however, none of these assays can directly report which polysaccharides a candidate microbe will sense during growth on these substrates. Here, we propose using the transcriptomic response of the plant biomass‐deconstructing microbe, Caldicellulosiruptor saccharolyticus , as a direct measure of how suitable a sample of plant biomass may be for fermentation based on the bioavailability of polysaccharides. Key genes were identified using the global gene response of the microbe to model plant polysaccharides and various types of unpretreated, chemically pretreated and genetically modified plant biomass. While the majority of C. saccharolyticus genes responding were similar between plant biomasses; subtle differences were discernable, most importantly between chemically pretreated or genetically modified biomass that both exhibit similar levels of solubilization by the microbe. Furthermore, the results here present a new paradigm for assessing plant–microbe interactions that can be deployed as a biological assay to report on the complexity and recalcitrance of plant biomass.}, number={6}, journal={Microbial Biotechnology}, publisher={Wiley}, author={Blumer‐Schuette, Sara E. and Zurawski, Jeffrey V. and Conway, Jonathan M. and Khatibi, Piyum and Lewis, Derrick L. and Li, Quanzi and Chiang, Vincent L. and Kelly, Robert M.}, year={2017}, month={Mar}, pages={1546–1557} }
 @article{antranikian_suleiman_schäfers_adams_bartolucci_blamey_birkeland_bonch-osmolovskaya_da costa_cowan_et al._2017, title={Diversity of bacteria and archaea from two shallow marine hydrothermal vents from Vulcano Island}, volume={21}, ISSN={1431-0651 1433-4909}, url={http://dx.doi.org/10.1007/s00792-017-0938-y}, DOI={10.1007/s00792-017-0938-y}, number={4}, journal={Extremophiles}, publisher={Springer Science and Business Media LLC}, author={Antranikian, Garabed and Suleiman, Marcel and Schäfers, Christian and Adams, Michael W. W. and Bartolucci, Simonetta and Blamey, Jenny M. and Birkeland, Nils-Kåre and Bonch-Osmolovskaya, Elizaveta and da Costa, Milton S. and Cowan, Don and et al.}, year={2017}, month={May}, pages={733–742} }
 @article{keller_lipscomb_nguyen_crowley_schut_scott_kelly_adams_2017, title={Ethanol production by the hyperthermophilic archaeon
            Pyrococcus furiosus
            by expression of bacterial bifunctional alcohol dehydrogenases}, volume={10}, ISSN={1751-7915 1751-7915}, url={http://dx.doi.org/10.1111/1751-7915.12486}, DOI={10.1111/1751-7915.12486}, abstractNote={Summary Ethanol is an important target for the renewable production of liquid transportation fuels. It can be produced biologically from pyruvate, via pyruvate decarboxylase, or from acetyl‐CoA, by alcohol dehydrogenase E (AdhE). Thermophilic bacteria utilize AdhE, which is a bifunctional enzyme that contains both acetaldehyde dehydrogenase and alcohol dehydrogenase activities. Many of these organisms also contain a separate alcohol dehydrogenase (AdhA) that generates ethanol from acetaldehyde, although the role of AdhA in ethanol production is typically not clear. As acetyl‐CoA is a key central metabolite that can be generated from a wide range of substrates, AdhE can serve as a single gene fuel module to produce ethanol through primary metabolic pathways. The focus here is on the hyperthermophilic archaeon Pyrococcus furiosus, which grows by fermenting sugar to acetate, CO 2 and H 2 . Previously, by the heterologous expression of adhA from a thermophilic bacterium, P. furiosus was shown to produce ethanol by a novel mechanism from acetate, mediated by AdhA and the native enzyme aldehyde oxidoreductase ( AOR ). In this study, the AOR gene was deleted from P. furiosus to evaluate ethanol production directly from acetyl‐CoA by heterologous expression of the adhE gene from eight thermophilic bacteria. Only AdhEs from two Thermoanaerobacter strains showed significant activity in cell‐free extracts of recombinant P. furiosus and supported ethanol production in vivo . In the AOR deletion background, the highest amount of ethanol (estimated 61% theoretical yield) was produced when adhE and adhA from Thermoanaerobacter were co‐expressed.}, number={6}, journal={Microbial Biotechnology}, publisher={Wiley}, author={Keller, Matthew W. and Lipscomb, Gina L. and Nguyen, Diep M. and Crowley, Alexander T. and Schut, Gerrit J. and Scott, Israel and Kelly, Robert M. and Adams, Michael W. W.}, year={2017}, month={Feb}, pages={1535–1545} }
 @misc{straub_zeldes_schut_adams_kelly_2017, title={Extremely thermophilic energy metabolisms: biotechnological prospects}, volume={45}, ISSN={["1879-0429"]}, DOI={10.1016/j.copbio.2017.02.016}, abstractNote={New strategies for metabolic engineering of extremely thermophilic microorganisms to produce bio-based fuels and chemicals could leverage pathways and physiological features resident in extreme thermophiles for improved outcomes. Furthermore, very recent advances in genetic tools for these microorganisms make it possible for them to serve as metabolic engineering hosts. Beyond providing a higher temperature alternative to mesophilic platforms, exploitation of strategic metabolic characteristics of high temperature microorganisms grants new opportunities for biotechnological products. This review considers recent developments in extreme thermophile biology as they relate to new horizons for energy biotechnology.}, journal={CURRENT OPINION IN BIOTECHNOLOGY}, author={Straub, Christopher T. and Zeldes, Benjamin M. and Schut, Gerrit J. and Adams, Michael W. W. and Kelly, Robert M.}, year={2017}, month={Jun}, pages={104–112} }
 @article{conway_mckinley_seals_hernandez_khatibi_poudel_giannone_hettich_williams-rhaesa_lipscomb_et al._2017, title={Functional Analysis of the Glucan Degradation Locus in Caldicellulosiruptor bescii Reveals Essential Roles of Component Glycoside Hydrolases in Plant Biomass Deconstruction}, volume={83}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01828-17}, abstractNote={ABSTRACT The ability to hydrolyze microcrystalline cellulose is an uncommon feature in the microbial world, but it can be exploited for conversion of lignocellulosic feedstocks into biobased fuels and chemicals. Understanding the physiological and biochemical mechanisms by which microorganisms deconstruct cellulosic material is key to achieving this objective. The glucan degradation locus (GDL) in the genomes of extremely thermophilic Caldicellulosiruptor species encodes polysaccharide lyases (PLs), unique cellulose binding proteins (tāpirins), and putative posttranslational modifying enzymes, in addition to multidomain, multifunctional glycoside hydrolases (GHs), thereby representing an alternative paradigm for plant biomass degradation compared to fungal or cellulosomal systems. To examine the individual and collective in vivo roles of the glycolytic enzymes, the six GH genes in the GDL of Caldicellulosiruptor bescii were systematically deleted, and the extents to which the resulting mutant strains could solubilize microcrystalline cellulose (Avicel) and plant biomass (switchgrass or poplar) were examined. Three of the GDL enzymes, Athe_1867 (CelA) (GH9-CBM3-CBM3-CBM3-GH48), Athe_1859 (GH5-CBM3-CBM3-GH44), and Athe_1857 (GH10-CBM3-CBM3-GH48), acted synergistically in vivo and accounted for 92% of naked microcrystalline cellulose (Avicel) degradation. However, the relative importance of the GDL GHs varied for the plant biomass substrates tested. Furthermore, mixed cultures of mutant strains showed that switchgrass solubilization depended on the secretome-bound enzymes collectively produced by the culture, not on the specific strain from which they came. These results demonstrate that certain GDL GHs are primarily responsible for the degradation of microcrystalline cellulose-containing substrates by C. bescii and provide new insights into the workings of a novel microbial mechanism for lignocellulose utilization. IMPORTANCE The efficient and extensive degradation of complex polysaccharides in lignocellulosic biomass, particularly microcrystalline cellulose, remains a major barrier to its use as a renewable feedstock for the production of fuels and chemicals. Extremely thermophilic bacteria from the genus Caldicellulosiruptor rapidly degrade plant biomass to fermentable sugars at temperatures of 70 to 78°C, although the specific mechanism by which this occurs is not clear. Previous comparative genomic studies identified a genomic locus found only in certain Caldicellulosiruptor species that was hypothesized to be mainly responsible for microcrystalline cellulose degradation. By systematically deleting genes in this locus in Caldicellulosiruptor bescii , the nuanced, substrate-specific in vivo roles of glycolytic enzymes in deconstructing crystalline cellulose and plant biomasses could be discerned. The results here point to synergism of three multidomain cellulases in C. bescii , working in conjunction with the aggregate secreted enzyme inventory, as the key to the plant biomass degradation ability of this extreme thermophile.}, number={24}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Conway, Jonathan M. and McKinley, Bennett S. and Seals, Nathaniel L. and Hernandez, Diana and Khatibi, Piyum A. and Poudel, Suresh and Giannone, Richard J. and Hettich, Robert L. and Williams-Rhaesa, Amanda M. and Lipscomb, Gina L. and et al.}, year={2017}, month={Dec} }
 @article{williams-rhaesa_poole_dinsmore_lipscomb_rubinstein_scott_conway_lee_khatibi_kelly_et al._2017, title={Genome Stability in Engineered Strains of the Extremely Thermophilic Lignocellulose-Degrading Bacterium Caldicellulosiruptor bescii}, volume={83}, ISSN={["1098-5336"]}, DOI={10.1128/aem.00444-17}, abstractNote={ABSTRACT Caldicellulosiruptor bescii is the most thermophilic cellulose degrader known and is of great interest because of its ability to degrade nonpretreated plant biomass. For biotechnological applications, an efficient genetic system is required to engineer it to convert plant biomass into desired products. To date, two different genetically tractable lineages of C. bescii strains have been generated. The first (JWCB005) is based on a random deletion within the pyrimidine biosynthesis genes pyrFA , and the second (MACB1018) is based on the targeted deletion of pyrE , making use of a kanamycin resistance marker. Importantly, an active insertion element, IS Cbe4 , was discovered in C. bescii when it disrupted the gene for lactate dehydrogenase ( ldh ) in strain JWCB018, constructed in the JWCB005 background. Additional instances of IS Cbe4 movement in other strains of this lineage are presented herein. These observations raise concerns about the genetic stability of such strains and their use as metabolic engineering platforms. In order to investigate genome stability in engineered strains of C. bescii from the two lineages, genome sequencing and Southern blot analyses were performed. The evidence presented shows a dramatic increase in the number of single nucleotide polymorphisms, insertions/deletions, and IS Cbe4 elements within the genome of JWCB005, leading to massive genome rearrangements in its daughter strain, JWCB018. Such dramatic effects were not evident in the newer MACB1018 lineage, indicating that JWCB005 and its daughter strains are not suitable for metabolic engineering purposes in C. bescii . Furthermore, a facile approach for assessing genomic stability in C. bescii has been established. IMPORTANCE Caldicellulosiruptor bescii is a cellulolytic extremely thermophilic bacterium of great interest for metabolic engineering efforts geared toward lignocellulosic biofuel and bio-based chemical production. Genetic technology in C. bescii has led to the development of two uracil auxotrophic genetic background strains for metabolic engineering. We show that strains derived from the genetic background containing a random deletion in uracil biosynthesis genes ( pyrFA ) have a dramatic increase in the number of single nucleotide polymorphisms, insertions/deletions, and IS Cbe4 insertion elements in their genomes compared to the wild type. At least one daughter strain of this lineage also contains large-scale genome rearrangements that are flanked by these IS Cbe4 elements. In contrast, strains developed from the second background strain developed using a targeted deletion strategy of the uracil biosynthetic gene pyrE have a stable genome structure, making them preferable for future metabolic engineering studies.}, number={14}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Williams-Rhaesa, Amanda M. and Poole, Farris L., II and Dinsmore, Jessica T. and Lipscomb, Gina L. and Rubinstein, Gabriel M. and Scott, Israel M. and Conway, Jonathan M. and Lee, Laura L. and Khatibi, Piyum A. and Kelly, Robert M. and et al.}, year={2017}, month={Jul} }
 @article{khatibi_chou_loder_zurawski_adams_kelly_2017, title={Impact of growth mode, phase, and rate on the metabolic state of the extremely thermophilic archaeon Pyrococcus furiosus}, volume={114}, ISSN={["1097-0290"]}, DOI={10.1002/bit.26408}, abstractNote={The archaeon Pyrococcus furiosus is emerging as a metabolic engineering platform for production of fuels and chemicals, such that more must be known about this organism's characteristics in bioprocessing contexts. Its ability to grow at temperatures from 70 to greater than 100°C and thereby avoid contamination, offers the opportunity for long duration, continuous bioprocesses as an alternative to batch systems. Toward that end, we analyzed the transcriptome of P. furiosus to reveal its metabolic state during different growth modes that are relevant to bioprocessing. As cells progressed from exponential to stationary phase in batch cultures, genes involved in biosynthetic pathways important to replacing diminishing supplies of key nutrients and genes responsible for the onset of stress responses were up-regulated. In contrast, during continuous culture, the progression to higher dilution rates down-regulated many biosynthetic processes as nutrient supplies were increased. Most interesting was the contrast between batch exponential phase and continuous culture at comparable growth rates (∼0.4 hr−1), where over 200 genes were differentially transcribed, indicating among other things, N-limitation in the chemostat and the onset of oxidative stress. The results here suggest that cellular processes involved in carbon and electron flux in P. furiosus were significantly impacted by growth mode, phase and rate, factors that need to be taken into account when developing successful metabolic engineering strategies.}, number={12}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Khatibi, Piyum A. and Chou, Chung-jung and Loder, Andrew J. and Zurawski, Jeffrey V. and Adams, Michael W. W. and Kelly, Robert M.}, year={2017}, month={Dec}, pages={2947–2954} }
 @misc{counts_zeldes_lee_straub_adams_kelly_2017, title={Physiological, metabolic and biotechnological features of extremely thermophilic microorganisms}, volume={9}, ISSN={["1939-005X"]}, DOI={10.1002/wsbm.1377}, abstractNote={The current upper thermal limit for life as we know it is approximately 120°C. Microorganisms that grow optimally at temperatures of 75°C and above are usually referred to as ‘extreme thermophiles’ and include both bacteria and archaea. For over a century, there has been great scientific curiosity in the basic tenets that support life in thermal biotopes on earth and potentially on other solar bodies. Extreme thermophiles can be aerobes, anaerobes, autotrophs, heterotrophs, or chemolithotrophs, and are found in diverse environments including shallow marine fissures, deep sea hydrothermal vents, terrestrial hot springs—basically, anywhere there is hot water. Initial efforts to study extreme thermophiles faced challenges with their isolation from difficult to access locales, problems with their cultivation in laboratories, and lack of molecular tools. Fortunately, because of their relatively small genomes, many extreme thermophiles were among the first organisms to be sequenced, thereby opening up the application of systems biology-based methods to probe their unique physiological, metabolic and biotechnological features. The bacterial genera Caldicellulosiruptor, Thermotoga and Thermus, and the archaea belonging to the orders Thermococcales and Sulfolobales, are among the most studied extreme thermophiles to date. The recent emergence of genetic tools for many of these organisms provides the opportunity to move beyond basic discovery and manipulation to biotechnologically relevant applications of metabolic engineering. WIREs Syst Biol Med 2017, 9:e1377. doi: 10.1002/wsbm.1377 This article is categorized under: Biological Mechanisms > Metabolism}, number={3}, journal={WILEY INTERDISCIPLINARY REVIEWS-SYSTEMS BIOLOGY AND MEDICINE}, author={Counts, James A. and Zeldes, Benjamin M. and Lee, Laura L. and Straub, Christopher T. and Adams, Michael W. W. and Kelly, Robert M.}, year={2017}, month={May} }
 @book{adams_kelly_hawkins_menon_lipscomb_schut_2017, title={Sequestration of CO2 with H2 into useful products}, number={9,587,256}, author={Adams, M.W.W. and Kelly, R.M. and Hawkins, A.S. and Menon, A.L. and Lipscomb, G.P. and Schut, G.J.}, year={2017}, month={Mar} }
 @article{adams_kelly_2017, title={The renaissance of life near the boiling point - at last, genetics and metabolic engineering}, volume={10}, ISSN={["1751-7915"]}, DOI={10.1111/1751-7915.12463}, number={1}, journal={MICROBIAL BIOTECHNOLOGY}, author={Adams, Michael W. W. and Kelly, Robert M.}, year={2017}, month={Jan}, pages={37–39} }
 @article{abu saleh_han_lu_wang_li_kelly_li_2017, title={Two Distinct alpha-L-Arabinofuranosidases in Caldicellulosiruptor Species Drive Degradation of Arabinose-Based Polysaccharides}, volume={83}, ISSN={["1098-5336"]}, DOI={10.1128/aem.00574-17}, abstractNote={ABSTRACT Species in the extremely thermophilic genus Caldicellulosiruptor can degrade unpretreated plant biomass through the action of multimodular glycoside hydrolases. To date, most focus with these bacteria has been on hydrolysis of glucans and xylans, while the biodegradation mechanism for arabinose-based polysaccharides remains unclear. Here, putative α- l -arabinofuranosidases (AbFs) were identified in Caldicellulosiruptor species by homology to less-thermophilic versions of these enzymes. From this screen, an extracellular XynF was determined to be a key factor in hydrolyzing α-1,2-, α-1,3-, and α-1,5- l -arabinofuranosyl residues of arabinose-based polysaccharides. Combined with a GH11 xylanase (XynA), XynF increased arabinoxylan hydrolysis more than 6-fold compared to the level seen with XynA alone, likely the result of XynF removing arabinofuranosyl side chains to generate linear xylans that were readily degraded. A second AbF, the intracellular AbF51, preferentially cleaved the α-1,5- l -arabinofuranosyl glycoside bonds within sugar beet arabinan. β-Xylosidases, such as GH39 Xyl39B, facilitated the hydrolysis of arabinofuranosyl residues at the nonreducing terminus of the arabinose-branched xylo-oligosaccharides by AbF51. These results demonstrate the separate but complementary contributions of extracellular XynF and cytosolic AbF51 in processing the bioconversion of arabinose-containing oligosaccharides to fermentable monosaccharides. IMPORTANCE Degradation of hemicellulose, due to its complex chemical structure, presents a major challenge during bioconversion of lignocellulosic biomass to biobased fuels and chemicals. Degradation of arabinose-containing polysaccharides, in particular, can be a key bottleneck in this process. Among Caldicellulosiruptor species, the multimodular arabinofuranosidase XynF is present in only selected members of this genus. This enzyme exhibited high hydrolysis activity, broad specificity, and strong synergism with other hemicellulases acting on arabino-polysaccharides. An intracellular arabinofuranosidase, AbF51, occurs in all Caldicellulosiruptor species and, in conjunction with xylosidases, processes the bioconversion of arabinose-branched oligosaccharides to fermentable monosaccharides. Taken together, the data suggest that plant biomass degradation in Caldicellulosiruptor species involves extracellular XynF that acts synergistically with other hemicellulases to digest arabino-polysaccharides that are subsequently transported and degraded further by intracellular AbF51 to produce short-chain arabino sugars.}, number={13}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Abu Saleh, Mohammad and Han, Wen-Jie and Lu, Ming and Wang, Bing and Li, Huayue and Kelly, Robert M. and Li, Fu-Li}, year={2017}, month={Jul} }
 @article{mukherjee_wheaton_counts_ijeomah_desai_kelly_2017, title={VapC toxins drive cellular dormancy under uranium stress for the extreme thermoacidophile Metallosphaera prunae}, volume={19}, ISSN={["1462-2920"]}, DOI={10.1111/1462-2920.13808}, abstractNote={When abruptly exposed to toxic levels of hexavalent uranium, the extremely thermoacidophilic archaeon Metallosphaera prunae, originally isolated from an abandoned uranium mine, ceased to grow, and concomitantly exhibited heightened levels of cytosolic ribonuclease activity that corresponded to substantial degradation of cellular RNA. The M. prunae transcriptome during ‘uranium-shock’ implicated VapC toxins as possible causative agents of the observed RNA degradation. Identifiable VapC toxins and PIN-domain proteins encoded in the M. prunae genome were produced and characterized, three of which (VapC4, VapC7, VapC8) substantially degraded M. prunae rRNA in vitro. RNA cleavage specificity for these VapCs mapped to motifs within M. prunae rRNA. Furthermore, based on frequency of cleavage sequences, putative target mRNAs for these VapCs were identified; these were closely associated with translation, transcription, and replication. It is interesting to note that Metallosphaera sedula, a member of the same genus and which has a nearly identical genome sequence but not isolated from a uranium-rich biotope, showed no evidence of dormancy when exposed to this metal. M. prunae utilizes VapC toxins for post-transcriptional regulation under uranium stress to enter a cellular dormant state, thereby providing an adaptive response to what would otherwise be a deleterious environmental perturbation.}, number={7}, journal={ENVIRONMENTAL MICROBIOLOGY}, author={Mukherjee, Arpan and Wheaton, Garrett H. and Counts, James A. and Ijeomah, Brenda and Desai, Jigar and Kelly, Robert M.}, year={2017}, month={Jul}, pages={2831–2842} }
 @article{lipscomb_conway_blumer-schuette_kelly_adams_2016, title={A Highly Thermostable Kanamycin Resistance Marker Expands the Tool Kit for Genetic Manipulation of Caldicellulosiruptor bescii}, volume={82}, ISSN={["1098-5336"]}, DOI={10.1128/aem.00570-16}, abstractNote={Caldicellulosiruptor bescii, an anaerobic Gram-positive bacterium with an optimal growth temperature of 78°C, is the most thermophilic cellulose degrader known. It is of great biotechnological interest, as it efficiently deconstructs nonpretreated lignocellulosic plant biomass. Currently, its genetic manipulation relies on a mutant uracil auxotrophic background strain that contains a random deletion in the pyrF genome region. The pyrF gene serves as a genetic marker to select for uracil prototrophy, and it can also be counterselected for loss via resistance to the compound 5-fluoroorotic acid (5-FOA). To expand the C. bescii genetic tool kit, kanamycin resistance was developed as a selection for genetic manipulation. A codon-optimized version of the highly thermostable kanamycin resistance gene (named Cbhtk) allowed the use of kanamycin selection to obtain transformants of either replicating or integrating vector constructs in C. bescii These strains showed resistance to kanamycin at concentrations >50 μg · ml(-1), whereas wild-type C. bescii was sensitive to kanamycin at 10 μg · ml(-1) In addition, placement of the Cbhtk marker between homologous recombination regions in an integrating vector allowed direct selection of a chromosomal mutation using both kanamycin and 5-FOA. Furthermore, the use of kanamycin selection enabled the targeted deletion of the pyrE gene in wild-type C. bescii, generating a uracil auxotrophic genetic background strain resistant to 5-FOA. The pyrE gene functioned as a counterselectable marker, like pyrF, and was used together with Cbhtk in the ΔpyrE background strain to delete genes encoding lactate dehydrogenase and the CbeI restriction enzyme.Caldicellulosiruptor bescii is a thermophilic anaerobic bacterium with an optimal growth temperature of 78°C, and it has the ability to efficiently deconstruct nonpretreated lignocellulosic plant biomass. It is, therefore, of biotechnological interest for genetic engineering applications geared toward biofuel production. The current genetic system used with C. bescii is based upon only a single selection strategy, and this uses the gene involved in a primary biosynthetic pathway. There are many advantages with an additional genetic selection using an antibiotic. This presents a challenge for thermophilic microorganisms, as only a limited number of antibiotics are stable above 50°C, and a thermostable version of the enzyme conferring antibiotic resistance must be obtained. In this work, we have developed a selection system for C. bescii using the antibiotic kanamycin and have shown that, in combination with the biosynthetic gene marker, it can be used to efficiently delete genes in this organism.}, number={14}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Lipscomb, Gina L. and Conway, Jonathan M. and Blumer-Schuette, Sara E. and Kelly, Robert M. and Adams, Michael W. W.}, year={2016}, month={Jul}, pages={4421–4428} }
 @article{lian_zeldes_lipscomb_hawkins_han_loder_nishiyama_adams_kelly_2016, title={Ancillary contributions of heterologous biotin protein ligase and carbonic anhydrase for CO2 incorporation into 3-hydroxypropionate by metabolically engineered Pyrococcus furiosus}, volume={113}, ISSN={0006-3592}, url={http://dx.doi.org/10.1002/BIT.26033}, DOI={10.1002/BIT.26033}, abstractNote={Acetyl-Coenzyme A carboxylase (ACC), malonyl-CoA reductase (MCR), and malonic semialdehyde reductase (MRS) convert HCO3− and acetyl-CoA into 3-hydroxypropionate (3HP) in the 3-hydroxypropionate/4-hydroxybutyrate carbon fixation cycle resident in the extremely thermoacidophilic archaeon Metallosphaera sedula. These three enzymes, when introduced into the hyperthermophilic archaeon Pyrococcus furiosus, enable production of 3HP from maltose and CO2. Sub-optimal function of ACC was hypothesized to be limiting for production of 3HP, so accessory enzymes carbonic anhydrase (CA) and biotin protein ligase (BPL) from M. sedula were produced recombinantly in Escherichia coli to assess their function. P. furiosus lacks a native, functional CA, while the M. sedula CA (Msed_0390) has a specific activity comparable to other microbial versions of this enzyme. M. sedula BPL (Msed_2010) was shown to biotinylate the β-subunit (biotin carboxyl carrier protein) of the ACC in vitro. Since the native BPLs in E. coli and P. furiosus may not adequately biotinylate the M. sedula ACC, the carboxylase was produced in P. furiosus by co-expression with the M. sedula BPL. The baseline production strain, containing only the ACC, MCR, and MSR, grown in a CO2-sparged bioreactor reached titers of approximately 40 mg/L 3HP. Strains in which either the CA or BPL accessory enzyme from M. sedula was added to the pathway resulted in improved titers, 120 or 370 mg/L, respectively. The addition of both M. sedula CA and BPL, however, yielded intermediate titers of 3HP (240 mg/L), indicating that the effects of CA and BPL on the engineered 3HP pathway were not additive, possible reasons for which are discussed. While further efforts to improve 3HP production by regulating gene dosage, improving carbon flux and optimizing bioreactor operation are needed, these results illustrate the ancillary benefits of accessory enzymes for incorporating CO2 into 3HP production in metabolically engineered P. furiosus, and hint at the important role that CA and BPL likely play in the native 3HP/4HB pathway in M. sedula. Biotechnol. Bioeng. 2016;113: 2652–2660. © 2016 Wiley Periodicals, Inc.}, number={12}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Lian, Hong and Zeldes, Benjamin M. and Lipscomb, Gina L. and Hawkins, Aaron B. and Han, Yejun and Loder, Andrew J. and Nishiyama, Declan and Adams, Michael W.W. and Kelly, Robert M.}, year={2016}, month={Jun}, pages={2652–2660} }
 @inbook{loder_zeldes_conway_counts_straub_khatibi_lee_vitko_keller_rhaesa_et al._2016, place={Weinheim, Germany}, title={Extreme Thermophiles as Metabolic Engineering Platforms: Strategies and Current Perspective}, volume={1}, ISBN={9783527807796 9783527341795}, url={http://dx.doi.org/10.1002/9783527807796.ch14}, DOI={10.1002/9783527807796.ch14}, booktitle={Industrial Biotechnology: Microorganisma}, publisher={Wiley-VCH Verlag GmbH & Co. KGaA}, author={Loder, Andrew J. and Zeldes, Benjamin M. and Conway, Jonathan M. and Counts, James A. and Straub, Christopher T. and Khatibi, Piyum A. and Lee, Laura L. and Vitko, Nicholas P. and Keller, Matthew W. and Rhaesa, Amanda M. and et al.}, editor={Wittmann, Christopher and Liao, James C.Editors}, year={2016}, month={Nov}, pages={505–580} }
 @article{schut_lipscomb_nguyen_kelly_adams_2016, title={Heterologous Production of an Energy-Conserving Carbon Monoxide Dehydrogenase Complex in the Hyperthermophile Pyrococcus furiosus}, volume={7}, ISSN={["1664-302X"]}, DOI={10.3389/fmicb.2016.00029}, abstractNote={Carbon monoxide (CO) is an important intermediate in anaerobic carbon fixation pathways in acetogenesis and methanogenesis. In addition, some anaerobes can utilize CO as an energy source. In the hyperthermophilic archaeon Thermococcus onnurineus, which grows optimally at 80°C, CO oxidation and energy conservation is accomplished by a respiratory complex encoded by a 16-gene cluster containing a CO dehydrogenase, a membrane-bound [NiFe]-hydrogenase and a Na(+)/H(+) antiporter module. This complex oxidizes CO, evolves CO2 and H2, and generates a Na(+) motive force that is used to conserve energy by a Na(+)-dependent ATP synthase. Herein we used a bacterial artificial chromosome to insert the 13.2 kb gene cluster encoding the CO-oxidizing respiratory complex of T. onnurineus into the genome of the heterotrophic archaeon, Pyrococcus furiosus, which grows optimally at 100°C. P. furiosus is normally unable to utilize CO, however, the recombinant strain readily oxidized CO and generated H2 at 80°C. Moreover, CO also served as an energy source and allowed the P. furiosus strain to grow with a limiting concentration of sugar or with peptides as the carbon source. Moreover, CO oxidation by P. furiosus was also coupled to the re-utilization, presumably for biosynthesis, of acetate generated by fermentation. The functional transfer of CO utilization between Thermococcus and Pyrococcus species demonstrated herein is representative of the horizontal gene transfer of an environmentally relevant metabolic capability. The transfer of CO utilizing, hydrogen-producing genetic modules also has applications for biohydrogen production and a CO-based industrial platform for various thermophilic organisms.}, journal={FRONTIERS IN MICROBIOLOGY}, author={Schut, Gerrit J. and Lipscomb, Gina L. and Nguyen, Diep M. N. and Kelly, Robert M. and Adams, Michael W. W.}, year={2016}, month={Jan} }
 @article{conway_pierce_le_harper_wright_tucker_zurawski_lee_blumer-schuette_kelly_2016, title={Multidomain, Surface Layer-associated Glycoside Hydrolases Contribute to Plant Polysaccharide Degradation by Caldicellulosiruptor Species}, volume={291}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.m115.707810}, abstractNote={The genome of the extremely thermophilic bacterium Caldicellulosiruptor kronotskyensis encodes 19 surface layer (S-layer) homology (SLH) domain-containing proteins, the most in any Caldicellulosiruptor species genome sequenced to date. These SLH proteins include five glycoside hydrolases (GHs) and one polysaccharide lyase, the genes for which were transcribed at high levels during growth on plant biomass. The largest GH identified so far in this genus, Calkro_0111 (2,435 amino acids), is completely unique to C. kronotskyensis and contains SLH domains. Calkro_0111 was produced recombinantly in Escherichia coli as two pieces, containing the GH16 and GH55 domains, respectively, as well as putative binding and spacer domains. These displayed endo- and exoglucanase activity on the β-1,3-1,6-glucan laminarin. A series of additional truncation mutants of Calkro_0111 revealed the essential architectural features required for catalytic function. Calkro_0402, another of the SLH domain GHs in C. kronotskyensis, when produced in E. coli, was active on a variety of xylans and β-glucans. Unlike Calkro_0111, Calkro_0402 is highly conserved in the genus Caldicellulosiruptor and among other biomass-degrading Firmicutes but missing from Caldicellulosiruptor bescii. As such, the gene encoding Calkro_0402 was inserted into the C. bescii genome, creating a mutant strain with its S-layer extensively decorated with Calkro_0402. This strain consequently degraded xylans more extensively than wild-type C. bescii. The results here provide new insights into the architecture and role of SLH domain GHs and demonstrate that hemicellulose degradation can be enhanced through non-native SLH domain GHs engineered into the genomes of Caldicellulosiruptor species. The genome of the extremely thermophilic bacterium Caldicellulosiruptor kronotskyensis encodes 19 surface layer (S-layer) homology (SLH) domain-containing proteins, the most in any Caldicellulosiruptor species genome sequenced to date. These SLH proteins include five glycoside hydrolases (GHs) and one polysaccharide lyase, the genes for which were transcribed at high levels during growth on plant biomass. The largest GH identified so far in this genus, Calkro_0111 (2,435 amino acids), is completely unique to C. kronotskyensis and contains SLH domains. Calkro_0111 was produced recombinantly in Escherichia coli as two pieces, containing the GH16 and GH55 domains, respectively, as well as putative binding and spacer domains. These displayed endo- and exoglucanase activity on the β-1,3-1,6-glucan laminarin. A series of additional truncation mutants of Calkro_0111 revealed the essential architectural features required for catalytic function. Calkro_0402, another of the SLH domain GHs in C. kronotskyensis, when produced in E. coli, was active on a variety of xylans and β-glucans. Unlike Calkro_0111, Calkro_0402 is highly conserved in the genus Caldicellulosiruptor and among other biomass-degrading Firmicutes but missing from Caldicellulosiruptor bescii. As such, the gene encoding Calkro_0402 was inserted into the C. bescii genome, creating a mutant strain with its S-layer extensively decorated with Calkro_0402. This strain consequently degraded xylans more extensively than wild-type C. bescii. The results here provide new insights into the architecture and role of SLH domain GHs and demonstrate that hemicellulose degradation can be enhanced through non-native SLH domain GHs engineered into the genomes of Caldicellulosiruptor species. Many bacteria (1.Sára M. Sleytr U.B. S-Layer proteins.J. Bacteriol. 2000; 182: 859-868Crossref PubMed Scopus (635) Google Scholar, 2.Sleytr U.B. Beveridge T.J. Bacterial S-layers.Trends Microbiol. 1999; 7: 253-260Abstract Full Text Full Text PDF PubMed Scopus (374) Google Scholar) and archaea (3.Albers S.-V. Meyer B.H. The archaeal cell envelope.Nat. Rev. Microbiol. 2011; 9: 414-426Crossref PubMed Scopus (337) Google Scholar) produce a two-dimensional, para-crystalline array of protein that covers the outside of the cell, referred to as a surface layer (S-layer). 5The abbreviations used are: S-layersurface layerSLHsurface layer homology (pfam00395)SLPS-layer proteinCAZymecarbohydrate active enzymeGHglycoside hydrolasePLpolysaccharide lyaseCBMcarbohydrate binding moduleFN3fibronectin type III (pfam00041)ACLactin cross-linking-like RICIN superfamily (CL22458)LODlow osmolality definedLOClow osmolality complexTMtruncation mutantBisTris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolDNS3,5-dinitrosalicylic acid. In bacteria, the majority of S-layer proteins are non-covalently associated with the bacterial cell surface via specialized domains at their N or C terminus, typically from one of three distinct but analogous domain categories: surface layer homology (SLH) (4.Kern J. Wilton R. Zhang R. Binkowski T.A. Joachimiak A. Schneewind O. Structure of surface layer homology (SLH) domains from Bacillus anthracis surface array protein.J. Biol. Chem. 2011; 286: 26042-26049Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar, 5.Mesnage S. Fontaine T. Mignot T. Delepierre M. Mock M. Fouet A. Bacterial SLH domain proteins are non-covalently anchored to the cell surface via a conserved mechanism involving wall polysaccharide pyruvylation.EMBO J. 2000; 19: 4473-4484Crossref PubMed Scopus (267) Google Scholar), CWB2 (pfam04122) (6.Fagan R.P. Janoir C. Collignon A. Mastrantonio P. Poxton I.R. Fairweather N.F. A proposed nomenclature for cell wall proteins of Clostridium difficile.J. Med. Microbiol. 2011; 60: 1225-1228Crossref PubMed Scopus (45) Google Scholar), or NCAD (previously SLAP, pfam03217) (7.Boot H.J. Kolen C.P. Pouwels P.H. Identification, cloning, and nucleotide sequence of a silent S-layer protein gene of Lactobacillus acidophilus ATCC 4356 which has extensive similarity with the S-layer protein gene of this species.J. Bacteriol. 1995; 177: 7222-7230Crossref PubMed Google Scholar, 8.Johnson B.R. Hymes J. Sanozky-Dawes R. Henriksen E.D. Barrangou R. Klaenhammer T.R. Conserved S-layer-associated proteins revealed by exoproteomic survey of S-layer-forming lactobacilli.Appl. Environ. Microbiol. 2015; 82: 134-145Crossref PubMed Scopus (44) Google Scholar). In archaea, S-layer proteins are most often attached to the cell membrane. S-layer proteins can be anchored to the membrane via a C-terminal transmembrane helix domain (3.Albers S.-V. Meyer B.H. The archaeal cell envelope.Nat. Rev. Microbiol. 2011; 9: 414-426Crossref PubMed Scopus (337) Google Scholar, 9.Veith A. Klingl A. Zolghadr B. Lauber K. Mentele R. Lottspeich F. Rachel R. Albers S.V. Kletzin A. Acidianus, Sulfolobus and Metallosphaera surface layers: structure, composition and gene expression.Mol. Microbiol. 2009; 73: 58-72Crossref PubMed Scopus (65) Google Scholar) or covalently attached to cell membrane lipid via an archaeosortase, as shown in Haloferax volcanii (10.Abdul Halim M.F. Pfeiffer F. Zou J. Frisch A. Haft D. Wu S. Tolić N. Brewer H. Payne S.H. Paša-Tolić L. Pohlschroder M. Haloferax volcanii archaeosortase is required for motility, mating, and C-terminal processing of the S-layer glycoprotein.Mol. Microbiol. 2013; 88: 1164-1175Crossref PubMed Scopus (42) Google Scholar, 11.Abdul Halim M.F. Karch K.R. Zhou Y. Haft D.H. Garcia B.A. Pohlschroder M. Permuting the PGF-CTERM signature motif blocks both archaeosortase-dependent C-terminal cleavage and prenyl lipid attachment for the Haloferax volcanii S-layer glycoprotein.J. Bacteriol. 2015; 10.1128/JB.00849-15PubMed Google Scholar). In most microorganisms, the S-layer is composed entirely of one or two proteins (SLPs), which self-assemble. In addition to these SLPs, some Firmicutes produce a family of proteins that also contain SLH, CWB2, or NCAD domains and, as such, are predicted to be associated with the S-layer (12.Fagan R.P. Fairweather N.F. Biogenesis and functions of bacterial S-layers.Nat. Rev. Microbiol. 2014; 12: 211-222Crossref PubMed Scopus (218) Google Scholar). SLPs and S-layer associated proteins can also contain domains with specialized functions allowing the S-layer to play a role in adherence and biofilm formation (13.Pham T.K. Roy S. Noirel J. Douglas I. Wright P.C. Stafford G.P. A quantitative proteomic analysis of biofilm adaptation by the periodontal pathogen Tannerella forsythia.Proteomics. 2010; 10: 3130-3141Crossref PubMed Scopus (84) Google Scholar, 14.Honma K. Inagaki S. Okuda K. Kuramitsu H.K. Sharma A. Role of a Tannerella forsythia exopolysaccharide synthesis operon in biofilm development.Microb. Pathog. 2007; 42: 156-166Crossref PubMed Scopus (43) Google Scholar, 15.Reynolds C.B. Emerson J.E. de la Riva L. Fagan R.P. Fairweather N.F. The Clostridium difficile cell wall protein CwpV is antigenically variable between strains, but exhibits conserved aggregation-promoting function.PLoS Pathog. 2011; 7: e1002024Crossref PubMed Scopus (66) Google Scholar, 16.Sun Z. Kong J. Hu S. Kong W. Lu W. Liu W. Characterization of a S-layer protein from Lactobacillus crispatus K313 and the domains responsible for binding to cell wall and adherence to collagen.Appl. Microbiol. Biotechnol. 2013; 97: 1941-1952Crossref PubMed Scopus (45) Google Scholar), biogenesis of the cell envelope (17.de la Riva L. Willing S.E. Tate E.W. Fairweather N.F. Roles of cysteine proteases Cwp84 and Cwp13 in biogenesis of the cell wall of Clostridium difficile.J. Bacteriol. 2011; 193: 3276-3285Crossref PubMed Scopus (44) Google Scholar), cell division (18.Anderson V.J. Kern J.W. McCool J.W. Schneewind O. Missiakas D. The SLH-domain protein BslO is a determinant of Bacillus anthracis chain length.Mol. Microbiol. 2011; 81: 192-205Crossref PubMed Scopus (30) Google Scholar), motility (19.Brahamsha B. An abundant cell-surface polypeptide is required for swimming by the nonflagellated marine cyanobacterium Synechococcus.Proc. Natl. Acad. Sci. U.S.A. 1996; 93: 6504-6509Crossref PubMed Scopus (88) Google Scholar, 20.McCarren J. Brahamsha B. SwmB, a 1.12-megadalton protein that is required for nonflagellar swimming motility in Synechococcus.J. Bacteriol. 2007; 189: 1158-1162Crossref PubMed Scopus (33) Google Scholar), and, of interest here, plant cell wall degradation (21.Ozdemir I. Blumer-Schuette S.E. Kelly R.M. S-layer homology domain proteins Csac_0678 and Csac_2722 are implicated in plant polysaccharide deconstruction by the extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus.Appl. Environ. Microbiol. 2012; 78: 768-777Crossref PubMed Scopus (45) Google Scholar, 22.Egelseer E. Schocher I. Sára M. Sleytr U.B. The S-layer from Bacillus stearothermophilus DSM 2358 functions as an adhesion site for a high-molecular-weight amylase.J. Bacteriol. 1995; 177: 1444-1451Crossref PubMed Google Scholar). surface layer surface layer homology (pfam00395) S-layer protein carbohydrate active enzyme glycoside hydrolase polysaccharide lyase carbohydrate binding module fibronectin type III (pfam00041) actin cross-linking-like RICIN superfamily (CL22458) low osmolality defined low osmolality complex truncation mutant 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol 3,5-dinitrosalicylic acid. Many lignocellulose-degrading bacteria utilize SLH domain-containing proteins to display plant biomass-degrading carbohydrate active enzymes (CAZymes) (23.Lombard V. Golaconda Ramulu H. Drula E. Coutinho P.M. Henrissat B. The carbohydrate-active enzymes database (CAZy) in 2013.Nucleic Acids Res. 2014; 42: D490-D495Crossref PubMed Scopus (4141) Google Scholar) on the cell surface. In cellulosomal bacteria, SLH domain proteins attached to the cell surface interact with the scaffoldin protein of the multienzyme cellulosome complex to anchor it to the cell surface (24.Lemaire M. Ohayon H. Gounon P. Fujino T. Béguin P. OlpB, a new outer layer protein of Clostridium thermocellum, and binding of its S-layer-like domains to components of the cell envelope.J. Bacteriol. 1995; 177: 2451-2459Crossref PubMed Google Scholar, 25.Fujino T. Béguin P. Aubert J.P. Organization of a Clostridium thermocellum gene cluster encoding the cellulosomal scaffolding protein CipA and a protein possibly involved in attachment of the cellulosome to the cell surface.J. Bacteriol. 1993; 175: 1891-1899Crossref PubMed Google Scholar, 26.Fontes C.M. Gilbert H.J. Cellulosomes: highly efficient nanomachines designed to deconstruct plant cell wall complex carbohydrates.Annu. Rev. Biochem. 2010; 79: 655-681Crossref PubMed Scopus (423) Google Scholar). In many non-cellulosomal, biomass-degrading bacteria, multidomain CAZymes containing SLH proteins are implicated in lignocellulose deconstruction. About 5% of the 20,710 predicted SLH domain proteins, represented in 1889 genomes from the Integrated Microbial Genomes database (27.Markowitz V.M. Chen I.M. Palaniappan K. Chu K. Szeto E. Pillay M. Ratner A. Huang J. Woyke T. Huntemann M. Anderson I. Billis K. Varghese N. Mavromatis K. Pati A. Ivanova N.N. Kyrpides N.C. IMG 4 version of the integrated microbial genomes comparative analysis system.Nucleic Acids Res. 2014; 42: D560-D567Crossref PubMed Scopus (412) Google Scholar), contain at least one identifiable CAZyme-related component: glycoside hydrolase (GH), polysaccharide lyase (PL), carbohydrate esterase, or carbohydrate binding module (CBM). Multidomain CAZymes containing SLH domains have been characterized from Caldanaerobius polysaccharolyticus (28.Han Y. Agarwal V. Dodd D. Kim J. Bae B. Mackie R.I. Nair S.K. Cann I.K. Biochemical and structural insights into xylan utilization by the thermophilic bacterium Caldanaerobius polysaccharolyticus.J. Biol. Chem. 2012; 287: 34946-34960Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 29.Han Y. Dodd D. Hespen C.W. Ohene-Adjei S. Schroeder C.M. Mackie R.I. Cann I.K. Comparative analyses of two thermophilic enzymes exhibiting both β-1,4 mannosidic and β-1,4 glucosidic cleavage activities from Caldanaerobius polysaccharolyticus.J. Bacteriol. 2010; 192: 4111-4121Crossref PubMed Scopus (37) Google Scholar), Bacillus sp. (30.Lee S.P. Morikawa M. Takagi M. Imanaka T. Cloning of the aapT gene and characterization of its product, α-amylase-pullulanase (AapT), from thermophilic and alkaliphilic Bacillus sp. strain XAL601.Appl. Environ. Microbiol. 1994; 60: 3764-3773Crossref PubMed Google Scholar), Paenibacillus sp. (31.Waeonukul R. Pason P. Kyu K.L. Sakka K. Kosugi A. Mori Y. Ratanakhanokchai K. Cloning, sequencing, and expression of the gene encoding a multidomain endo-β-1,4-xylanase from Paenibacillus curdlanolyticus B-6, and characterization of the recombinant enzyme.J. Microbiol. Biotechnol. 2009; 19: 277-285PubMed Google Scholar, 32.Cheng Y.M. Hong T.Y. Liu C.C. Meng M. Cloning and functional characterization of a complex endo-β-1,3-glucanase from Paenibacillus sp.Appl. Microbiol. Biotechnol. 2009; 81: 1051-1061Crossref PubMed Scopus (43) Google Scholar, 33.Stjohn F.J. Rice J.D. Preston J.F. Paenibacillus sp. strain JDR-2 and XynA1: a novel system for methylglucuronoxylan utilization.Appl. Environ. Microbiol. 2006; 72: 1496-1506Crossref PubMed Scopus (56) Google Scholar, 34.Ito Y. Tomita T. Roy N. Nakano A. Sugawara-Tomita N. Watanabe S. Okai N. Abe N. Kamio Y. Cloning, expression, and cell surface localization of Paenibacillus sp. strain W-61 xylanase 5, a multidomain xylanase.Appl. Environ. Microbiol. 2003; 69: 6969-6978Crossref PubMed Scopus (41) Google Scholar, 35.Itoh T. Sugimoto I. Hibi T. Suzuki F. Matsuo K. Fujii Y. Taketo A. Kimoto H. Overexpression, purification, and characterization of Paenibacillus cell surface-expressed chitinase ChiW with two catalytic domains.Biosci. Biotechnol. Biochem. 2014; 78: 624-634Crossref PubMed Scopus (29) Google Scholar, 36.St John F.J. Preston J.F. Pozharski E. Novel structural features of xylanase A1 from Paenibacillus sp. JDR-2.J. Struct. Biol. 2012; 180: 303-311Crossref PubMed Scopus (12) Google Scholar), Clostridium sp. (37.Kim H. Jung K.H. Pack M.Y. Molecular characterization of xynX, a gene encoding a multidomain xylanase with a thermostabilizing domain from Clostridium thermocellum.Appl. Microbiol. Biotechnol. 2000; 54: 521-527Crossref PubMed Scopus (27) Google Scholar, 38.Fuchs K.-P. Zverlov V.V. Velikodvorskaya G.A. Lottspeich F. Schwarz W.H. Lic16A of Clostridium thermocellum, a non-cellulosomal, highly complex endo-β-1,3-glucanase bound to the outer cell surface.Microbiology. 2003; 149: 1021-1031Crossref PubMed Scopus (61) Google Scholar, 39.Adelsberger H. Hertel C. Glawischnig E. Zverlov V.V. Schwarz W.H. Enzyme system of Clostridium stercorarium for hydrolysis of arabinoxylan: reconstitution of the in vivo system from recombinant enzymes.Microbiology. 2004; 150: 2257-2266Crossref PubMed Scopus (71) Google Scholar, 40.Feng J.X. Karita S. Fujino E. Fujino T. Kimura T. Sakka K. Ohmiya K. Cloning, sequencing, and expression of the gene encoding a cell-bound multi-domain xylanase from Clostridium josui, and characterization of the translated product.Biosci. Biotechnol. Biochem. 2000; 64: 2614-2624Crossref PubMed Scopus (28) Google Scholar, 41.Ali M.K. Fukumura M. Sakano K. Karita S. Kimura T. Sakka K. Ohmiya K. Cloning, sequencing, and expression of the gene encoding the Clostridium stercorarium xylanase C in Escherichia coli.Biosci. Biotechnol. Biochem. 1999; 63: 1596-1604Crossref PubMed Scopus (35) Google Scholar, 42.Ali E. Araki R. Zhao G. Sakka M. Karita S. Kimura T. Sakka K. Functions of family-22 carbohydrate-binding modules in Clostridium josui Xyn10A.Biosci. Biotechnol. Biochem. 2005; 69: 2389-2394Crossref PubMed Scopus (10) Google Scholar, 43.Ali M.K. Hayashi H. Karita S. Goto M. Kimura T. Sakka K. Ohmiya K. Importance of the carbohydrate-binding module of Clostridium stercorarium Xyn10B to xylan hydrolysis.Biosci. Biotechnol. Biochem. 2001; 65: 41-47Crossref PubMed Scopus (67) Google Scholar, 44.Ali M.K. Kimura T. Sakka K. Ohmiya K. The multidomain xylanase Xyn10B as a cellulose-binding protein in Clostridium stercorarium.FEMS Microbiol. Lett. 2001; 198: 79-83Crossref PubMed Google Scholar), Thermoanaerobacterium sp. (45.Brechtel E. Matuschek M. Hellberg A. Egelseer E.M. Schmid R. Bahl H. Cell wall of Thermoanaerobacterium thermosulfurigenes EM1: isolation of its components and attachment of the xylanase XynA.Arch. Microbiol. 1999; 171: 159-165Crossref PubMed Scopus (16) Google Scholar, 46.Liu S.Y. Gherardini F.C. Matuschek M. Bahl H. Wiegel J. Cloning, sequencing, and expression of the gene encoding a large S-layer-associated endoxylanase from Thermoanaerobacterium sp. strain JW/SL-YS 485 in Escherichia coli.J. Bacteriol. 1996; 178: 1539-1547Crossref PubMed Google Scholar, 47.Matuschek M. Burchhardt G. Sahm K. Bahl H. Pullulanase of Thermoanaerobacterium thermosulfurigenes EM1 (Clostridium thermosulfurogenes): molecular analysis of the gene, composite structure of the enzyme, and a common model for its attachment to the cell surface.J. Bacteriol. 1994; 176: 3295-3302Crossref PubMed Google Scholar, 48.Matuschek M. Sahm K. Zibat A. Bahl H. Characterization of genes from Thermoanaerobacterium thermosulfurigenes EM1 that encode two glycosyl hydrolases with conserved S-layer-like domains.Mol. Gen. Genet. 1996; 252: 493-496PubMed Google Scholar, 49.Shao W. Deblois S. Wiegel J. A high-molecular-weight, cell-associated xylanase isolated from exponentially growing Thermoanaerobacterium sp. strain JW/SL-YS485.Appl. Environ. Microbiol. 1995; 61: 937-940Crossref PubMed Google Scholar, 50.Huang X. Li Z. Du C. Wang J. Li S. Improved expression and characterization of a multidomain xylanase from Thermoanaerobacterium aotearoense SCUT27 in Bacillus subtilis.J. Agric. Food Chem. 2015; 63: 6430-6439Crossref PubMed Scopus (24) Google Scholar, 51.Hung K.S. Liu S.M. Fang T.Y. Tzou W.S. Lin F.P. Sun K.H. Tang S.J. Characterization of a salt-tolerant xylanase from Thermoanaerobacterium saccharolyticum NTOU1.Biotechnol. Lett. 2011; 33: 1441-1447Crossref PubMed Scopus (28) Google Scholar), and Caldicellulosiruptor sp. (21.Ozdemir I. Blumer-Schuette S.E. Kelly R.M. S-layer homology domain proteins Csac_0678 and Csac_2722 are implicated in plant polysaccharide deconstruction by the extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus.Appl. Environ. Microbiol. 2012; 78: 768-777Crossref PubMed Scopus (45) Google Scholar, 52.Morris D.D. Gibbs M.D. Ford M. Thomas J. Bergquist P.L. Family 10 and 11 xylanase genes from Caldicellulosiruptor sp. strain Rt69B. 1.Extremophiles. 1999; 3: 103-111Crossref PubMed Scopus (47) Google Scholar). Across these species, the number of identifiable CAZyme domain-containing SLH proteins and total predicted SLH proteins vary significantly. Examples include Paenibacillus sp. strain JDR-2 (23 CAZyme domain containing of 78 total SLH domain proteins), Clostridium thermocellum ATCC 27405 (4 of 25), Thermoanaerobacterium saccharolyticum strain JW/SL-YS485 DSM 8691 (7 of 12), Caldicellulosiruptor bescii (1 of 12), and Caldicellulosiruptor kronotskyensis (6 of 19). The genus Caldicellulosiruptor is composed of extremely thermophilic, Gram-positive, anaerobic bacteria that are able to attach to and degrade the variety of polysaccharides found in lignocellulosic biomass. Currently, the genomes of 12 members of the genus have been sequenced, representing species isolated from globally distributed terrestrial hot springs (53.Blumer-Schuette S.E. Ozdemir I. Mistry D. Lucas S. Lapidus A. Cheng J.-F. Goodwin L.A. Pitluck S. Land M.L. Hauser L.J. Woyke T. Mikhailova N. Pati A. Kyrpides N.C. Ivanova N. Detter J.C. Walston-Davenport K. Han S. Adams M.W.W. Kelly R.M. Complete genome sequences for the anaerobic, extremely thermophilic plant biomass-degrading bacteria Caldicellulosiruptor hydrothermalis, Caldicellulosiruptor kristjanssonii, Caldicellulosiruptor kronotskyensis, Caldicellulosiruptor owensensis, and Caldicellulosiruptor lactoaceticus.J. Bacteriol. 2011; 193: 1483-1484PubMed Google Scholar, 54.Lee L.L. Izquierdo J.A. Blumer-Schuette S.E. Zurawski J.V. Conway J.M. Cottingham R.W. Huntemann M. Copeland A. Chen I.M. Kyrpides N. Markowitz V. Palaniappan K. Ivanova N. Mikhailova N. Ovchinnikova G. Andersen E. Pati A. Stamatis D. Reddy T.B. Shapiro N. Nordberg H.P. Cantor M.N. Hua S.X. Woyke T. Kelly R.M. Complete genome sequences of Caldicellulosiruptor sp. Strain Rt8.B8, Caldicellulosiruptor sp. Strain Wai35.B1, and “Thermoanaerobacter cellulolyticus”.Genome Announc. 2015; 10.1128/genomeA.00440-15Crossref Scopus (10) Google Scholar, 55.Elkins J.G. Lochner A. Hamilton-Brehm S.D. Davenport K.W. Podar M. Brown S.D. Land M.L. Hauser L.J. Klingeman D.M. Raman B. Goodwin L.A. Tapia R. Meincke L.J. Detter J.C. Bruce D.C. Han C.S. Palumbo A.V. Cottingham R.W. Keller M. Graham D.E. Complete genome sequence of the cellulolytic thermophile Caldicellulosiruptor obsidiansis OB47T.J. Bacteriol. 2010; 192: 6099-6100Crossref PubMed Scopus (34) Google Scholar, 56.van de Werken H.J. Verhaart M.R. VanFossen A.L. Willquist K. Lewis D.L. Nichols J.D. Goorissen H.P. Mongodin E.F. Nelson K.E. van Niel E.W. Stams A.J. Ward D.E. de Vos W.M. van der Oost J. Kelly R.M. Kengen S.W. Hydrogenomics of the extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus.Appl. Environ. Microbiol. 2008; 74: 6720-6729Crossref PubMed Scopus (140) Google Scholar, 57.Kataeva I.A. Yang S.J. Dam P. Poole 2nd, F.L. Yin Y. Zhou F. Chou W.C. Xu Y. Goodwin L. Sims D.R. Detter J.C. Hauser L.J. Westpheling J. Adams M.W. Genome sequence of the anaerobic, thermophilic, and cellulolytic bacterium “Anaerocellum thermophilum” DSM 6725.J. Bacteriol. 2009; 191: 3760-3761Crossref PubMed Scopus (65) Google Scholar). Caldicellulosiruptor species produce many extracellular CAZymes, including some that have SLH domains (58.Conway J.M. Zurawski J.V. Lee L.L. Blumer-Schuette S.E. Kelly R.M. Thermophilic Microorganisms.in: Li F. Caister Academic Press, Norfolk, UK2015: 91-120Crossref Google Scholar). The enzyme inventory produced by individual species, and thus the capacity to degrade plant biomass polysaccharides, varies significantly across the genus (59.Blumer-Schuette S.E. Giannone R.J. Zurawski J.V. Ozdemir I. Ma Q. Yin Y. Xu Y. Kataeva I. Poole 2nd, F.L. Adams M.W. Hamilton-Brehm S.D. Elkins J.G. Larimer F.W. Land M.L. Hauser L.J. Cottingham R.W. Hettich R.L. Kelly R.M. Caldicellulosiruptor core and pangenomes reveal determinants for noncellulosomal thermophilic deconstruction of plant biomass.J. Bacteriol. 2012; 194: 4015-4028Crossref PubMed Scopus (83) Google Scholar, 60.Blumer-Schuette S.E. Lewis D.L. Kelly R.M. Phylogenetic, microbiological, and glycoside hydrolase diversities within the extremely thermophilic, plant biomass-degrading genus Caldicellulosiruptor.Appl. Environ. Microbiol. 2010; 76: 8084-8092Crossref PubMed Scopus (87) Google Scholar). C. kronotskyensis has the largest inventory of CAZymes of any Caldicellulosiruptor species, with 31 CAZymes compared with 20 CAZymes in C. bescii, which is to date the most studied member of the genus (61.Blumer-Schuette S.E. Brown S.D. Sander K.B. Bayer E.A. Kataeva I. Zurawski J.V. Conway J.M. Adams M.W.W. Kelly R.M. Thermophilic lignocellulose deconstruction.FEMS Microbiol. Rev. 2014; 38: 393-448Crossref PubMed Scopus (128) Google Scholar). During growth on complex carbohydrates, Caldicellulosiruptor species physically associate with the substrate. This attachment is mediated in part by non-catalytic cellulose-binding proteins, called tāpirins, that were recently identified and characterized (62.Blumer-Schuette S.E. Alahuhta M. Conway J.M. Lee L.L. Zurawski J.V. Giannone R.J. Hettich R.L. Lunin V.V. Himmel M.E. Kelly R.M. Discrete and structurally unique proteins (tāpirins) mediate attachment of extremely thermophilic Caldicellulosiruptor species to cellulose.J. Biol. Chem. 2015; 290: 10645-10656Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). In addition, proteins anchored to the cell surface within the S-layer via SLH domains are also believed to play a role in the attachment of Caldicellulosiruptor species to insoluble plant biomass substrates (21.Ozdemir I. Blumer-Schuette S.E. Kelly R.M. S-layer homology domain proteins Csac_0678 and Csac_2722 are implicated in plant polysaccharide deconstruction by the extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus.Appl. Environ. Microbiol. 2012; 78: 768-777Crossref PubMed Scopus (45) Google Scholar, 63.Dam P. Kataeva I. Yang S.J. Zhou F. Yin Y. Chou W. Poole 2nd, F.L. Westpheling J. Hettich R. Giannone R. Lewis D.L. Kelly R. Gilbert H.J. Henrissat B. Xu Y. Adams M.W. Insights into plant biomass conversion from the genome of the anaerobic thermophilic bacterium Caldicellulosiruptor bescii DSM 6725.Nucleic Acids Res. 2011; 39: 3240-3254Crossref PubMed Scopus (91) Google Scholar). Two such SLH domain proteins from C. saccharolyticus, Csac_0678 and Csac_2722, were shown to bind to insoluble substrates and could be identified in the S-layer protein cell fraction, implying a role in cell-substrate attachment (21.Ozdemir I. Blumer-Schuette S.E. Kelly R.M. S-layer homology domain proteins Csac_0678 and Csac_2722 are implicated in plant polysaccharide deconstruction by the extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus.Appl. Environ. Microbiol. 2012; 78: 768-777Crossref PubMed Scopus (45) Google Scholar). However, more information is needed to understand the role of SLH domain proteins in plant biomass deconstruction, especially how their function relates to other CAZymes produced for this purpose. In this study, the localization, biochemical characteristics, and physiological role of two SLH domain enzymes from C.kronotskyensis, xylanase Calkro_0402 and laminarinase Calkro_0111, were examined from this perspective. Cloning and expression of recombinant proteins used various E. coli strains: NovaBlue GigaSinglesTM (EMD Millipore), RosettaTM 2(DE3) SinglesTM (EMD Millipore), NEB 10-beta electrocompetent E. coli (New England Biolabs), and Arctic Express (DE3)RIL E. coli (Agilent Technologies). Axenic strains of C. bescii and C. kronotskyensis were obtained from the Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures. C. bescii strain JWCB018 (64.Chung D. Farkas J. Westpheling J. Overcoming restriction as a barrier to DNA transformation in Caldicellulosiruptor species results in efficient marker replacement.Biotechnol. Biofuels. 2013; 6: 82Crossref PubMed Scopus (46) Google Scholar) and non-replicating vector pDCW121 (65.Cha M. Chung D. Elkins J.G. Guss A.M. Westpheling J. Metabolic engineering of Caldicellulosiruptor bescii yields increased hydrogen production from lignocellulosic biomass.Biotechnol. Biofuels. 2013; 6: 85Crossref PubMed Scopus (88) Google Scholar) were obtained from J. Westpheling (University of Georgia, Athens, Georgia). Genes of interest were amplified by polymerase chain reaction (PCR) and cloned using the pET46 Ek/LIC vector kit (EMD Millipore) for protein expression. All other vectors were constructed using one-step isothermal assembly of overlapping dsDNA, as described previously (66.Gibson D.G. Enzymatic assembly of overlapping DNA fragments.Methods Enzymol. 2011; 498: 349-361Crossref PubMed Scopus (488) Google Scholar). Plasmids were isolated using Qiaprep miniprep kits (Qiagen), and plasmid sequences were confirmed by sequencing (Genewiz). Oligonucleotide primer sequences used are listed in Table 1. Carbohydrates and biomasses used included the following: laminarin from Laminaria digitata (Sigma L9634), xylan from birchwood (Sigma X0502), xylan from oat spelts (Sigma X0627), and dilute acid-pretreated Populus trichocarpa × Populus deltoides (National Renewable Energy Laboratory, Golden, CO).TABLE 1Primers used in this studyPrimerSequenceUseCalkro_0111 TM1 FGACGACGACAAGATAAATAAAGCAGGCACApET46 cloningCalkro_0111 TM1/TM3 RGAGGAGAAGCCCGGTTAATCTGACATATCTGATTCpET46 cloningCalkro_0111 TM2 FGACGACGACAAGATGGTTG}, number={13}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Conway, Jonathan M. and Pierce, William S. and Le, Jaycee H. and Harper, George W. and Wright, John H. and Tucker, Allyson L. and Zurawski, Jeffrey V. and Lee, Laura L. and Blumer-Schuette, Sara E. and Kelly, Robert M.}, year={2016}, month={Mar}, pages={6732–6747} }
 @article{loder_han_hawkins_lian_lipscomb_schut_keller_adams_kelly_2016, title={Reaction kinetic analysis of the 3-hydroxypropionate/4-hydroxybutyrate CO2 fixation cycle in extremely thermoacidophilic archaea}, volume={38}, ISSN={["1096-7184"]}, DOI={10.1016/j.ymben.2016.10.009}, abstractNote={The 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) cycle fixes CO2 in extremely thermoacidophilic archaea and holds promise for metabolic engineering because of its thermostability and potentially rapid pathway kinetics. A reaction kinetics model was developed to examine the biological and biotechnological attributes of the 3HP/4HB cycle as it operates in Metallosphaera sedula, based on previous information as well as on kinetic parameters determined here for recombinant versions of five of the cycle enzymes (malonyl-CoA/succinyl-CoA reductase, 3-hydroxypropionyl-CoA synthetase, 3-hydroxypropionyl-CoA dehydratase, acryloyl-CoA reductase, and succinic semialdehyde reductase). The model correctly predicted previously observed features of the cycle: the 35-65% split of carbon flux through the acetyl-CoA and succinate branches, the high abundance and relative ratio of acetyl-CoA/propionyl-CoA carboxylase (ACC) and MCR, and the significance of ACC and hydroxybutyryl-CoA synthetase (HBCS) as regulated control points for the cycle. The model was then used to assess metabolic engineering strategies for incorporating CO2 into chemical intermediates and products of biotechnological importance: acetyl-CoA, succinate, and 3-hydroxypropionate.}, journal={METABOLIC ENGINEERING}, author={Loder, Andrew J. and Han, Yejun and Hawkins, Aaron B. and Lian, Hong and Lipscomb, Gina L. and Schut, Gerrit J. and Keller, Matthew W. and Adams, Michael W. W. and Kelly, Robert M.}, year={2016}, month={Nov}, pages={446–463} }
 @article{nguyen_lipscomb_schut_vaccaro_basen_kelly_adams_2016, title={Temperature-dependent acetoin production by Pyrococcus furiosus is catalyzed by a biosynthetic acetolactate synthase and its deletion improves ethanol production}, volume={34}, ISSN={["1096-7184"]}, DOI={10.1016/j.ymben.2015.12.006}, abstractNote={The hyperthermophilic archaeon, Pyrococcus furiosus, grows optimally near 100 °C by fermenting sugars to acetate, carbon dioxide and molecular hydrogen as the major end products. The organism has recently been exploited to produce biofuels using a temperature-dependent metabolic switch using genes from microorganisms that grow near 70 °C. However, little is known about its metabolism at the lower temperatures. We show here that P. furiosus produces acetoin (3-hydroxybutanone) as a major product at temperatures below 80 °C. A novel type of acetolactate synthase (ALS), which is involved in branched-chain amino acid biosynthesis, is responsible and deletion of the als gene abolishes acetoin production. Accordingly, deletion of als in a strain of P. furiosus containing a novel pathway for ethanol production significantly improved the yield of ethanol. These results also demonstrate that P. furiosus is a potential platform for the biological production of acetoin at temperatures in the 70–80 °C range.}, journal={METABOLIC ENGINEERING}, author={Nguyen, Diep M. N. and Lipscomb, Gina L. and Schut, Gerrit J. and Vaccaro, Brian J. and Basen, Mirko and Kelly, Robert M. and Adams, Michael W. W.}, year={2016}, month={Mar}, pages={71–79} }
 @article{wheaton_mukherjee_kelly_2016, title={Transcriptomes of the Extremely Thermoacidophilic Archaeon Metallosphaera sedula Exposed to Metal "Shock" Reveal Generic and Specific Metal Responses}, volume={82}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01176-16}, abstractNote={ABSTRACT The extremely thermoacidophilic archaeon Metallosphaera sedula mobilizes metals by novel membrane-associated oxidase clusters and, consequently, requires metal resistance strategies. This issue was examined by “shocking” M. sedula with representative metals (Co 2+ , Cu 2+ , Ni 2+ , UO 2 2+ , Zn 2+ ) at inhibitory and subinhibitory levels. Collectively, one-quarter of the genome (554 open reading frames [ORFs]) responded to inhibitory levels, and two-thirds (354) of the ORFs were responsive to a single metal. Cu 2+ (259 ORFs, 106 Cu 2+ -specific ORFs) and Zn 2+ (262 ORFs, 131 Zn 2+ -specific ORFs) triggered the largest responses, followed by UO 2 2+ (187 ORFs, 91 UO 2 2+ -specific ORFs), Ni 2+ (93 ORFs, 25 Ni 2+ -specific ORFs), and Co 2+ (61 ORFs, 1 Co 2+ -specific ORF). While one-third of the metal-responsive ORFs are annotated as encoding hypothetical proteins, metal challenge also impacted ORFs responsible for identifiable processes related to the cell cycle, DNA repair, and oxidative stress. Surprisingly, there were only 30 ORFs that responded to at least four metals, and 10 of these responded to all five metals. This core transcriptome indicated induction of Fe-S cluster assembly (Msed_1656-Msed_1657), tungsten/molybdenum transport (Msed_1780-Msed_1781), and decreased central metabolism. Not surprisingly, a metal-translocating P-type ATPase (Msed_0490) associated with a copper resistance system (Cop) was upregulated in response to Cu 2+ (6-fold) but also in response to UO 2 2+ (4-fold) and Zn 2+ (9-fold). Cu 2+ challenge uniquely induced assimilatory sulfur metabolism for cysteine biosynthesis, suggesting a role for this amino acid in Cu 2+ resistance or issues in sulfur metabolism. The results indicate that M. sedula employs a range of physiological and biochemical responses to metal challenge, many of which are specific to a single metal and involve proteins with yet unassigned or definitive functions. IMPORTANCE The mechanisms by which extremely thermoacidophilic archaea resist and are negatively impacted by metals encountered in their natural environments are important to understand so that technologies such as bioleaching, which leverage microbially based conversion of insoluble metal sulfides to soluble species, can be improved. Transcriptomic analysis of the cellular response to metal challenge provided both global and specific insights into how these novel microorganisms negotiate metal toxicity in natural and technological settings. As genetics tools are further developed and implemented for extreme thermoacidophiles, information about metal toxicity and resistance can be leveraged to create metabolically engineered strains with improved bioleaching characteristics.}, number={15}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Wheaton, Garrett H. and Mukherjee, Arpan and Kelly, Robert M.}, year={2016}, month={Aug}, pages={4613–4627} }
 @article{scott_rubinstein_lipscomb_basen_schut_rhaesa_lancaster_poole_kelly_adams_2015, title={A New Class of Tungsten-Containing Oxidoreductase in Caldicellulosiruptor, a Genus of Plant Biomass-Degrading Thermophilic Bacteria}, volume={81}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01634-15}, abstractNote={ABSTRACT Caldicellulosiruptor bescii grows optimally at 78°C and is able to decompose high concentrations of lignocellulosic plant biomass without the need for thermochemical pretreatment. C. bescii ferments both C 5 and C 6 sugars primarily to hydrogen gas, lactate, acetate, and CO 2 and is of particular interest for metabolic engineering applications given the recent availability of a genetic system. Developing optimal strains for technological use requires a detailed understanding of primary metabolism, particularly when the goal is to divert all available reductant (electrons) toward highly reduced products such as biofuels. During an analysis of the C. bescii genome sequence for oxidoreductase-type enzymes, evidence was uncovered to suggest that the primary redox metabolism of C. bescii has a completely uncharacterized aspect involving tungsten, a rarely used element in biology. An active tungsten utilization pathway in C. bescii was demonstrated by the heterologous production of a tungsten-requiring, aldehyde-oxidizing enzyme (AOR) from the hyperthermophilic archaeon Pyrococcus furiosus . Furthermore, C. bescii also contains a tungsten-based AOR-type enzyme, here termed XOR, which is phylogenetically unique, representing a completely new member of the AOR tungstoenzyme family. Moreover, in C. bescii , XOR represents ca. 2% of the cytoplasmic protein. XOR is proposed to play a key, but as yet undetermined, role in the primary redox metabolism of this cellulolytic microorganism.}, number={20}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Scott, Israel M. and Rubinstein, Gabe M. and Lipscomb, Gina L. and Basen, Mirko and Schut, Gerrit J. and Rhaesa, Amanda M. and Lancaster, W. Andrew and Poole, Farris L., II and Kelly, Robert M. and Adams, Michael W. W.}, year={2015}, month={Oct}, pages={7339–7347} }
 @article{keller_lipscomb_loder_schut_kelly_adams_2015, title={A hybrid synthetic pathway for butanol production by a hyperthermophilic microbe}, volume={27}, ISSN={["1096-7184"]}, DOI={10.1016/j.ymben.2014.11.004}, abstractNote={Biologically produced alcohols are of great current interest for renewable solvents and liquid transportation fuels. While bioethanol is now produced on a massive scale, butanol has superior fuel characteristics and an additional value as a solvent and chemical feedstock. Butanol production has been demonstrated at ambient temperatures in metabolically-engineered mesophilic organisms, but the ability to engineer a microbe for in vivo high-temperature production of commodity chemicals has several distinct advantages. These include reduced contamination risk, facilitated removal of volatile products, and a wide temperature range to modulate and balance both the engineered pathway and the host׳s metabolism. We describe a synthetic metabolic pathway assembled from genes obtained from three different sources for conversion of acetyl-CoA to 1-butanol, and 1-butanol generation from glucose was demonstrated near 70 °C in a microorganism that grows optimally near 100 °C. The module could also be used in thermophiles capable of degrading plant biomass.}, journal={METABOLIC ENGINEERING}, author={Keller, Matthew W. and Lipscomb, Gina L. and Loder, Andrew J. and Schut, Gerrit J. and Kelly, Robert M. and Adams, Michael W. W.}, year={2015}, month={Jan}, pages={101–106} }
 @article{lewis_notey_chandrayan_loder_lipscomb_adams_kelly_2015, title={A mutant ('lab strain') of the hyperthermophilic archaeon Pyrococcus furiosus, lacking flagella, has unusual growth physiology}, volume={19}, ISSN={["1433-4909"]}, DOI={10.1007/s00792-014-0712-3}, abstractNote={A mutant (‘lab strain’) of the hyperthermophilic archaeon Pyrococcus furiosus DSM3638 exhibited an extended exponential phase and atypical cell aggregation behavior. Genomic DNA from the mutant culture was sequenced and compared to wild-type (WT) DSM3638, revealing 145 genes with one or more insertions, deletions, or substitutions (12 silent, 33 amino acid substitutions, and 100 frame shifts). Approximately, half of the mutated genes were transposases or hypothetical proteins. The WT transcriptome revealed numerous changes in amino acid and pyrimidine biosynthesis pathways coincidental with growth phase transitions, unlike the mutant whose transcriptome reflected the observed prolonged exponential phase. Targeted gene deletions, based on frame-shifted ORFs in the mutant genome, in a genetically tractable strain of P. furiosus (COM1) could not generate the extended exponential phase behavior observed for the mutant. For example, a putative radical SAM family protein (PF2064) was the most highly up-regulated ORF (>25-fold) in the WT between exponential and stationary phase, although this ORF was unresponsive in the mutant; deletion of this gene in P. furiosus COM1 resulted in no apparent phenotype. On the other hand, frame-shifting mutations in the mutant genome negatively impacted transcription of a flagellar biosynthesis operon (PF0329-PF0338).Consequently, cells in the mutant culture lacked flagella and, unlike the WT, showed minimal evidence of exopolysaccharide-based cell aggregation in post-exponential phase. Electron microscopy of PF0331-PF0337 deletions in P. furiosus COM1 showed that absence of flagella impacted normal cell aggregation behavior and, furthermore, indicated that flagella play a key role, beyond motility, in the growth physiology of P. furiosus.}, number={2}, journal={EXTREMOPHILES}, author={Lewis, Derrick L. and Notey, Jaspreet S. and Chandrayan, Sanjeev K. and Loder, Andrew J. and Lipscomb, Gina L. and Adams, Michael W. W. and Kelly, Robert M.}, year={2015}, month={Mar}, pages={269–281} }
 @article{loder_zeldes_garrison_lipscomb_adams_kelly_2015, title={Alcohol Selectivity in a Synthetic Thermophilic n-Butanol Pathway Is Driven by Biocatalytic and Thermostability Characteristics of Constituent Enzymes}, volume={81}, ISSN={["1098-5336"]}, DOI={10.1128/aem.02028-15}, abstractNote={ABSTRACT n -Butanol is generated as a natural product of metabolism by several microorganisms, but almost all grow at mesophilic temperatures. A synthetic pathway for n -butanol production from acetyl coenzyme A (acetyl-CoA) that functioned at 70°C was assembled in vitro from enzymes recruited from thermophilic bacteria to inform efforts for engineering butanol production into thermophilic hosts. Recombinant versions of eight thermophilic enzymes (β-ketothiolase [Thl], 3-hydroxybutyryl-CoA dehydrogenase [Hbd], and 3-hydroxybutyryl-CoA dehydratase [Crt] from Caldanaerobacter subterraneus subsp. tengcongensis ; trans -2-enoyl-CoA reductase [Ter] from Spirochaeta thermophila ; bifunctional acetaldehyde dehydrogenase/alcohol dehydrogenase [AdhE] from Clostridium thermocellum ; and AdhE, aldehyde dehydrogenase [Bad], and butanol dehydrogenase [Bdh] from Thermoanaerobacter sp. strain X514) were utilized to examine three possible pathways for n -butanol. These pathways differed in the two steps required to convert butyryl-CoA to n -butanol: Thl-Hbd-Crt-Ter-AdhE ( C. thermocellum ), Thl-Hbd-Crt-Ter-AdhE ( Thermoanaerobacter X514), and Thl-Hbd-Crt-Ter-Bad-Bdh. n -Butanol was produced at 70°C, but with different amounts of ethanol as a coproduct, because of the broad substrate specificities of AdhE, Bad, and Bdh. A reaction kinetics model, validated via comparison to in vitro experiments, was used to determine relative enzyme ratios needed to maximize n -butanol production. By using large relative amounts of Thl and Hbd and small amounts of Bad and Bdh, >70% conversion to n -butanol was observed in vitro , but with a 60% decrease in the predicted pathway flux. With more-selective hypothetical versions of Bad and Bdh, >70% conversion to n -butanol is predicted, with a 19% increase in pathway flux. Thus, more-selective thermophilic versions of Bad, Bdh, and AdhE are needed to fully exploit biocatalytic n -butanol production at elevated temperatures.}, number={20}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Loder, Andrew J. and Zeldes, Benjamin M. and Garrison, G. Dale, II and Lipscomb, Gina L. and Adams, Michael W. W. and Kelly, Robert M.}, year={2015}, month={Oct}, pages={7187–7200} }
 @article{hawkins_lian_zeldes_loder_lipscomb_schut_keller_adams_kelly_2015, title={Bioprocessing analysis of Pyrococcus furiosus strains engineered for CO2-based 3-hydroxypropionate production}, volume={112}, ISSN={["1097-0290"]}, DOI={10.1002/bit.25584}, abstractNote={Metabolically engineered strains of the hyperthermophile Pyrococcus furiosus (Topt 95–100°C), designed to produce 3-hydroxypropionate (3HP) from maltose and CO2 using enzymes from the Metallosphaera sedula (Topt 73°C) carbon fixation cycle, were examined with respect to the impact of heterologous gene expression on metabolic activity, fitness at optimal and sub-optimal temperatures, gas-liquid mass transfer in gas-intensive bioreactors, and potential bottlenecks arising from product formation. Transcriptomic comparisons of wild-type P. furiosus, a genetically-tractable, naturally-competent mutant (COM1), and COM1-based strains engineered for 3HP production revealed numerous differences after being shifted from 95°C to 72°C, where product formation catalyzed by the heterologously-produced M. sedula enzymes occurred. At 72°C, significantly higher levels of metabolic activity and a stress response were evident in 3HP-forming strains compared to the non-producing parent strain (COM1). Gas–liquid mass transfer limitations were apparent, given that 3HP titers and volumetric productivity in stirred bioreactors could be increased over 10-fold by increased agitation and higher CO2 sparging rates, from 18 mg/L to 276 mg/L and from 0.7 mg/L/h to 11 mg/L/h, respectively. 3HP formation triggered transcription of genes for protein stabilization and turnover, RNA degradation, and reactive oxygen species detoxification. The results here support the prospects of using thermally diverse sources of pathways and enzymes in metabolically engineered strains designed for product formation at sub-optimal growth temperatures. Biotechnol. Bioeng. 2015;112: 1533–1543. © 2015 Wiley Periodicals, Inc.}, number={8}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Hawkins, Aaron B. and Lian, Hong and Zeldes, Benjamin M. and Loder, Andrew J. and Lipscomb, Gina L. and Schut, Gerrit J. and Keller, Matthew W. and Adams, Michael W. W. and Kelly, Robert M.}, year={2015}, month={Aug}, pages={1533–1543} }
 @article{zurawski_conway_lee_simpson_izquierdo_blumer-schuette_nookaew_adams_kelly_2015, title={Comparative Analysis of Extremely Thermophilic Caldicellulosiruptor Species Reveals Common and Unique Cellular Strategies for Plant Biomass Utilization}, volume={81}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01622-15}, abstractNote={Microbiological, genomic and transcriptomic analyses were used to examine three species from the bacterial genus Caldicellulosiruptor with respect to their capacity to convert the carbohydrate content of lignocellulosic biomass at 70°C to simple sugars, acetate, lactate, CO2, and H2. Caldicellulosiruptor bescii, C. kronotskyensis, and C. saccharolyticus solubilized 38%, 36%, and 29% (by weight) of unpretreated switchgrass (Panicum virgatum) (5 g/liter), respectively, which was about half of the amount of crystalline cellulose (Avicel; 5 g/liter) that was solubilized under the same conditions. The lower yields with C. saccharolyticus, not appreciably greater than the thermal control for switchgrass, were unexpected, given that its genome encodes the same glycoside hydrolase 9 (GH9)-GH48 multidomain cellulase (CelA) found in the other two species. However, the genome of C. saccharolyticus lacks two other cellulases with GH48 domains, which could be responsible for its lower levels of solubilization. Transcriptomes for growth of each species comparing cellulose to switchgrass showed that many carbohydrate ABC transporters and multidomain extracellular glycoside hydrolases were differentially regulated, reflecting the heterogeneity of lignocellulose. However, significant differences in transcription levels for conserved genes among the three species were noted, indicating unexpectedly diverse regulatory strategies for deconstruction for these closely related bacteria. Genes encoding the Che-type chemotaxis system and flagellum biosynthesis were upregulated in C. kronotskyensis and C. bescii during growth on cellulose, implicating motility in substrate utilization. The results here show that capacity for plant biomass deconstruction varies across Caldicellulosiruptor species and depends in a complex way on GH genome inventory, substrate composition, and gene regulation.}, number={20}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Zurawski, Jeffrey V. and Conway, Jonathan M. and Lee, Laura L. and Simpson, Hunter J. and Izquierdo, Javier A. and Blumer-Schuette, Sara and Nookaew, Intawat and Adams, Michael W. W. and Kelly, Robert M.}, year={2015}, month={Oct}, pages={7159–7170} }
 @article{lee_izquierdo_blumer-schuette_zurawski_conway_cottingham_huntemann_copeland_chen_kyrpides_et al._2015, title={Complete Genome Sequences of
            Caldicellulosiruptor
            sp. Strain Rt8.B8,
            Caldicellulosiruptor
            sp. Strain Wai35.B1, and “
            Thermoanaerobacter cellulolyticus
            ”}, volume={3}, ISSN={2169-8287}, url={http://dx.doi.org/10.1128/genomea.00440-15}, DOI={10.1128/genomea.00440-15}, abstractNote={The genus Caldicellulosiruptor contains extremely thermophilic, cellulolytic bacteria capable of lignocellulose deconstruction. Currently, complete genome sequences for eleven Caldicellulosiruptor species are available. Here, we report genome sequences for three additional Caldicellulosiruptor species: Rt8.B8 DSM 8990 (New Zealand), Wai35.B1 DSM 8977 (New Zealand), and "Thermoanaerobacter cellulolyticus" strain NA10 DSM 8991 (Japan).}, number={3}, journal={Genome Announcements}, publisher={American Society for Microbiology}, author={Lee, Laura L. and Izquierdo, Javier A. and Blumer-Schuette, Sara E. and Zurawski, Jeffrey V. and Conway, Jonathan M. and Cottingham, Robert W. and Huntemann, Marcel and Copeland, Alex and Chen, I-Min A. and Kyrpides, Nikos and et al.}, year={2015}, month={Jun} }
 @article{blumer-schuette_alahuhta_conway_lee_zurawski_giannone_hettich_lunin_himmel_kelly_2015, title={Discrete and Structurally Unique Proteins (Tapirins) Mediate Attachment of Extremely Thermophilic Caldicellulosiruptor Species to Cellulose}, volume={290}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.m115.641480}, abstractNote={A variety of catalytic and noncatalytic protein domains are deployed by select microorganisms to deconstruct lignocellulose. These extracellular proteins are used to attach to, modify, and hydrolyze the complex polysaccharides present in plant cell walls. Cellulolytic enzymes, often containing carbohydrate-binding modules, are key to this process; however, these enzymes are not solely responsible for attachment. Few mechanisms of attachment have been discovered among bacteria that do not form large polypeptide structures, called cellulosomes, to deconstruct biomass. In this study, bioinformatics and proteomics analyses identified unique, discrete, hypothetical proteins (“tāpirins,” origin from Māori: to join), not directly associated with cellulases, that mediate attachment to cellulose by species in the noncellulosomal, extremely thermophilic bacterial genus Caldicellulosiruptor. Two tāpirin genes are located directly downstream of a type IV pilus operon in strongly cellulolytic members of the genus, whereas homologs are absent from the weakly cellulolytic Caldicellulosiruptor species. Based on their amino acid sequence, tāpirins are specific to these extreme thermophiles. Tāpirins are also unusual in that they share no detectable protein domain signatures with known polysaccharide-binding proteins. Adsorption isotherm and trans vivo analyses demonstrated the carbohydrate-binding module-like affinity of the tāpirins for cellulose. Crystallization of a cellulose-binding truncation from one tāpirin indicated that these proteins form a long β-helix core with a shielded hydrophobic face. Furthermore, they are structurally unique and define a new class of polysaccharide adhesins. Strongly cellulolytic Caldicellulosiruptor species employ tāpirins to complement substrate-binding proteins from the ATP-binding cassette transporters and multidomain extracellular and S-layer-associated glycoside hydrolases to process the carbohydrate content of lignocellulose. A variety of catalytic and noncatalytic protein domains are deployed by select microorganisms to deconstruct lignocellulose. These extracellular proteins are used to attach to, modify, and hydrolyze the complex polysaccharides present in plant cell walls. Cellulolytic enzymes, often containing carbohydrate-binding modules, are key to this process; however, these enzymes are not solely responsible for attachment. Few mechanisms of attachment have been discovered among bacteria that do not form large polypeptide structures, called cellulosomes, to deconstruct biomass. In this study, bioinformatics and proteomics analyses identified unique, discrete, hypothetical proteins (“tāpirins,” origin from Māori: to join), not directly associated with cellulases, that mediate attachment to cellulose by species in the noncellulosomal, extremely thermophilic bacterial genus Caldicellulosiruptor. Two tāpirin genes are located directly downstream of a type IV pilus operon in strongly cellulolytic members of the genus, whereas homologs are absent from the weakly cellulolytic Caldicellulosiruptor species. Based on their amino acid sequence, tāpirins are specific to these extreme thermophiles. Tāpirins are also unusual in that they share no detectable protein domain signatures with known polysaccharide-binding proteins. Adsorption isotherm and trans vivo analyses demonstrated the carbohydrate-binding module-like affinity of the tāpirins for cellulose. Crystallization of a cellulose-binding truncation from one tāpirin indicated that these proteins form a long β-helix core with a shielded hydrophobic face. Furthermore, they are structurally unique and define a new class of polysaccharide adhesins. Strongly cellulolytic Caldicellulosiruptor species employ tāpirins to complement substrate-binding proteins from the ATP-binding cassette transporters and multidomain extracellular and S-layer-associated glycoside hydrolases to process the carbohydrate content of lignocellulose.}, number={17}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Blumer-Schuette, Sara E. and Alahuhta, Markus and Conway, Jonathan M. and Lee, Laura L. and Zurawski, Jeffrey V. and Giannone, Richard J. and Hettich, Robert L. and Lunin, Vladimir V. and Himmel, Michael E. and Kelly, Robert M.}, year={2015}, month={Apr}, pages={10645–10656} }
 @misc{zeldes_keller_loder_straub_adams_kelly_2015, title={Extremely thermophilic microorganisms as metabolic engineering platforms for production of fuels and industrial chemicals}, volume={6}, ISSN={["1664-302X"]}, DOI={10.3389/fmicb.2015.01209}, abstractNote={Enzymes from extremely thermophilic microorganisms have been of technological interest for some time because of their ability to catalyze reactions of industrial significance at elevated temperatures. Thermophilic enzymes are now routinely produced in recombinant mesophilic hosts for use as discrete biocatalysts. Genome and metagenome sequence data for extreme thermophiles provide useful information for putative biocatalysts for a wide range of biotransformations, albeit involving at most a few enzymatic steps. However, in the past several years, unprecedented progress has been made in establishing molecular genetics tools for extreme thermophiles to the point that the use of these microorganisms as metabolic engineering platforms has become possible. While in its early days, complex metabolic pathways have been altered or engineered into recombinant extreme thermophiles, such that the production of fuels and chemicals at elevated temperatures has become possible. Not only does this expand the thermal range for industrial biotechnology, it also potentially provides biodiverse options for specific biotransformations unique to these microorganisms. The list of extreme thermophiles growing optimally between 70 and 100°C with genetic toolkits currently available includes archaea and bacteria, aerobes and anaerobes, coming from genera such as Caldicellulosiruptor, Sulfolobus, Thermotoga, Thermococcus and Pyrococcus. These organisms exhibit unusual and potentially useful native metabolic capabilities, including cellulose degradation, metal solubilization, and RuBisCO-free carbon fixation. Those looking to design a thermal bioprocess now have a host of potential candidates to choose from, each with its own advantages and challenges that will influence its appropriateness for specific applications. Here, the issues and opportunities for extremely thermophilic metabolic engineering platforms are considered with an eye towards potential technological advantages for high temperature industrial biotechnology.}, journal={FRONTIERS IN MICROBIOLOGY}, author={Zeldes, Benjamin M. and Keller, Matthew W. and Loder, Andrew J. and Straub, Christopher T. and Adams, Michael W. W. and Kelly, Robert M.}, year={2015}, month={Nov} }
 @book{kelly_adams_schut_basen_2015, title={Genetically engineered microbes and methods for converting organic acid to alcohols}, number={14/670,601}, author={Kelly, R.M. and Adams, M.W.W. and Schut, G. and Basen, M.}, year={2015}, month={Mar} }
 @article{schilling_nepomuceno_planchart_yoder_kelly_muddiman_daniels_hiramatsu_reading_2015, title={Machine learning reveals sex-specific 17β-estradiol-responsive expression patterns in white perch (Morone americana) plasma proteins}, volume={15}, ISSN={1615-9853}, url={http://dx.doi.org/10.1002/pmic.201400606}, DOI={10.1002/pmic.201400606}, abstractNote={With growing abundance and awareness of endocrine disrupting compounds (EDCs) in the environment, there is a need for accurate and reliable detection of EDC exposure. Our objective in the present study was to observe differences within and between the global plasma proteomes of sexually mature male and female white perch (Morone americana) before (Initial Control, IC) and after 17β-estradiol (E2) induction. Semiquantitative nanoLC-MS/MS data were analyzed by machine learning support vector machines (SVMs) and by two-way ANOVA. By ANOVA, the expression levels of 44, 77, and 57 proteins varied significantly by gender, treatment, and the interaction of gender and treatment, respectively. SVMs perfectly classified male and female perch IC and E2-induced plasma samples using the protein expression data. E2-induced male and female perch plasma proteomes contained significantly higher levels of the yolk precursors vitellogenin Aa and Ab (VtgAa, VtgAb), as well as latrophilin and seven transmembrane domain-containing protein 1 (Eltd1) and kininogen 1 (Kng1). This is the first report that Eltd1 and Kng1 may be E2-responsive proteins in fishes and therefore may be useful indicators of estrogen induction.}, number={15}, journal={PROTEOMICS}, publisher={Wiley}, author={Schilling, Justin and Nepomuceno, Angelito I. and Planchart, Antonio and Yoder, Jeffrey A. and Kelly, Robert M. and Muddiman, David C. and Daniels, Harry V. and Hiramatsu, Naoshi and Reading, Benjamin J.}, year={2015}, month={Jun}, pages={2678–2690} }
 @misc{wheaton_counts_mukherjee_kruh_kelly_2015, title={The Confluence of Heavy Metal Biooxidation and Heavy Metal Resistance: Implications for Bioleaching by Extreme Thermoacidophiles}, volume={5}, ISSN={["2075-163X"]}, DOI={10.3390/min5030397}, abstractNote={Extreme thermoacidophiles (Topt > 65 °C, pHopt < 3.5) inhabit unique environments fraught with challenges, including extremely high temperatures, low pH, as well as high levels of soluble metal species. In fact, certain members of this group thrive by metabolizing heavy metals, creating a dynamic equilibrium between biooxidation to meet bioenergetic needs and mechanisms for tolerating and resisting the toxic effects of solubilized metals. Extremely thermoacidophilic archaea dominate bioleaching operations at elevated temperatures and have been considered for processing certain mineral types (e.g., chalcopyrite), some of which are recalcitrant to their mesophilic counterparts. A key issue to consider, in addition to temperature and pH, is the extent to which solid phase heavy metals are solubilized and the concomitant impact of these mobilized metals on the microorganism’s growth physiology. Here, extreme thermoacidophiles are examined from the perspectives of biodiversity, heavy metal biooxidation, metal resistance mechanisms, microbe-solid interactions, and application of these archaea in biomining operations.}, number={3}, journal={MINERALS}, author={Wheaton, Garrett and Counts, James and Mukherjee, Arpan and Kruh, Jessica and Kelly, Robert}, year={2015}, month={Sep}, pages={397–451} }
 @article{hawkins_adams_kelly_2014, title={Conversion of 4-Hydroxybutyrate to Acetyl Coenzyme A and Its Anapleurosis in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Carbon Fixation Pathway}, volume={80}, ISSN={["1098-5336"]}, DOI={10.1128/aem.04146-13}, abstractNote={The extremely thermoacidophilic archaeon Metallosphaera sedula (optimum growth temperature, 73°C, pH 2.0) grows chemolithoautotrophically on metal sulfides or molecular hydrogen by employing the 3-hydroxypropionate/4-hydroxybutyrate (3HP/4HB) carbon fixation cycle. This cycle adds two CO2 molecules to acetyl coenzyme A (acetyl-CoA) to generate 4HB, which is then rearranged and cleaved to form two acetyl-CoA molecules. Previous metabolic flux analysis showed that two-thirds of central carbon precursor molecules are derived from succinyl-CoA, which is oxidized to malate and oxaloacetate. The remaining one-third is apparently derived from acetyl-CoA. As such, the steps beyond succinyl-CoA are essential for completing the carbon fixation cycle and for anapleurosis of acetyl-CoA. Here, the final four enzymes of the 3HP/4HB cycle, 4-hydroxybutyrate-CoA ligase (AMP forming) (Msed_0406), 4-hydroxybutyryl-CoA dehydratase (Msed_1321), crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenase (Msed_0399), and acetoacetyl-CoA β-ketothiolase (Msed_0656), were produced recombinantly in Escherichia coli, combined in vitro, and shown to convert 4HB to acetyl-CoA. Metabolic pathways connecting CO2 fixation and central metabolism were examined using a gas-intensive bioreactor system in which M. sedula was grown under autotrophic (CO2-limited) and heterotrophic conditions. Transcriptomic analysis revealed the importance of the 3HP/4HB pathway in supplying acetyl-CoA to anabolic pathways generating intermediates in M. sedula metabolism. The results indicated that flux between the succinate and acetyl-CoA branches in the 3HP/4HB pathway is governed by 4-hydroxybutyrate-CoA ligase, possibly regulated posttranslationally by the protein acetyltransferase (Pat)/Sir2-dependent system. Taken together, this work confirms the final four steps of the 3HP/4HB pathway, thereby providing the framework for examining connections between CO2 fixation and central metabolism in M. sedula.}, number={8}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Hawkins, Aaron B. and Adams, Michael W. W. and Kelly, Robert M.}, year={2014}, month={Apr}, pages={2536–2545} }
 @article{tang_saquing_morton_glatz_kelly_khan_2014, title={Cross-linked Polymer Nanofibers for Hyperthermophilic Enzyme Immobilization: Approaches to Improve Enzyme Performance}, volume={6}, ISSN={["1944-8244"]}, DOI={10.1021/am5033633}, abstractNote={We report an enzyme immobilization method effective at elevated temperatures (up to 105 °C) and sufficiently robust for hyperthermophilic enzymes. Using a model hyperthermophilic enzyme, α-galactosidase from Thermotoga maritima, immobilization within chemically cross-linked poly(vinyl alcohol) (PVA) nanofibers to provide high specific surface area is achieved by (1) electrospinning a blend of a PVA and enzyme and (2) chemically cross-linking the polymer to entrap the enzyme within a water insoluble PVA fiber. The resulting enzyme-loaded nanofibers are water-insoluble at elevated temperatures, and enzyme leaching is not observed, indicating that the cross-linking effectively immobilizes the enzyme within the fibers. Upon immobilization, the enzyme retains its hyperthermophilic nature and shows improved thermal stability indicated by a 5.5-fold increase in apparent half-life at 90 °C, but with a significant decrease in apparent activity. The loss in apparent activity is attributed to enzyme deactivation and mass transfer limitations. Improvements in the apparent activity can be achieved by incorporating a cryoprotectant during immobilization to prevent enzyme deactivation. For example, immobilization in the presence of trehalose improved the apparent activity by 10-fold. Minimizing the mat thickness to reduce interfiber diffusion was a simple and effective method to further improve the performance of the immobilized enzyme.}, number={15}, journal={ACS APPLIED MATERIALS & INTERFACES}, author={Tang, Christina and Saquing, Carl D. and Morton, Stephen W. and Glatz, Brittany N. and Kelly, Robert M. and Khan, Saad A.}, year={2014}, month={Aug}, pages={11899–11906} }
 @article{thorgersen_lipscomb_schut_kelly_adams_2014, title={Deletion of acetyl-CoA synthetases I and II increases production of 3-hydroxypropionate by the metabolically-engineered hyperthermophile Pyrococcus furiosus}, volume={22}, ISSN={["1096-7184"]}, DOI={10.1016/j.ymben.2013.12.006}, abstractNote={The heterotrophic, hyperthermophilic archaeon Pyrococcus furiosus is a new addition to the growing list of genetically-tractable microorganisms suitable for metabolic engineering to produce liquid fuels and industrial chemicals. P. furiosus was recently engineered to generate 3-hydroxypropionate (3-HP) from CO2 and acetyl-CoA by the heterologous-expression of three enzymes from the CO2 fixation cycle of the thermoacidophilic archaeon Metallosphaera sedula using a thermally-triggered induction system. The acetyl-CoA for this pathway is generated from glucose catabolism that in wild-type P. furiosus is converted to acetate with concurrent ATP production by the heterotetrameric (α2β2) acetyl-CoA synthetase (ACS). Hence ACS in the engineered 3-HP production strain (MW56) competes with the heterologous pathway for acetyl-CoA. Herein we show that strains of MW56 lacking the α-subunit of either of the two ACSs previously characterized from P. furiosus (ACSI and ACSII) exhibit a three-fold increase in specific 3-HP production. The ΔACSIα strain displayed only a minor defect in growth on either maltose or peptides, while no growth defect on these substrates was observed with the ΔACSIIα strain. Deletion of individual and multiple ACS subunits was also shown to decrease CoA release activity for several different CoA ester substrates in addition to acetyl-CoA, information that will be extremely useful for future metabolic engineering endeavors in P. furiosus.}, journal={METABOLIC ENGINEERING}, author={Thorgersen, Michael P. and Lipscomb, Gina L. and Schut, Gerrit J. and Kelly, Robert M. and Adams, Michael W. W.}, year={2014}, month={Mar}, pages={83–88} }
 @article{lipscomb_schut_thorgersen_nixon_kelly_adams_2014, title={Engineering Hydrogen Gas Production from Formate in a Hyperthermophile by Heterologous Production of an 18-Subunit Membrane-bound Complex}, volume={289}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.m113.530725}, abstractNote={Biohydrogen gas has enormous potential as a source of reductant for the microbial production of biofuels, but its low solubility and poor gas mass transfer rates are limiting factors. These limitations could be circumvented by engineering biofuel production in microorganisms that are also capable of generating H2 from highly soluble chemicals such as formate, which can function as an electron donor. Herein, the model hyperthermophile, Pyrococcus furiosus, which grows optimally near 100 °C by fermenting sugars to produce H2, has been engineered to also efficiently convert formate to H2. Using a bacterial artificial chromosome vector, the 16.9-kb 18-gene cluster encoding the membrane-bound, respiratory formate hydrogen lyase complex of Thermococcus onnurineus was inserted into the P. furiosus chromosome and expressed as a functional unit. This enabled P. furiosus to utilize formate as well as sugars as an H2 source and to do so at both 80° and 95 °C, near the optimum growth temperature of the donor (T. onnurineus) and engineered host (P. furiosus), respectively. This accomplishment also demonstrates the versatility of P. furiosus for metabolic engineering applications.}, number={5}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Lipscomb, Gina L. and Schut, Gerrit J. and Thorgersen, Michael P. and Nixon, William J. and Kelly, Robert M. and Adams, Michael W. W.}, year={2014}, month={Jan}, pages={2873–2879} }
 @article{tang_saquing_sarin_kelly_khan_2014, title={Nanofibrous membranes for single-step immobilization of hyperthermophilic enzymes}, volume={472}, ISSN={["1873-3123"]}, DOI={10.1016/j.memsci.2014.08.037}, abstractNote={We report a single-step method to immobilize hyperthermophilic enzymes within chemically crosslinked polyvinyl alcohol (PVA) nanofibrous membranes. The polymer crosslinking that entraps the enzyme within the fiber is not affected by the particular enzyme and can thus be applied to any enzyme. Using a reactive electrospinning process, the chemical crosslinking that occurs during processing effectively entraps the enzyme within the fiber preventing enzyme leaching at elevated temperature establishing that the system is sufficiently robust for immobilization of hyperthermophilic enzymes. Upon immobilization, the enzyme retains 20% of its catalytic activity as well as its hyperthermophilicity, as the maximum activity occurs at ~90 °C, and that activity at 90 °C is an order of magnitude higher than at 37 °C. Furthermore, thermostability of the enzyme is enhanced upon immobilization as indicated by the 2-fold increase in half-life at 90 °C and pH 5.5 which extends the use of these biocatalysts at high temperatures. Compared to alternative methods, the apparent activity using the single-step method is significantly higher than alternative two-step methods (4 orders of magnitude higher than non-solvent based crosslinking and 3-fold higher than vapor-phase crosslinking). Analysis of this immobilization method indicates that the apparent decrease in specific activity could be attributed to enzyme deactivation arising from the crosslinking reaction, whereas mass transfer limits the apparent activity using alternative two-step immobilization methods. Based on this understanding, enzyme activity upon immobilization may be improved by using enzymes with higher intrinsic stability. Since significant enzyme activity is observed upon immobilization and the stability under high temperatures is enhanced, this versatile approach leverages the unique properties of hyperthermophilc enzymes and electrospun nanofibers providing a platform to produce catalytically active nanofibrous membranes appropriate for high temperature processes.}, journal={JOURNAL OF MEMBRANE SCIENCE}, author={Tang, Christina and Saquing, Carl D. and Sarin, Pooja K. and Kelly, Robert M. and Khan, Saad A.}, year={2014}, month={Dec}, pages={251–260} }
 @article{keller_loder_basen_izquierdo_kelly_adams_2014, title={Production of lignofuels and electrofuels by extremely thermophilic microbes}, volume={5}, ISSN={1759-7269 1759-7277}, url={http://dx.doi.org/10.1080/17597269.2014.996729}, DOI={10.1080/17597269.2014.996729}, abstractNote={Extreme thermophiles are microorganisms that grow optimally at elevated temperatures (≥ 70°C). They could play an important role in the emerging renewable energy landscape by exploiting thermophily to produce liquid transportation fuels. For example, Caldicellulosiruptor species can grow on unpretreated plant biomass near 80°C utilizing novel multi-domain glycoside hydrolases. Through metabolic engineering, advanced biofuels compatible with existing infrastructure liquid biofuels, so-called lignofuels, could be produced to establish consolidated bioprocessing at high temperatures. In another case, a new paradigm, electrofuels, addresses the inefficiency of biofuel production through the direct synthesis of advanced fuels from carbon dioxide using hydrogen gas as the electron carrier. This requires coupling of biological electron utilization to carbon dioxide fixation and ultimately to fuel synthesis. Using a hyperthermophilic host Pyrococcus furiosus and synthetic metabolic pathways comprised of genes fro...}, number={5}, journal={Biofuels}, publisher={Informa UK Limited}, author={Keller, Matthew and Loder, Andrew and Basen, Mirko and Izquierdo, Javier and Kelly, Robert M. and Adams, Michael W.W.}, year={2014}, month={Sep}, pages={499–515} }
 @article{mccarthy_ai_wheaton_tevatia_eckrich_kelly_blum_2014, title={Role of an Archaeal PitA Transporter in the Copper and Arsenic Resistance of Metallosphaera sedula, an Extreme Thermoacidophile}, volume={196}, ISSN={["1098-5530"]}, DOI={10.1128/jb.01707-14}, abstractNote={Thermoacidophilic archaea, such as Metallosphaera sedula, are lithoautotrophs that occupy metal-rich environments. In previous studies, an M. sedula mutant lacking the primary copper efflux transporter, CopA, became copper sensitive. In contrast, the basis for supranormal copper resistance remained unclear in the spontaneous M. sedula mutant, CuR1. Here, transcriptomic analysis of copper-shocked cultures indicated that CuR1 had a unique regulatory response to metal challenge corresponding to the upregulation of 55 genes. Genome resequencing identified 17 confirmed mutations unique to CuR1 that were likely to change gene function. Of these, 12 mapped to genes with annotated function associated with transcription, metabolism, or transport. These mutations included 7 nonsynonymous substitutions, 4 insertions, and 1 deletion. One of the insertion mutations mapped to pseudogene Msed_1517 and extended its reading frame an additional 209 amino acids. The extended mutant allele was identified as a homolog of Pho4, a family of phosphate symporters that includes the bacterial PitA proteins. Orthologs of this allele were apparent in related extremely thermoacidophilic species, suggesting M. sedula naturally lacked this gene. Phosphate transport studies combined with physiologic analysis demonstrated M. sedula PitA was a low-affinity, high-velocity secondary transporter implicated in copper resistance and arsenate sensitivity. Genetic analysis demonstrated that spontaneous arsenate-resistant mutants derived from CuR1 all underwent mutation in pitA and nonselectively became copper sensitive. Taken together, these results point to archaeal PitA as a key requirement for the increased metal resistance of strain CuR1 and its accelerated capacity for copper bioleaching.}, number={20}, journal={JOURNAL OF BACTERIOLOGY}, author={McCarthy, Samuel and Ai, Chenbing and Wheaton, Garrett and Tevatia, Rahul and Eckrich, Valerie and Kelly, Robert and Blum, Paul}, year={2014}, month={Oct}, pages={3562–3570} }
 @article{basen_schut_nguyen_lipscomb_benn_prybol_vaccaro_poole_kelly_adams_2014, title={Single gene insertion drives bioalcohol production by a thermophilic archaeon}, volume={111}, ISSN={["0027-8424"]}, DOI={10.1073/pnas.1413789111}, abstractNote={Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 °C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.}, number={49}, journal={PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA}, author={Basen, Mirko and Schut, Gerrit J. and Nguyen, Diep M. and Lipscomb, Gina L. and Benn, Robert A. and Prybol, Cameron J. and Vaccaro, Brian J. and Poole, Farris L., II and Kelly, Robert M. and Adams, Michael W. W.}, year={2014}, month={Dec}, pages={17618–17623} }
 @inbook{zurawski_blumer-schuette_conway_kelly_2014, title={The Extremely Thermophilic Genus Caldicellulosiruptor: Physiological and Genomic Characteristics for Complex Carbohydrate Conversion to Molecular Hydrogen}, ISBN={9789401785532 9789401785549}, ISSN={1572-0233 2215-0102}, url={http://dx.doi.org/10.1007/978-94-017-8554-9_8}, DOI={10.1007/978-94-017-8554-9_8}, booktitle={Microbial BioEnergy: Hydrogen Production}, publisher={Springer Netherlands}, author={Zurawski, Jeffrey V. and Blumer-Schuette, Sara E. and Conway, Jonathan M. and Kelly, Robert M.}, year={2014}, pages={177–195} }
 @inbook{schut_lipscomb_han_notey_kelly_adams_2014, title={The Order Thermococcales and the Family Thermococcaceae}, ISBN={9783642389535 9783642389542}, url={http://dx.doi.org/10.1007/978-3-642-38954-2_324}, DOI={10.1007/978-3-642-38954-2_324}, booktitle={The Prokaryotes}, publisher={Springer Berlin Heidelberg}, author={Schut, Gerrit J. and Lipscomb, Gina L. and Han, Yejun and Notey, Jaspreet S. and Kelly, Robert M. and Adams, Michael M. W.}, year={2014}, pages={363–383} }
 @misc{blumer-schuette_brown_sander_bayer_kataeva_zurawski_conway_adams_kelly_2014, title={Thermophilic lignocellulose deconstruction}, volume={38}, ISSN={["1574-6976"]}, DOI={10.1111/1574-6976.12044}, abstractNote={Thermophilic microorganisms are attractive candidates for conversion of lignocellulose to biofuels because they produce robust, effective, carbohydrate-degrading enzymes and survive under harsh bioprocessing conditions that reflect their natural biotopes. However, no naturally occurring thermophile is known that can convert plant biomass into a liquid biofuel at rates, yields and titers that meet current bioprocessing and economic targets. Meeting those targets requires either metabolically engineering solventogenic thermophiles with additional biomass-deconstruction enzymes or engineering plant biomass degraders to produce a liquid biofuel. Thermostable enzymes from microorganisms isolated from diverse environments can serve as genetic reservoirs for both efforts. Because of the sheer number of enzymes that are required to hydrolyze plant biomass to fermentable oligosaccharides, the latter strategy appears to be the preferred route and thus has received the most attention to date. Thermophilic plant biomass degraders fall into one of two categories: cellulosomal (i.e. multienzyme complexes) and noncellulosomal (i.e. 'free' enzyme systems). Plant-biomass-deconstructing thermophilic bacteria from the genera Clostridium (cellulosomal) and Caldicellulosiruptor (noncellulosomal), which have potential as metabolic engineering platforms for producing biofuels, are compared and contrasted from a systems biology perspective.}, number={3}, journal={FEMS MICROBIOLOGY REVIEWS}, author={Blumer-Schuette, Sara E. and Brown, Steven D. and Sander, Kyle B. and Bayer, Edward A. and Kataeva, Irina and Zurawski, Jeffrey V. and Conway, Jonathan M. and Adams, Michael W. W. and Kelly, Robert M.}, year={2014}, month={May}, pages={393–448} }
 @article{bielen_verhaart_vanfossen_blumer-schuette_stams_oost_kelly_kengen_2013, title={A thermophile under pressure: Transcriptional analysis of the response of Caldicellulosiruptor saccharolyticus to different H-2 partial pressures}, volume={38}, ISSN={["1879-3487"]}, DOI={10.1016/j.ijhydene.2012.11.082}, abstractNote={Increased hydrogen (H2) levels are known to inhibit H2 formation in Caldicellulosiruptor saccharolyticus. To investigate this organism's strategy for dealing with elevated H2 levels the effect of the hydrogen partial pressure (PH2) on fermentation performance was studied by growing cultures under high and low PH2 in a glucose limited chemostat setup. Transcriptome analysis revealed the upregulation of genes involved in the disposal of reducing equivalents under high PH2, like lactate dehydrogenase and alcohol dehydrogenase as well as the NADH-dependent and ferredoxin-dependent hydrogenases. These findings are in line with the observed shift in fermentation profiles from acetate production to the production of acetate, lactate and ethanol under high PH2. Moreover, differential transcription was observed for genes involved in carbon metabolism, fatty acid biosynthesis and several transport systems. In addition, presented transcription data provide evidence for the involvement of the redox sensing Rex protein in gene regulation under high PH2 cultivation conditions.}, number={4}, journal={INTERNATIONAL JOURNAL OF HYDROGEN ENERGY}, author={Bielen, Abraham A. M. and Verhaart, Marcel R. A. and VanFossen, Amy L. and Blumer-Schuette, Sara E. and Stams, Alfons J. M. and Oost, John and Kelly, Robert M. and Kengen, Serve W. M.}, year={2013}, month={Feb}, pages={1837–1849} }
 @misc{hawkins_mcternan_lian_kelly_adams_2013, title={Biological conversion of carbon dioxide and hydrogen into liquid fuels and industrial chemicals}, volume={24}, ISSN={["1879-0429"]}, DOI={10.1016/j.copbio.2013.02.017}, abstractNote={Non-photosynthetic routes for biological fixation of carbon dioxide into valuable industrial chemical precursors and fuels are moving from concept to reality. The development of ‘electrofuel’-producing microorganisms leverages techniques in synthetic biology, genetic and metabolic engineering, as well as systems-level multi-omic analysis, directed evolution, and in silico modeling. Electrofuel processes are being developed for a range of microorganisms and energy sources (e.g. hydrogen, formate, electricity) to produce a variety of target molecules (e.g. alcohols, terpenes, alkenes). This review examines the current landscape of electrofuel projects with a focus on hydrogen-utilizing organisms covering the biochemistry of hydrogenases and carbonic anhydrases, kinetic and energetic analyses of the known carbon fixation pathways, and the state of genetic systems for current and prospective electrofuel-producing microorganisms.}, number={3}, journal={CURRENT OPINION IN BIOTECHNOLOGY}, author={Hawkins, Aaron S. and McTernan, Patrick M. and Lian, Hong and Kelly, Robert M. and Adams, Michael W. W.}, year={2013}, month={Jun}, pages={376–384} }
 @article{kataeva_foston_yang_pattathil_biswal_poole ii_basen_rhaesa_thomas_azadi_et al._2013, title={Carbohydrate and lignin are simultaneously solubilized from unpretreated switchgrass by microbial action at high temperature}, volume={6}, ISSN={1754-5692 1754-5706}, url={http://dx.doi.org/10.1039/C3EE40932E}, DOI={10.1039/C3EE40932E}, abstractNote={The three major components of plant biomass, cellulose, hemicellulose and lignin, are highly recalcitrant and deconstruction involves thermal and chemical pretreatment. Microbial conversion is a possible solution, but few anaerobic microbes utilize both cellulose and hemicellulose and none are known to solubilize lignin. Herein, we show that the majority (85%) of insoluble switchgrass biomass that had not been previously chemically treated was degraded at 78 °C by the anaerobic bacterium Caldicellulosiruptor bescii. Remarkably, the glucose/xylose/lignin ratio and physical and spectroscopic properties of the remaining insoluble switchgrass were not significantly different than those of the untreated plant material. C. bescii is therefore able to solubilize lignin as well as the carbohydrates and, accordingly, lignin-derived aromatics were detected in the culture supernatants. From mass balance analyses, the carbohydrate in the solubilized switchgrass quantitatively accounted for the growth of C. bescii and its fermentation products, indicating that the lignin was not assimilated by the microorganism. Immunoanalyses of biomass and transcriptional analyses of C. bescii showed that the microorganism when grown on switchgrass produces enzymes directed at key plant cell wall moieties such as pectin, xyloglucans and rhamnogalacturonans, and that these and as yet uncharacterized enzymes enable the degradation of cellulose, hemicellulose and lignin at comparable rates. This unexpected finding of simultaneous lignin and carbohydrate solubilization bodes well for industrial conversion by extremely thermophilic microbes of biomass that requires limited or, more importantly, no chemical pretreatment.}, number={7}, journal={Energy & Environmental Science}, publisher={Royal Society of Chemistry (RSC)}, author={Kataeva, Irina and Foston, Marcus B. and Yang, Sung-Jae and Pattathil, Sivakumar and Biswal, Ajaya K. and Poole II, Farris L. and Basen, Mirko and Rhaesa, Amanda M. and Thomas, Tina P. and Azadi, Parastoo and et al.}, year={2013}, pages={2186} }
 @article{keller_schut_lipscomb_menon_iwuchukwu_leuko_thorgersen_nixon_hawkins_kelly_et al._2013, title={Exploiting microbial hyperthermophilicity to produce an industrial chemical, using hydrogen and carbon dioxide}, volume={110}, ISSN={["0027-8424"]}, DOI={10.1073/pnas.1222607110}, abstractNote={Microorganisms can be engineered to produce useful products, including chemicals and fuels from sugars derived from renewable feedstocks, such as plant biomass. An alternative method is to use low potential reducing power from nonbiomass sources, such as hydrogen gas or electricity, to reduce carbon dioxide directly into products. This approach circumvents the overall low efficiency of photosynthesis and the production of sugar intermediates. Although significant advances have been made in manipulating microorganisms to produce useful products from organic substrates, engineering them to use carbon dioxide and hydrogen gas has not been reported. Herein, we describe a unique temperature-dependent approach that confers on a microorganism (the archaeon Pyrococcus furiosus, which grows optimally on carbohydrates at 100°C) the capacity to use carbon dioxide, a reaction that it does not accomplish naturally. This was achieved by the heterologous expression of five genes of the carbon fixation cycle of the archaeon Metallosphaera sedula, which grows autotrophically at 73°C. The engineered P. furiosus strain is able to use hydrogen gas and incorporate carbon dioxide into 3-hydroxypropionic acid, one of the top 12 industrial chemical building blocks. The reaction can be accomplished by cell-free extracts and by whole cells of the recombinant P. furiosus strain. Moreover, it is carried out some 30°C below the optimal growth temperature of the organism in conditions that support only minimal growth but maintain sufficient metabolic activity to sustain the production of 3-hydroxypropionate. The approach described here can be expanded to produce important organic chemicals, all through biological activation of carbon dioxide.}, number={15}, journal={PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA}, author={Keller, Matthew W. and Schut, Gerrit J. and Lipscomb, Gina L. and Menon, Angeli L. and Iwuchukwu, Ifeyinwa J. and Leuko, Therese T. and Thorgersen, Michael P. and Nixon, William J. and Hawkins, Aaron S. and Kelly, Robert M. and et al.}, year={2013}, month={Apr}, pages={5840–5845} }
 @article{hawkins_han_bennett_adams_kelly_2013, title={Role of 4-Hydroxybutyrate-CoA Synthetase in the CO2 Fixation Cycle in Thermoacidophilic Archaea}, volume={288}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.m112.413195}, abstractNote={Metallosphaera sedula is an extremely thermoacidophilic archaeon that grows heterotrophically on peptides and chemolithoautotrophically on hydrogen, sulfur, or reduced metals as energy sources. During autotrophic growth, carbon dioxide is incorporated into cellular carbon via the 3-hydroxypropionate/4-hydroxybutyrate cycle (3HP/4HB). To date, all of the steps in the pathway have been connected to enzymes encoded in specific genes, except for the one responsible for ligation of coenzyme A (CoA) to 4HB. Although several candidates for this step have been identified through bioinformatic analysis of the M. sedula genome, none have been shown to catalyze this biotransformation. In this report, transcriptomic analysis of cells grown under strict H2-CO2 autotrophy was consistent with the involvement of Msed_0406 and Msed_0394. Recombinant versions of these enzymes catalyzed the ligation of CoA to 4HB, with similar affinities for 4HB (Km values of 1.9 and 1.5 mm for Msed_0406 and Msed_0394, respectively) but with different rates (1.69 and 0.22 μmol × min−1 × mg−1 for Msed_0406 and Msed_0394, respectively). Neither Msed_0406 nor Msed_0394 have close homologs in other Sulfolobales, although low sequence similarity is not unusual for acyl-adenylate-forming enzymes. The capacity of these two enzymes to use 4HB as a substrate may have arisen from simple modifications to acyl-adenylate-forming enzymes. For example, a single amino acid substitution (W424G) in the active site of the acetate/propionate synthetase (Msed_1353), an enzyme that is highly conserved among the Sulfolobales, changed its substrate specificity to include 4HB. The identification of the 4-HB CoA synthetase now completes the set of enzymes comprising the 3HP/4HB cycle.Background: Thermoacidophilic Sulfolobales contain a novel CO2 fixation pathway; all enzymes but one have been accounted for in Metallosphaera sedula.Results: Enzymes encoded in Msed_0394 and Msed_0406 each exhibit 4-hydroxybutyrate-CoA synthetase activity, consistent with transcriptomic evidence.Conclusion: Msed_0406 is likely the physiologically relevant enzyme in the cycle.Significance: All enzymes are now accounted for in the CO2 fixation cycle of M. sedula. Metallosphaera sedula is an extremely thermoacidophilic archaeon that grows heterotrophically on peptides and chemolithoautotrophically on hydrogen, sulfur, or reduced metals as energy sources. During autotrophic growth, carbon dioxide is incorporated into cellular carbon via the 3-hydroxypropionate/4-hydroxybutyrate cycle (3HP/4HB). To date, all of the steps in the pathway have been connected to enzymes encoded in specific genes, except for the one responsible for ligation of coenzyme A (CoA) to 4HB. Although several candidates for this step have been identified through bioinformatic analysis of the M. sedula genome, none have been shown to catalyze this biotransformation. In this report, transcriptomic analysis of cells grown under strict H2-CO2 autotrophy was consistent with the involvement of Msed_0406 and Msed_0394. Recombinant versions of these enzymes catalyzed the ligation of CoA to 4HB, with similar affinities for 4HB (Km values of 1.9 and 1.5 mm for Msed_0406 and Msed_0394, respectively) but with different rates (1.69 and 0.22 μmol × min−1 × mg−1 for Msed_0406 and Msed_0394, respectively). Neither Msed_0406 nor Msed_0394 have close homologs in other Sulfolobales, although low sequence similarity is not unusual for acyl-adenylate-forming enzymes. The capacity of these two enzymes to use 4HB as a substrate may have arisen from simple modifications to acyl-adenylate-forming enzymes. For example, a single amino acid substitution (W424G) in the active site of the acetate/propionate synthetase (Msed_1353), an enzyme that is highly conserved among the Sulfolobales, changed its substrate specificity to include 4HB. The identification of the 4-HB CoA synthetase now completes the set of enzymes comprising the 3HP/4HB cycle. Background: Thermoacidophilic Sulfolobales contain a novel CO2 fixation pathway; all enzymes but one have been accounted for in Metallosphaera sedula. Results: Enzymes encoded in Msed_0394 and Msed_0406 each exhibit 4-hydroxybutyrate-CoA synthetase activity, consistent with transcriptomic evidence. Conclusion: Msed_0406 is likely the physiologically relevant enzyme in the cycle. Significance: All enzymes are now accounted for in the CO2 fixation cycle of M. sedula. Carbon dioxide is chemically stable and unreactive and must be reduced to enable its incorporation into biological molecules. Autotrophic microorganisms are able to utilize carbon dioxide as their sole carbon source, and a variety of pathways are known to activate and incorporate it into biomolecules essential for growth and replication. Recently, carbon dioxide fixation pathways have received interest for biotechnological applications, since this could provide biological routes for de novo generation of fuels and small organic molecules (1Hawkins A. Han Y. Lian H. Loder A. Menon A. Iwuchukwu I. Keller M. Leuko T. Adams M.W. Kelly R.M. Extremely thermophilic routes to microbial electrofuels.ACS Catal. 2011; 1: 1043-1050Crossref Scopus (28) Google Scholar). There are currently at least six natural pathways for the incorporation of inorganic carbon dioxide into cellular carbon (2Berg I.A. Ecological aspects of the distribution of different autotrophic CO2 fixation pathways.Appl. Environ. Microbiol. 2011; 77: 1925-1936Crossref PubMed Scopus (456) Google Scholar, 3Berg I.A. Kockelkorn D. Ramos-Vera W.H. Say R.F. Zarzycki J. Hügler M. Alber B.E. Fuchs G. Autotrophic carbon fixation in archaea.Nat. Rev. Microbiol. 2010; 8: 447-460Crossref PubMed Scopus (453) Google Scholar). The most recently discovered of these are found exclusively in extremely thermophilic archaea as follows: the 3-hydroxypropionate/4-hydroxybutyrate (3HP 3The abbreviations used are: 3HP3-hydroxypropionate4HB4-hydroxybutyrateDCdicarboxylateACLautotrophic carbon-limitedHTRheterotrophicACSacetyl-CoA synthetaseACRautotrophic carbon-rich. /4HB) carbon fixation cycle, which operates in members of the crenarchaeal order Sulfolobales (2Berg I.A. Ecological aspects of the distribution of different autotrophic CO2 fixation pathways.Appl. Environ. Microbiol. 2011; 77: 1925-1936Crossref PubMed Scopus (456) Google Scholar, 4Berg I.A. Kockelkorn D. Buckel W. Fuchs G. A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway in archaea.Science. 2007; 318: 1782-1786Crossref PubMed Scopus (420) Google Scholar, 5Alber B.E. Kung J.W. Fuchs G. 3-Hydroxypropionyl-coenzyme A synthetase from Metallosphaera sedula, an enzyme involved in autotrophic CO2 fixation.J. Bacteriol. 2008; 190: 1383-1389Crossref PubMed Scopus (38) Google Scholar, 6Hügler M. Huber H. Stetter K.O. Fuchs G. Autotrophic CO2 fixation pathways in archaea (Crenarchaeota).Arch. Microbiol. 2003; 179: 160-173Crossref PubMed Scopus (154) Google Scholar), and the dicarboxylate/4-hydroxybutyrate (DC/4HB) cycle, which is used by anaerobic members of the orders Thermoproteales and Desulfurococcales (4Berg I.A. Kockelkorn D. Buckel W. Fuchs G. A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway in archaea.Science. 2007; 318: 1782-1786Crossref PubMed Scopus (420) Google Scholar, 7Huber H. Gallenberger M. Jahn U. A dicarboxylate/4-hydroxybutyrate autotrophic carbon assimilation cycle in the hyperthermophilic archaeum Ignicoccus hospitalis.Proc. Natl. Acad. Sci. U.S.A. 2008; 105: 7851-7856Crossref PubMed Scopus (202) Google Scholar). In both cycles, two carbon dioxide molecules are added to acetyl-CoA (C2) to produce succinyl-CoA (C4), which is subsequently rearranged to acetoacetyl-CoA and cleaved into two molecules of acetyl-CoA. These pathways differ primarily in regard to their tolerance to oxygen and the co-factors used for reducing equivalents as follows: NAD(P)H for the 3HP/4HB cycle and ferredoxin/NAD(P)H for the DC/4HB cycle (3Berg I.A. Kockelkorn D. Ramos-Vera W.H. Say R.F. Zarzycki J. Hügler M. Alber B.E. Fuchs G. Autotrophic carbon fixation in archaea.Nat. Rev. Microbiol. 2010; 8: 447-460Crossref PubMed Scopus (453) Google Scholar, 8Auernik K.S. Kelly R.M. Physiological versatility of the extremely thermoacidophilic archaeon Metallosphaera sedula supported by transcriptomic analysis of heterotrophic, autotrophic, and mixotrophic growth.Appl. Environ. Microbiol. 2010; 76: 931-935Crossref PubMed Scopus (49) Google Scholar). The two archaeal pathways also differ in how they link the CO2 fixation cycle to central metabolism. In the DC/4HB pathway, pyruvate is synthesized directly from acetyl-CoA using pyruvate synthase. In the 3HP/4HB pathway, another half-turn is required to make succinyl-CoA, which is then oxidized via succinate to pyruvate (2Berg I.A. Ecological aspects of the distribution of different autotrophic CO2 fixation pathways.Appl. Environ. Microbiol. 2011; 77: 1925-1936Crossref PubMed Scopus (456) Google Scholar, 9Ramos-Vera W.H. Weiss M. Strittmatter E. Kockelkorn D. Fuchs G. Identification of missing genes and enzymes for autotrophic carbon fixation in crenarchaeota.J. Bacteriol. 2011; 193: 1201-1211Crossref PubMed Scopus (44) Google Scholar, 10Estelmann S. Hügler M. Eisenreich W. Werner K. Berg I.A. Ramos-Vera W.H. Say R.F. Kockelkorn D. Gad'on N. Fuchs G. Labeling and enzyme studies of the central carbon metabolism in Metallosphaera sedula.J. Bacteriol. 2011; 193: 1191-1200Crossref PubMed Scopus (51) Google Scholar). 3-hydroxypropionate 4-hydroxybutyrate dicarboxylate autotrophic carbon-limited heterotrophic acetyl-CoA synthetase autotrophic carbon-rich. There are 13 enzymes proposed to catalyze the 16 reactions in the 3HP/4HB pathway. The first three enzymes convert acetyl-CoA (C2) to 3HP (C3) via an ATP-dependent carboxylation step. Next, 3HP is converted and reduced to propionyl-CoA, carboxylated a second time, and rearranged to make succinyl-CoA (C4). Succinyl-CoA is reduced to 4HB, which is converted to two molecules of acetyl-CoA in the final reactions of the cycle. Flux analysis and labeling studies have confirmed the operation of this pathway in Metallosphaera sedula (4Berg I.A. Kockelkorn D. Buckel W. Fuchs G. A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway in archaea.Science. 2007; 318: 1782-1786Crossref PubMed Scopus (420) Google Scholar, 10Estelmann S. Hügler M. Eisenreich W. Werner K. Berg I.A. Ramos-Vera W.H. Say R.F. Kockelkorn D. Gad'on N. Fuchs G. Labeling and enzyme studies of the central carbon metabolism in Metallosphaera sedula.J. Bacteriol. 2011; 193: 1191-1200Crossref PubMed Scopus (51) Google Scholar). All of the enzymes that comprise the first portion of the cycle up to the formation of 4HB have been identified and characterized biochemically in their native or recombinant form, mostly from the extremely thermoacidophilic archaeon M. sedula (T = 70 °C, pH 2.0) (see Table 1) (4Berg I.A. Kockelkorn D. Buckel W. Fuchs G. A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway in archaea.Science. 2007; 318: 1782-1786Crossref PubMed Scopus (420) Google Scholar, 5Alber B.E. Kung J.W. Fuchs G. 3-Hydroxypropionyl-coenzyme A synthetase from Metallosphaera sedula, an enzyme involved in autotrophic CO2 fixation.J. Bacteriol. 2008; 190: 1383-1389Crossref PubMed Scopus (38) Google Scholar, 11Hügler M. Krieger R.S. Jahn M. Fuchs G. Characterization of acetyl-CoA/propionyl-CoA carboxylase in Metallosphaera sedula.Eur. J. Biochem. 2003; 270: 736-744Crossref PubMed Scopus (88) Google Scholar, 12Alber B. Olinger M. Rieder A. Kockelkorn D. Jobst B. Hügler M. Fuchs G. Malonyl-coenzyme a reductase in the modified 3-hydroxypropionate cycle for autotrophic carbon fixation in archaeal metallosphaera and sulfolobus spp.J. Bacteriol. 2006; 188: 8551-8559Crossref PubMed Scopus (76) Google Scholar, 13Han Y. Hawkins A.S. Adams M.W. Kelly R.M. Epimerase (Msed_ 0639) and mutase (Msed_0638, Msed_2055) convert (S)-methylmalonyl-CoA to succinyl-CoA in the Metallosphaera sedula 3-hydroxypropionate/4-hydroxybutyrate cycle.Appl. Environ. Microbiol. 2012; 78: 6196-6202Crossref Scopus (19) Google Scholar). The enzymes involved in the conversion of 4HB to two molecules of acetyl-CoA have not been characterized to the same extent (Fig. 1). Activities corresponding to 4-hydroxybutyryl-CoA dehydratase and acetoacetyl-CoA β-ketothiolase have been detected in cell extracts (4Berg I.A. Kockelkorn D. Buckel W. Fuchs G. A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway in archaea.Science. 2007; 318: 1782-1786Crossref PubMed Scopus (420) Google Scholar, 14Riddles P.W. Blakeley R.L. Zerner B. Reassessment of Ellman's reagent.Methods Enzymol. 1983; 91: 49-60Crossref PubMed Scopus (1065) Google Scholar), although neither enzyme has been purified in its native form or recombinantly produced. Identification of candidates for both of these enzymes has been made based on genome annotation and transcriptomic analysis of autotrophic growth compared with heterotrophy (8Auernik K.S. Kelly R.M. Physiological versatility of the extremely thermoacidophilic archaeon Metallosphaera sedula supported by transcriptomic analysis of heterotrophic, autotrophic, and mixotrophic growth.Appl. Environ. Microbiol. 2010; 76: 931-935Crossref PubMed Scopus (49) Google Scholar, 9Ramos-Vera W.H. Weiss M. Strittmatter E. Kockelkorn D. Fuchs G. Identification of missing genes and enzymes for autotrophic carbon fixation in crenarchaeota.J. Bacteriol. 2011; 193: 1201-1211Crossref PubMed Scopus (44) Google Scholar). Although neither of the candidate genes for these enzymes has so far been confirmed biochemically, their identity is not in dispute because of strong homology to known versions in less thermophilic organisms. The corresponding gene products in M. sedula are Msed_1321 for the 4HB-CoA dehydratase and Msed_0656 for the acetoacetyl-CoA β-ketothiolase.TABLE 1Enzymes in the 3HP/4HB cycle in M. sedulaCycle ref. no.ORFEnzymeRef.E1αMsed_0147Acetyl-CoA/propionyl-CoA carboxylaseNCE (11Hügler M. Krieger R.S. Jahn M. Fuchs G. Characterization of acetyl-CoA/propionyl-CoA carboxylase in Metallosphaera sedula.Eur. J. Biochem. 2003; 270: 736-744Crossref PubMed Scopus (88) Google Scholar, 41Menendez C. Bauer Z. Huber H. Gad'on N. Stetter K.O. Fuchs G. Presence of acetyl coenzyme A (CoA) carboxylase and propionyl-CoA carboxylase in autotrophic Crenarchaeota and indication for operation of a 3-hydroxypropionate cycle in autotrophic carbon fixation.J. Bacteriol. 1999; 181: 1088-1098Crossref PubMed Google Scholar)E1βMsed_0148E1γMsed_1375E2Msed_0709Malonyl-CoA/succinyl-CoA reductaseR (42Kockelkorn D. Fuchs G. Malonic semialdehyde reductase, succinic semialdehyde reductase, and succinyl-coenzyme a reductase from Metallosphaera sedula. Enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in sulfolobales.J. Bacteriol. 2009; 191: 6352-6362Crossref PubMed Scopus (53) Google Scholar)E3Msed_1993Malonate semialdehyde reductaseR (42Kockelkorn D. Fuchs G. Malonic semialdehyde reductase, succinic semialdehyde reductase, and succinyl-coenzyme a reductase from Metallosphaera sedula. Enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in sulfolobales.J. Bacteriol. 2009; 191: 6352-6362Crossref PubMed Scopus (53) Google Scholar)E4Msed_14563-Hydroxypropionate:CoA ligaseNP (5Alber B.E. Kung J.W. Fuchs G. 3-Hydroxypropionyl-coenzyme A synthetase from Metallosphaera sedula, an enzyme involved in autotrophic CO2 fixation.J. Bacteriol. 2008; 190: 1383-1389Crossref PubMed Scopus (38) Google Scholar)E5Msed_20013-Hydroxypropionyl-CoA dehydrataseNP,R (43Teufel R. Kung J.W. Kockelkorn D. Alber B.E. Fuchs G. 3-Hydroxypropionyl-coenzyme A dehydratase and acryloyl-coenzyme A reductase, enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in the sulfolobales.J. Bacteriol. 2009; 191: 4572-4581Crossref PubMed Scopus (58) Google Scholar)E6Msed_1426Acryloyl-CoA reductaseNP (43Teufel R. Kung J.W. Kockelkorn D. Alber B.E. Fuchs G. 3-Hydroxypropionyl-coenzyme A dehydratase and acryloyl-coenzyme A reductase, enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in the sulfolobales.J. Bacteriol. 2009; 191: 4572-4581Crossref PubMed Scopus (58) Google Scholar)E7Msed_0639Methylmalonyl-CoA epimeraseR (13Han Y. Hawkins A.S. Adams M.W. Kelly R.M. Epimerase (Msed_ 0639) and mutase (Msed_0638, Msed_2055) convert (S)-methylmalonyl-CoA to succinyl-CoA in the Metallosphaera sedula 3-hydroxypropionate/4-hydroxybutyrate cycle.Appl. Environ. Microbiol. 2012; 78: 6196-6202Crossref Scopus (19) Google Scholar)E8αMsed_0638Methylmalonyl-CoA mutaseR (13Han Y. Hawkins A.S. Adams M.W. Kelly R.M. Epimerase (Msed_ 0639) and mutase (Msed_0638, Msed_2055) convert (S)-methylmalonyl-CoA to succinyl-CoA in the Metallosphaera sedula 3-hydroxypropionate/4-hydroxybutyrate cycle.Appl. Environ. Microbiol. 2012; 78: 6196-6202Crossref Scopus (19) Google Scholar)E8βMsed_2055E9Msed_1424Succinate semialdehyde reductaseNP,R (42Kockelkorn D. Fuchs G. Malonic semialdehyde reductase, succinic semialdehyde reductase, and succinyl-coenzyme a reductase from Metallosphaera sedula. Enzymes of the autotrophic 3-hydroxypropionate/4-hydroxybutyrate cycle in sulfolobales.J. Bacteriol. 2009; 191: 6352-6362Crossref PubMed Scopus (53) Google Scholar)E10Msed_03944-Hydroxybutyrate-CoA synthetaseR (this work)Msed_0406E11Msed_13214-Hydroxybutyryl-CoA dehydrataseNCE (4Berg I.A. Kockelkorn D. Buckel W. Fuchs G. A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway in archaea.Science. 2007; 318: 1782-1786Crossref PubMed Scopus (420) Google Scholar)E12Msed_0399Crotonyl-CoA hydratase/(S)-3-hydroxybutyryl-CoA dehydrogenaseR (9Ramos-Vera W.H. Weiss M. Strittmatter E. Kockelkorn D. Fuchs G. Identification of missing genes and enzymes for autotrophic carbon fixation in crenarchaeota.J. Bacteriol. 2011; 193: 1201-1211Crossref PubMed Scopus (44) Google Scholar)E13Msed_0656Acetoacetyl-CoA β-ketothiolaseNCE (4Berg I.A. Kockelkorn D. Buckel W. Fuchs G. A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway in archaea.Science. 2007; 318: 1782-1786Crossref PubMed Scopus (420) Google Scholar) Open table in a new tab The identity of the crotonyl-CoA hydratase and the (S)-3-hydroxybutyryl-CoA dehydrogenase was recently confirmed when it was discovered that both reactions were catalyzed by a single bifunctional fusion protein (9Ramos-Vera W.H. Weiss M. Strittmatter E. Kockelkorn D. Fuchs G. Identification of missing genes and enzymes for autotrophic carbon fixation in crenarchaeota.J. Bacteriol. 2011; 193: 1201-1211Crossref PubMed Scopus (44) Google Scholar). In the same work, Ramos-Vera et al. (9Ramos-Vera W.H. Weiss M. Strittmatter E. Kockelkorn D. Fuchs G. Identification of missing genes and enzymes for autotrophic carbon fixation in crenarchaeota.J. Bacteriol. 2011; 193: 1201-1211Crossref PubMed Scopus (44) Google Scholar) tested three different candidates for the 4HB-CoA synthetase, but they all failed to show activity on 4HB. In fact, the primary candidate suggested by the autotrophic transcriptome analysis (Msed_1422) showed no enzymatic activity on short chain linear unsubstituted or hydroxy acids, specifically acetate, propionate, 3HP, 3-hydroxybutyrate, 4HB, and crotonate. Two other candidates were selected, based on homology to 4HB-CoA synthetase from Thermoproteus neutrophilus (Tneu_0420) and 3HP-CoA synthetase from M. sedula: Msed_1353 and Msed_1291 were recombinantly produced and tested for ligase activity. Msed_1353 was active on propionate and acetate, but not on 4HB. Furthermore, Msed_1291 had no activity on any of the previously mentioned organic acids. Thus, although cycle function has been confirmed by metabolic flux analysis, and although 4HB-CoA synthetase activity has been measured in cell extracts of autotrophically grown M. sedula, the enzyme responsible for ligation of CoA to 4HB remains unclear. To identify the missing link in the 3HP/4HB cycle, new methods for semi-continuous cultivation of M. sedula in a gas-intensive fermentation system were developed to tease out differential transcriptional response of autotrophy-related genes. Strict carbon dioxide limitation was used to drive increased operational efficiency of the CO2 fixation enzymes, which hypothetically would increase transcriptional levels of genes encoding key enzymes to maximize carbon incorporation. Using these conditions for transcriptional analysis, a much clearer picture emerged concerning the global regulatory changes in M. sedula as its cellular metabolism switches from autotrophy to heterotrophy. This strategy produced new leads for the genes and corresponding enzymes responsible for the 4HB-CoA ligation step. The enzymes were recombinantly produced and shown to catalyze the ligation of CoA to 4HB. M. sedula (DSMZ 5348) was grown aerobically at 70 °C in a shaking oil bath (90 rpm) under autotrophic or heterotrophic conditions on DSMZ medium 88 at pH 2. Heterotrophically grown cells were supplemented with 0.1% tryptone. Cell growth was scaled up from 300 ml in sealed 1-liter bottles (see Ref. 8Auernik K.S. Kelly R.M. Physiological versatility of the extremely thermoacidophilic archaeon Metallosphaera sedula supported by transcriptomic analysis of heterotrophic, autotrophic, and mixotrophic growth.Appl. Environ. Microbiol. 2010; 76: 931-935Crossref PubMed Scopus (49) Google Scholar) to 2 liters in a stirred bench-top glass fermentor (Applikon), also on DSMZ medium 88, pH 2, at 70 °C, and agitated at 250 rpm. Two separately regulated gas feeds were used such that flow rates were held constant for all conditions at 1 ml/min for the hydrogen/CO2 gas mixtures (composition varied) and 100 ml/min for air (composition: 78% N2, 21% O2, 0.03% CO2). For the autotrophic carbon-rich (ACR) condition, the gas feed contained H2 (80%) and CO2 (20%); for the autotrophic carbon-limited (ACL) condition, the feed was changed to H2 (80%) and N2 (20%); for the heterotrophic condition (HTR), the medium was supplemented with 0.1% tryptone, and the gas feed composition was N2 (80%) and CO2 (20%). Tandem fermentors were run simultaneously with the same inoculum to generate biological repeats (Fig. 2). Cells were harvested at mid-exponential phase by rapid cooling with dry ice and ethanol and then centrifuged at 6000 × g for 15 min at 4 °C. A spotted whole-genome oligonucleotide microarray, based on 2256 protein-coding open reading frames (ORFs), was used, as described previously (15Auernik K.S. Kelly R.M. Identification of components of electron transport chains in the extremely thermoacidophilic crenarchaeon Metallosphaera sedula through iron and sulfur compound oxidation transcriptomes.Appl. Environ. Microbiol. 2008; 74: 7723-7732Crossref PubMed Scopus (75) Google Scholar). Total RNA was extracted and purified (RNeasy; Qiagen), reverse-transcribed (Superscript III; Invitrogen), re-purified, labeled with either Cy3 or Cy5 dye (GE Healthcare), and hybridized to the microarray slides (Corning). Slides were scanned on a GenePix 4000B Microarray Scanner (Molecular Devices, Sunnyvale, CA), and raw intensities were quantitated using GenePix Pro version 6.0. Normalization of data and statistical analysis were performed using JMP Genomics 5 (SAS, Cary, NC). In general, significant differential transcription was defined to be a relative change at or above 2 (where a log2 value of ±1 equals a 2-fold change) with significance values at or above the Bonferroni correction; for these data, this was 5.4 (equivalent to a p value of 4.0 × 106). Microarray data are available through the NCBI Gene Expression Omnibus (GEO) under accession number GSE39944. Two assays were used to measure ligase activity, one spectrophotometric and one using high performance liquid chromatography (HPLC). A discontinuous assay was used to measure substrate-dependent disappearance of CoA at 75 °C. The reaction mixture (600 μl) contained 100 mm MOPS/KOH, pH 7.9, 5 mm MgCl2, 2.5 mm ATP, 0.15 mm CoA, and purified enzyme. At each time point, 80 μl of reaction mixture was added to 80 μl of cold 5,5′-dithiobis-(2-nitrobenzoic acid). A time point (0 min) was taken before heating. The reaction mixture was incubated for 2 min at 75 °C, followed by addition of substrate. Additional time points were taken at 30, 60, 90, 120, and 180 s after addition of substrate. Absorbance was measured at 412 nm to determine free CoA concentration, based on the concentration of 2-nitro-5-thiobenzoate dianion (ϵ412 = 14,150 m−1 cm−1) (1Hawkins A. Han Y. Lian H. Loder A. Menon A. Iwuchukwu I. Keller M. Leuko T. Adams M.W. Kelly R.M. Extremely thermophilic routes to microbial electrofuels.ACS Catal. 2011; 1: 1043-1050Crossref Scopus (28) Google Scholar, 14Riddles P.W. Blakeley R.L. Zerner B. Reassessment of Ellman's reagent.Methods Enzymol. 1983; 91: 49-60Crossref PubMed Scopus (1065) Google Scholar). Enzymes were kinetically characterized by varying the concentration of the acyl-CoA substrate from 0.05 to 12 mm, although the other substrate concentrations were held constant. Measurements for specific activity were taken under saturating substrate concentrations (10 mm). Formation of the CoA ester was also confirmed using HPLC (Waters). The reaction mixture (0.15 ml) contained 100 mm potassium phosphate, pH 7.9, 10 mm MgCl2, 2 mm ATP, 0.5 mm CoA, 10 mm substrate, and purified enzyme. The reaction was incubated for 3 min at 75 °C, quenched with 15 μl of 1 m HCl, filtered with a 10-kDa spin column (Amicon YM-10) to remove the protein, and loaded onto a reversed-phase C18 silica-based column (Shodex C18–4E, 4.6 × 250 mm). The mobile phase was 50 mm sodium phosphate buffer, pH 6.7, with 2% methanol. M. sedula genes encoding acyl-CoA synthetases were amplified from genomic DNA using primers synthesized by Integrated DNA Technologies (Coralville, IA). Msed_0394 and Msed_0406 were ligated into pET46-Ek/LIC, although Msed_1353 was ligated into pET21b using NdeI and XhoI restrictions sites. All constructs were designed to express with an N-terminal His6 tag. Plasmids containing gene inserts were cloned into NovaBlue GigaSingles E. coli competent cells and selected by growth on LB-agar supplemented with ampicillin (100 μg/ml). Plasmid DNA was extracted using a QIAprep spin miniprep kit. Sequences were confirmed by Eton Biosciences, Inc. (Durham, NC). For protein expression, the plasmids were transformed into Escherichia coli Rosetta 2 (DE3) cells and selected by growth on LB-agar, supplemented with ampicillin (100 μg/ml) and chloramphenicol (50 μg/ml). Cells harboring the recombinant plasmid were induced with isopropyl 1-thio-β-d-galactopyranoside (final concentration 0.1 mm) at A600 0.4–0.6 and cultured for 3 h before harvest. Cells were harvested by centrifugation at 6000 × g for 15 min at 4 °C. Cell yields ranged from 1.6 to 3.8 g of cells/liter of LB medium (wet weight). Cell pellets were resuspended in lysis buffer (50 mm sodium phosphate, 100 mm NaCl, 0.1% Nonidet P-40, pH 8.0) containing DNase and lysozyme at final concentrations of 10 and 100 μg/ml, respectively. Cells were lysed with a French press (two passes at 18,000 p.s.i.), and the lysate was centrifuged at 22,000 × g for 15 min at 4 °C to removed insoluble material. Soluble, cell-free extract was heated to 65 °C for 20 min to precipitate mesophilic proteins. Streptomycin sulfate (1% w/v) was added to precipitate nucleic acids, followed by a 1-h incubation at 4 °C. A final centrifugation was performed at 22,000 × g for 15 min at 4 °C to collect the soluble, heat-treated cell-free extract, which was sterile-filtered (0.22 μm) and purified using a 5 ml HisTrapTM nickel column (GE Healthcare). Proteins were bound to the HisTrapTM column using binding buffer (50 mm sodium phosphate, 500 mm NaCl, 20 mm imidazole, pH 7.4) and eluted using elution buffer (50 mm sodium phosphate, 500 mm NaCl, 300 mm imidazole, pH 7.4). SDS-PAGE was then performed on the immobilized metal affinity chromatography fractions to qualitatively determine the purity of the protein before further purification. Chromatography fractions containing the protein were concentrated, exchanged into phosphate buffer (50 mm potassium phosphate, 150 mm NaCl, pH 7.0) using an Amicon YM10 (Millipore) centrifugal filter membrane, and centrifuged at 4000 × g and 4 °C. To quantify the amount of protein, a Bradford assay was performed on the concentrated immobilized metal affinity chromatography fractions using known serial dilutions of bovine serum albumin (BSA) by taking absorbance readings at 595 nm. Protein was further purified using a Superdex 200 10/300 GL (GE Healthcare) gel filtration column. The proteins were eluted from the gel filtration column using elution buffer (50 mm potassium phosphate, 150 mm NaCl, pH 7.0). Proteins were dialyzed into 100 mm MOPS-KOH (pH 7.9) and either stored at 4 °C or mixed with glycerol to 20% and stored at −20 °C. Msed_1353 was mutated with the GENEART® site-directed mutagenesis system (Invitrogen), using AccuPrimeTM Pfx polymerase. Mutagenesis primers were designed to change Trp424 to glycine (primer 1, 5′-CCCTTTGGTAGCACTTGGGGAATGACTGAAACTGG-3′; primer 2, reverse complement of primer 1). Plasmids with Msed_1353-G424 were cloned into NovaBlue GigaSingles E. coli competent cells and selected by growth on LB-agar supplemented with ampicillin (100 μg/ml). Sequences were confirmed by Eton Biosciences Inc. (Durham, NC). Three-dimensional structural models for M. sedula acyl-CoA synthetases were made using the iterative threading assembly refinement (I-TASSER) on-line server (2Berg I.A. Ecological aspects of the distribution of different autotrophic CO2 fixation pathways.Appl. Environ. Microbiol. 2011; 77: 1925-1936Cros}, number={6}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Hawkins, Aaron S. and Han, Yejun and Bennett, Robert K. and Adams, Michael W. W. and Kelly, Robert M.}, year={2013}, month={Feb}, pages={4012–4022} }
 @article{frock_montero_blumer-schuette_kelly_2013, title={Stationary Phase and Nutrient Levels Trigger Transcription of a Genomic Locus Containing a Novel Peptide (TM1316) in the Hyperthermophilic Bacterium Thermotoga maritima}, volume={79}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01627-13}, abstractNote={ABSTRACT The genome of the hyperthermophilic bacterium Thermotoga maritima encodes numerous putative peptides/proteins of 100 amino acids or less. While most of these open reading frames (ORFs) are transcribed during growth, their corresponding physiological roles are largely unknown. The onset of stationary phase in T. maritima was accompanied by significant morphological changes and upregulation of several ORFs located in the TM1298-TM1336 genome locus. This region contains putative HicAB toxin-antitoxin pairs, hypothetical proteins, radical S -adenosylmethionine (SAM) enzymes, and ABC transporters. Of particular note was the TM1315-TM1319 operon, which includes a putative 31-amino-acid peptide (TM1316) that was the most highly transcribed gene in the transcriptome during stationary phase. Antibodies directed against a synthetic version of TM1316 were used to track its production, which correlated closely with transcriptomic data. Immunofluorescence microscopy revealed that TM1316 was localized to the cell envelope and prominent in cell aggregates formed during stationary phase. The only functionally characterized locus with an organization similar to that of TM1315-TM1319 is in Bacillus subtilis , which contains subtilosin A, a cyclic peptide with Cys–to–α-carbon linkages that functions as an antilisterial bacteriocin. While the organization of TM1316 resembled that of the Bacillus peptide (e.g., in its number of amino acids and spacing of Cys residues), preparations containing high levels of TM1316 affected the growth of neither Thermotoga species nor Pyrococcus furiosus , a hyperthermophilic archaeon isolated from the same locale as T. maritima . Several other putative Cys-rich peptides could be identified in the TM1298-TM1336 locus, and while their roles are also unclear, they merit examination as potential antimicrobial agents in hyperthermophilic biotopes.}, number={21}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Frock, Andrew D. and Montero, Clemente I. and Blumer-Schuette, Sara E. and Kelly, Robert M.}, year={2013}, month={Nov}, pages={6637–6646} }
 @article{blumer-schuette_giannone_zurawski_ozdemir_ma_yin_xu_kataeva_poole_adams_et al._2012, title={Caldicellulosiruptor Core and Pangenomes Reveal Determinants for Noncellulosomal Thermophilic Deconstruction of Plant Biomass}, volume={194}, ISSN={["1098-5530"]}, DOI={10.1128/jb.00266-12}, abstractNote={ABSTRACT Extremely thermophilic bacteria of the genus Caldicellulosiruptor utilize carbohydrate components of plant cell walls, including cellulose and hemicellulose, facilitated by a diverse set of glycoside hydrolases (GHs). From a biofuel perspective, this capability is crucial for deconstruction of plant biomass into fermentable sugars. While all species from the genus grow on xylan and acid-pretreated switchgrass, growth on crystalline cellulose is variable. The basis for this variability was examined using microbiological, genomic, and proteomic analyses of eight globally diverse Caldicellulosiruptor species. The open Caldicellulosiruptor pangenome (4,009 open reading frames [ORFs]) encodes 106 GHs, representing 43 GH families, but only 26 GHs from 17 families are included in the core (noncellulosic) genome (1,543 ORFs). Differentiating the strongly cellulolytic Caldicellulosiruptor species from the others is a specific genomic locus that encodes multidomain cellulases from GH families 9 and 48, which are associated with cellulose-binding modules. This locus also encodes a novel adhesin associated with type IV pili, which was identified in the exoproteome bound to crystalline cellulose. Taking into account the core genomes, pangenomes, and individual genomes, the ancestral Caldicellulosiruptor was likely cellulolytic and evolved, in some cases, into species that lost the ability to degrade crystalline cellulose while maintaining the capacity to hydrolyze amorphous cellulose and hemicellulose.}, number={15}, journal={JOURNAL OF BACTERIOLOGY}, author={Blumer-Schuette, Sara E. and Giannone, Richard J. and Zurawski, Jeffrey V. and Ozdemir, Inci and Ma, Qin and Yin, Yanbin and Xu, Ying and Kataeva, Irina and Poole, Farris L., II and Adams, Michael W. W. and et al.}, year={2012}, month={Aug}, pages={4015–4028} }
 @article{han_hawkins_adams_kelly_2012, title={Epimerase (Msed_0639) and Mutase (Msed_0638 and Msed_2055) Convert (S)-Methylmalonyl-Coenzyme A (CoA) to Succinyl-CoA in the Metallosphaera sedula 3-Hydroxypropionate/4-Hydroxybutyrate Cycle}, volume={78}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01312-12}, abstractNote={ABSTRACT Crenarchaeotal genomes encode the 3-hydroxypropionate/4-hydroxybutyrate (3-HP/4-HB) cycle for carbon dioxide fixation. Of the 13 enzymes putatively comprising the cycle, several of them, including methylmalonyl-coenzyme A (CoA) epimerase (MCE) and methylmalonyl-CoA mutase (MCM), which convert ( S )-methylmalonyl-CoA to succinyl-CoA, have not been confirmed and characterized biochemically. In the genome of Metallosphaera sedula (optimal temperature [ T opt ], 73°C), the gene encoding MCE (Msed_0639) is adjacent to that encoding the catalytic subunit of MCM-α (Msed_0638), while the gene for the coenzyme B 12 -binding subunit of MCM (MCM-β) is located remotely (Msed_2055). The expression of all three genes was significantly upregulated under autotrophic compared to heterotrophic growth conditions, implying a role in CO 2 fixation. Recombinant forms of MCE and MCM were produced in Escherichia coli ; soluble, active MCM was produced only if MCM-α and MCM-β were coexpressed. MCE is a homodimer and MCM is a heterotetramer (α 2 β 2 ) with specific activities of 218 and 2.2 μmol/min/mg, respectively, at 75°C. The heterotetrameric MCM differs from the homo- or heterodimeric orthologs in other organisms. MCE was activated by divalent cations (Ni 2+ , Co 2+ , and Mg 2+ ), and the predicted metal binding/active sites were identified through sequence alignments with less-thermophilic MCEs. The conserved coenzyme B 12 -binding motif ( DXHXXG -SXL-GG) was identified in M. sedula MCM-β. The two enzymes together catalyzed the two-step conversion of ( S )-methylmalonyl-CoA to succinyl-CoA, consistent with their proposed role in the 3-HP/4-HB cycle. Based on the highly conserved occurrence of single copies of MCE and MCM in Sulfolobaceae genomes, the M. sedula enzymes are likely to be representatives of these enzymes in the 3-HP/4-HB cycle in crenarchaeal thermoacidophiles.}, number={17}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Han, Yejun and Hawkins, Aaron S. and Adams, Michael W. W. and Kelly, Robert M.}, year={2012}, month={Sep}, pages={6194–6202} }
 @article{frock_kelly_2012, title={Extreme thermophiles: moving beyond single-enzyme biocatalysis}, volume={1}, ISSN={2211-3398}, url={http://dx.doi.org/10.1016/j.coche.2012.07.003}, DOI={10.1016/j.coche.2012.07.003}, abstractNote={Extremely thermophilic microorganisms have been sources of thermostable and thermoactive enzymes for over 30 years. However, information and insights gained from genome sequences, in conjunction with new tools for molecular genetics, have opened up exciting new possibilities for biotechnological opportunities based on extreme thermophiles that go beyond single-step biotransformations. Although the pace for discovering novel microorganisms has slowed over the past two decades, genome sequence data have provided clues to novel biomolecules and metabolic pathways, which can be mined for a range of new applications. Furthermore, recent advances in molecular genetics for extreme thermophiles have made metabolic engineering for high temperature applications a reality.}, number={4}, journal={Current Opinion in Chemical Engineering}, publisher={Elsevier BV}, author={Frock, Andrew D and Kelly, Robert M}, year={2012}, month={Nov}, pages={363–372} }
 @article{frock_gray_kelly_2012, title={Hyperthermophilic Thermotoga Species Differ with Respect to Specific Carbohydrate Transporters and Glycoside Hydrolases}, volume={78}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.07069-11}, DOI={10.1128/aem.07069-11}, abstractNote={ABSTRACT Four hyperthermophilic members of the bacterial genus Thermotoga ( T. maritima , T. neapolitana , T. petrophila , and Thermotoga sp. strain RQ2) share a core genome of 1,470 open reading frames (ORFs), or about 75% of their genomes. Nonetheless, each species exhibited certain distinguishing features during growth on simple and complex carbohydrates that correlated with genomic inventories of specific ABC sugar transporters and glycoside hydrolases. These differences were consistent with transcriptomic analysis based on a multispecies cDNA microarray. Growth on a mixture of six pentoses and hexoses showed no significant utilization of galactose or mannose by any of the four species. T. maritima and T. neapolitana exhibited similar monosaccharide utilization profiles, with a strong preference for glucose and xylose over fructose and arabinose. Thermotoga sp. strain RQ2 also used glucose and xylose, but was the only species to utilize fructose to any extent, consistent with a phosphotransferase system (PTS) specific for this sugar encoded in its genome. T. petrophila used glucose to a significantly lesser extent than the other species. In fact, the XylR regulon was triggered by growth on glucose for T. petrophila , which was attributed to the absence of a glucose transporter (XylE2F2K2), otherwise present in the other Thermotoga species. This suggested that T. petrophila acquires glucose through the XylE1F1K1 transporter, which primarily serves to transport xylose in the other three Thermotoga species. The results here show that subtle differences exist among the hyperthermophilic Thermotogales with respect to carbohydrate utilization, which supports their designation as separate species.}, number={6}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Frock, Andrew D. and Gray, Steven R. and Kelly, Robert M.}, year={2012}, month={Mar}, pages={1978–1986} }
 @article{ozdemir_blumer-schuette_kelly_2012, title={S-Layer Homology Domain Proteins Csac_0678 and Csac_2722 Are Implicated in Plant Polysaccharide Deconstruction by the Extremely Thermophilic Bacterium Caldicellulosiruptor saccharolyticus}, volume={78}, ISSN={["1098-5336"]}, DOI={10.1128/aem.07031-11}, abstractNote={ABSTRACT The genus Caldicellulosiruptor contains extremely thermophilic bacteria that grow on plant polysaccharides. The genomes of Caldicellulosiruptor species reveal certain surface layer homology (SLH) domain proteins that have distinguishing features, pointing to a role in lignocellulose deconstruction. Two of these proteins in Caldicellulosiruptor saccharolyticus (Csac_0678 and Csac_2722) were examined from this perspective. In addition to three contiguous SLH domains, the Csac_0678 gene encodes a glycoside hydrolase family 5 (GH5) catalytic domain and a family 28 carbohydrate-binding module (CBM); orthologs to Csac_0678 could be identified in all genome-sequenced Caldicellulosiruptor species. Recombinant Csac_0678 was optimally active at 75°C and pH 5.0, exhibiting both endoglucanase and xylanase activities. SLH domain removal did not impact Csac_0678 GH activity, but deletion of the CBM28 domain eliminated binding to crystalline cellulose and rendered the enzyme inactive on this substrate. Csac_2722 is the largest open reading frame (ORF) in the C. saccharolyticus genome (predicted molecular mass of 286,516 kDa) and contains two putative sugar-binding domains, two Big4 domains (bacterial domains with an immunoglobulin [Ig]-like fold), and a cadherin-like (Cd) domain. Recombinant Csac_2722, lacking the SLH and Cd domains, bound to cellulose and had detectable carboxymethylcellulose (CMC) hydrolytic activity. Antibodies directed against Csac_0678 and Csac_2722 confirmed that these proteins bound to the C. saccharolyticus S-layer. Their cellular localization and functional biochemical properties indicate roles for Csac_0678 and Csac_2722 in recruitment and hydrolysis of complex polysaccharides and the deconstruction of lignocellulosic biomass. Furthermore, these results suggest that related SLH domain proteins in other Caldicellulosiruptor genomes may also be important contributors to plant biomass utilization.}, number={3}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Ozdemir, Inci and Blumer-Schuette, Sara E. and Kelly, Robert M.}, year={2012}, month={Feb}, pages={768–777} }
 @article{mukherjee_wheaton_blum_kelly_2012, title={Uranium extremophily is an adaptive, rather than intrinsic, feature for extremely thermoacidophilic Metallosphaera species}, volume={109}, ISSN={["0027-8424"]}, DOI={10.1073/pnas.1210904109}, abstractNote={Thermoacidophilic archaea are found in heavy metal-rich environments, and, in some cases, these microorganisms are causative agents of metal mobilization through cellular processes related to their bioenergetics. Given the nature of their habitats, these microorganisms must deal with the potentially toxic effect of heavy metals. Here, we show that two thermoacidophilic Metallosphaera species with nearly identical (99.99%) genomes differed significantly in their sensitivity and reactivity to uranium (U). Metallosphaera prunae , isolated from a smoldering heap on a uranium mine in Thüringen, Germany, could be viewed as a “spontaneous mutant” of Metallosphaera sedula , an isolate from Pisciarelli Solfatara near Naples. Metallosphaera prunae tolerated triuranium octaoxide (U 3 O 8 ) and soluble uranium [U(VI)] to a much greater extent than M. sedula . Within 15 min following exposure to “U(VI) shock,” M. sedula , and not M. prunae , exhibited transcriptomic features associated with severe stress response. Furthermore, within 15 min post-U(VI) shock, M. prunae , and not M. sedula , showed evidence of substantial degradation of cellular RNA, suggesting that transcriptional and translational processes were aborted as a dynamic mechanism for resisting U toxicity; by 60 min post-U(VI) shock, RNA integrity in M. prunae recovered, and known modes for heavy metal resistance were activated. In addition, M. sedula rapidly oxidized solid U 3 O 8 to soluble U(VI) for bioenergetic purposes, a chemolithoautotrophic feature not previously reported. M. prunae , however, did not solubilize solid U 3 O 8 to any significant extent, thereby not exacerbating U(VI) toxicity. These results point to uranium extremophily as an adaptive, rather than intrinsic, feature for Metallosphaera species, driven by environmental factors.}, number={41}, journal={PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA}, author={Mukherjee, Arpan and Wheaton, Garrett H. and Blum, Paul H. and Kelly, Robert M.}, year={2012}, month={Oct}, pages={16702–16707} }
 @article{cobucci-ponzano_zorzetti_strazzulli_carillo_bedini_corsaro_comfort_kelly_rossi_moracci_2011, title={A novel alpha-d-galactosynthase from Thermotoga maritima converts beta-d-galactopyranosyl azide to alpha-galacto-oligosaccharides}, volume={21}, ISSN={["1460-2423"]}, DOI={10.1093/glycob/cwq177}, abstractNote={The large-scale production of oligosaccharides is a daunting task, hampering the study of the role of glycans in vivo and the testing of the efficacy of novel glycan-based drugs. Glycosynthases, mutated glycosidases that synthesize oligosaccharides in high yields, are becoming important chemo-enzymatic tools for the production of oligosaccharides. However, while β-glycosynthase can be produced with a rather well-established technology, examples of α-glycosynthases are thus far limited only to enzymes from glycoside hydrolase 29 (GH29), GH31 and GH95 families. α-L-Fucosynthases from GH29 use convenient glycosyl azide derivatives as a strategic alternative to glycosyl fluoride donors. However, the general applicability of this method to other α-glycosynthases is not trivial and remains to be confirmed. Here, β-D-galactopyranosyl azide was converted to α-galacto-oligosaccharides with good yields and high regioselectivity, catalyzed by a novel α-galactosynthase based on the GH36 α-galactosidase from the hyperthermophilic bacterium Thermotoga maritima. These results open a new avenue to the practical synthesis of biologically interesting α-galacto-oligosaccharides and demonstrate more widespread use of β-glycosyl-azide as donors, confirming their utility to expand the repertoire of glycosynthases.}, number={4}, journal={GLYCOBIOLOGY}, author={Cobucci-Ponzano, Beatrice and Zorzetti, Carmela and Strazzulli, Andrea and Carillo, Sara and Bedini, Emiliano and Corsaro, Maria Michela and Comfort, Donald A. and Kelly, Robert M. and Rossi, Mose and Moracci, Marco}, year={2011}, month={Apr}, pages={448–456} }
 @article{blumer-schuette_ozdemir_mistry_lucas_lapidus_cheng_goodwin_pitluck_land_hauser_et al._2011, title={Complete Genome Sequences for the Anaerobic, Extremely Thermophilic Plant Biomass-Degrading Bacteria
            Caldicellulosiruptor hydrothermalis
            ,
            Caldicellulosiruptor kristjanssonii
            ,
            Caldicellulosiruptor kronotskyensis
            ,
            Caldicellulosiruptor owensensis
            , and
            Caldicellulosiruptor lactoaceticus}, volume={193}, ISSN={0021-9193 1098-5530}, url={http://dx.doi.org/10.1128/jb.01515-10}, DOI={10.1128/jb.01515-10}, abstractNote={ABSTRACT The genus Caldicellulosiruptor contains the most thermophilic, plant biomass-degrading bacteria isolated to date. Previously, genome sequences from three cellulolytic members of this genus were reported ( C. saccharolyticus , C. bescii , and C. obsidiansis ). To further explore the physiological and biochemical basis for polysaccharide degradation within this genus, five additional genomes were sequenced: C. hydrothermalis , C. kristjanssonii , C. kronotskyensis , C. lactoaceticus , and C. owensensis . Taken together, the seven completed and one draft-phase Caldicellulosiruptor genomes suggest that, while central metabolism is highly conserved, significant differences in glycoside hydrolase inventories and numbers of carbohydrate transporters exist, a finding which likely relates to variability observed in plant biomass degradation capacity.}, number={6}, journal={Journal of Bacteriology}, publisher={American Society for Microbiology}, author={Blumer-Schuette, Sara E. and Ozdemir, Inci and Mistry, Dhaval and Lucas, Susan and Lapidus, Alla and Cheng, Jan-Fang and Goodwin, Lynne A. and Pitluck, Samuel and Land, Miriam L. and Hauser, Loren J. and et al.}, year={2011}, month={Mar}, pages={1483–1484} }
 @article{hawkins_han_lian_loder_menon_iwuchukwu_keller_leuko_adams_kelly_2011, title={Extremely Thermophilic Routes to Microbial Electrofuels}, volume={1}, ISSN={["2155-5435"]}, DOI={10.1021/cs2003017}, abstractNote={ADVERTISEMENT RETURN TO ISSUEPREVViewpointNEXTExtremely Thermophilic Routes to Microbial ElectrofuelsAaron S. Hawkins†, Yejun Han†, Hong Lian†, Andrew J. Loder†, Angeli L. Menon‡, Ifeyinwa J. Iwuchukwu‡, Matthew Keller‡, Therese T. Leuko‡, Michael W.W. Adams‡, and Robert M. Kelly*†View Author Information† Department of Chemical and Biomolecular Engineering, North Carolina State University, Raleigh, North Carolina 27695-7905, United States‡ Department of Biochemistry and Molecular Biology, University of Georgia, Athens, Georgia 30602, United StatesPhone: (919) 515-6396. Fax: (919) 515-3465. E-mail: [email protected]Cite this: ACS Catal. 2011, 1, 9, 1043–1050Publication Date (Web):August 1, 2011Publication History Received7 June 2011Published online8 August 2011Published inissue 2 September 2011https://doi.org/10.1021/cs2003017Copyright © 2011 American Chemical SocietyRIGHTS & PERMISSIONSArticle Views2550Altmetric-Citations34LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (3 MB) Get e-AlertsSUBJECTS:Bacteria,Genetics,Hydrogen,Oxides,Peptides and proteins Get e-Alerts}, number={9}, journal={ACS CATALYSIS}, author={Hawkins, Aaron S. and Han, Yejun and Lian, Hong and Loder, Andrew J. and Menon, Angeli L. and Iwuchukwu, Ifeyinwa J. and Keller, Matthew and Leuko, Therese T. and Adams, Michael W. W. and Kelly, Robert M.}, year={2011}, month={Sep}, pages={1043–1050} }
 @article{vanfossen_ozdemir_zelin_kelly_2011, title={Glycoside Hydrolase Inventory Drives Plant Polysaccharide Deconstruction by the Extremely Thermophilic Bacterium Caldicellulosiruptor saccharolyticus}, volume={108}, ISSN={["1097-0290"]}, DOI={10.1002/bit.23093}, abstractNote={The genome of Caldicellulosiruptor saccharolyticus encodes a range of glycoside hydrolases (GHs) that mediate plant biomass deconstruction by this bacterium. Two GH-based genomic loci that appear to be central to the hydrolysis of hemicellulosic and cellulosic substrates were examined. XynB-XynF (Csac_2404-Csac_2411) encodes intracellular and extracellular GHs that are active towards xylan and xylan side-chains, as well as carboxymethyl cellulose (CMC). XynD (Csac_2409) and XynE (Csac_2410) were produced recombinantly and confirmed to be xylanases. XynF (Csac_2411) was produced in two separate polypeptides, each with one GH43 catalytic domain displaying α-L-arabinofuranosidase activity. CelA-ManB (Csac_1076-Csac_1080) encodes four multi-domain, extracellular GHs, including CelB (Csac_1078), a 118 kDa extracellular enzyme not present in the other genome-sequenced member of this genus, Caldicellulosiruptor bescii (formerly Anaerocellum thermophilum). CelB contains both GH10 and GH5 domains, separated by a family 3 carbohydrate-binding module (CBM3). CelB encoded in Csac_1078 differed from the version originally reported (Saul et al., 1990, Appl Environ Microbiol 56:3117–3124) with respect to linker regions. CelB hydrolyzed xylan and CMC, as well as barley β-glucan, glucomannan, and arabinoxylan. For all substrates tested, intact CelB was significantly more active than either the individual GH5 and GH10 domains or the two discrete domains together, indicating that the multi-domain architecture is essential for complex carbohydrate hydrolysis. Transcriptomes for C. saccharolyticus grown at 70°C on glucose, xylose, xyloglucan, switchgrass, and poplar revealed that certain GHs were particularly responsive to growth on switchgrass and poplar and that CelB was in the top decile of all transcripts during growth on the plant biomass. Biotechnol. Bioeng. 2011; 108:1559–1569. © 2011 Wiley Periodicals, Inc.}, number={7}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={VanFossen, Amy L. and Ozdemir, Inci and Zelin, Samantha L. and Kelly, Robert M.}, year={2011}, month={Jul}, pages={1559–1569} }
 @article{dam_kataeva_yang_zhou_yin_chou_poole_westpheling_hettich_giannone_et al._2011, title={Insights into plant biomass conversion from the genome of the anaerobic thermophilic bacterium Caldicellulosiruptor bescii DSM 6725}, volume={39}, ISSN={["1362-4962"]}, DOI={10.1093/nar/gkq1281}, abstractNote={Caldicellulosiruptor bescii DSM 6725 utilizes various polysaccharides and grows efficiently on untreated high-lignin grasses and hardwood at an optimum temperature of ∼80°C. It is a promising anaerobic bacterium for studying high-temperature biomass conversion. Its genome contains 2666 protein-coding sequences organized into 1209 operons. Expression of 2196 genes (83%) was confirmed experimentally. At least 322 genes appear to have been obtained by lateral gene transfer (LGT). Putative functions were assigned to 364 conserved/hypothetical protein (C/HP) genes. The genome contains 171 and 88 genes related to carbohydrate transport and utilization, respectively. Growth on cellulose led to the up-regulation of 32 carbohydrate-active (CAZy), 61 sugar transport, 25 transcription factor and 234 C/HP genes. Some C/HPs were overproduced on cellulose or xylan, suggesting their involvement in polysaccharide conversion. A unique feature of the genome is enrichment with genes encoding multi-modular, multi-functional CAZy proteins organized into one large cluster, the products of which are proposed to act synergistically on different components of plant cell walls and to aid the ability of C. bescii to convert plant biomass. The high duplication of CAZy domains coupled with the ability to acquire foreign genes by LGT may have allowed the bacterium to rapidly adapt to changing plant biomass-rich environments.}, number={8}, journal={NUCLEIC ACIDS RESEARCH}, author={Dam, Phuongan and Kataeva, Irina and Yang, Sung-Jae and Zhou, Fengfeng and Yin, Yanbin and Chou, Wenchi and Poole, Farris L., II and Westpheling, Janet and Hettich, Robert and Giannone, Richard and et al.}, year={2011}, month={Apr}, pages={3240–3254} }
 @article{santa-maria_yencho_haigler_thompson_kelly_sosinski_2011, title={Starch Self-Processing in Transgenic Sweet Potato Roots Expressing a Hyperthermophilic alpha-Amylase}, volume={27}, ISSN={["1520-6033"]}, url={http://europepmc.org/abstract/med/21365786}, DOI={10.1002/btpr.573}, abstractNote={Sweet potato is a major crop in the southeastern United States, which requires few inputs and grows well on marginal land. It accumulates large quantities of starch in the storage roots and has been shown to give comparable or superior ethanol yields to corn per cultivated acre in the southeast. Starch conversion to fermentable sugars (i.e., for ethanol production) is carried out at high temperatures and requires the action of thermostable and thermoactive amylolytic enzymes. These enzymes are added to the starch mixture impacting overall process economics. To address this shortcoming, the gene encoding a hyperthermophilic α-amylase from Thermotoga maritima was cloned and expressed in transgenic sweet potato, generated by Agrobacterium tumefaciens-mediated transformation, to create a plant with the ability to self-process starch. No significant enzyme activity could be detected below 40°C, but starch in the transgenic sweet potato storage roots was readily hydrolyzed at 80°C. The transgene did not affect normal storage root formation. The results presented here demonstrate that engineering plants with hyperthermophilic glycoside hydrolases can facilitate cost effective starch conversion to fermentable sugars. Furthermore, the use of sweet potato as an alternative near-term energy crop should be considered. © 2011 American Institute of Chemical Engineers Biotechnol. Prog., 2011}, number={2}, journal={BIOTECHNOLOGY PROGRESS}, author={Santa-Maria, Monica C. and Yencho, Craig G. and Haigler, Candace H. and Thompson, William F. and Kelly, Robert M. and Sosinski, Bryon}, year={2011}, pages={351–359} }
 @article{maezato_daugherty_dana_soo_cooper_tachdjian_kelly_blum_2011, title={VapC6, a ribonucleolytic toxin regulates thermophilicity in the crenarchaeote Sulfolobus solfataricus}, volume={17}, ISSN={["1469-9001"]}, DOI={10.1261/rna.2679911}, abstractNote={The phylum Crenarchaeota includes hyperthermophilic micro-organisms subjected to dynamic thermal conditions. Previous transcriptomic studies of Sulfolobus solfataricus identified vapBC6 as a heat-shock (HS)-inducible member of the Vap toxin–antitoxin gene family. In this study, the inactivation of the vapBC6 operon by targeted gene disruption produced two recessive phenotypes related to fitness, HS sensitivity and a heat-dependent reduction in the rate of growth. In-frame vapBC6 deletion mutants were analyzed to examine the respective roles of each protein. Since vapB6 transcript abundance was elevated in the vapC6 deletion, the VapC6 toxin appears to regulate abundance of its cognate antitoxin. In contrast, vapC6 transcript abundance was reduced in the vapB6 deletion. A putative intergenic terminator may underlie these observations by coordinating vapBC6 expression. As predicted by structural modeling, recombinant VapC6 produced using chaperone cosynthesis exhibited heat-dependent ribonucleolytic activity toward S. solfataricus total RNA. This activity could be blocked by addition of preheated recombinant VapB6. In vivo transcript targets were identified by assessing the relative expression of genes that naturally respond to thermal stress in VapBC6-deficient cells. Preferential increases were observed for dppB-1 and tetR , and preferential decreases were observed for rpoD and eIF2 gamma . Specific VapC6 ribonucleolytic action could also be demonstrated in vitro toward RNAs whose expression increased in the VapBC6-deficient strain during heat shock. These findings provide a biochemical mechanism and identify cellular targets underlying VapBC6-mediated control over microbial growth and survival at temperature extremes.}, number={7}, journal={RNA}, author={Maezato, Yukari and Daugherty, Amanda and Dana, Karl and Soo, Edith and Cooper, Charlotte and Tachdjian, Sabrina and Kelly, Robert M. and Blum, Paul}, year={2011}, month={Jul}, pages={1381–1392} }
 @inbook{harris_adams_kelly_2010, place={Hoboken, New Jersey}, title={Enzymes, Extremely Thermophilic}, ISBN={9780471799306 9780470054581}, url={http://dx.doi.org/10.1002/9780470054581.eib308}, DOI={10.1002/9780470054581.eib308}, abstractNote={The availability of enzymes with optimal functional temperatures above 70°C has had considerable impact on basic and applied elements of biocatalysis. Not only have extremely thermophilic enzymes expanded the known thermal range of biological systems but they have also ushered in a new era in applied biocatalysis that is less restricted by limitations related to thermoactivity and thermostability. While much effort has been directed at understanding the intrinsic basis for enzyme stabilization at high temperatures, there is still much to be learned to appreciate this complex biomolecular trait. Nonetheless, strategic uses of extremely thermophilic enzymes continue to emerge and prospects for expanded use of biocatalysts in a variety of bioprocess settings are promising. As genome sequence information from extremely thermophilic microorganisms is mined for novel biocatalysts and molecular biological tools for improving enzyme function are refined, the future is bright for biologically based catalysis.


Keywords:

thermophilic enzymes;
biocatalysis;
thermostable;
thermolabile;
proteases}, booktitle={Encyclopedia of Industrial Biotechnology}, publisher={John Wiley & Sons, Inc.}, author={Harris, James M. and Adams, Michael and Kelly, Robert M.}, editor={Flickinger, Michael C.Editor}, year={2010}, month={Apr} }
 @inbook{gray_adams_kelly_2010, place={NY}, edition={2nd}, title={Extremely thermophilic microorganisms}, volume={5}, booktitle={Encyclopedia of Industrial Biotechnology: Bioprocess, Bioseparation, and Cell Technology}, publisher={John Wiley and Sons}, author={Gray, S.R. and Adams, M.W.W. and Kelly, R.M.}, editor={Flickinger, M.C.Editor}, year={2010}, pages={3481–3499} }
 @misc{ozdemir_kelly_2010, place={Hoboken, NJ}, title={Extremophiles}, volume={3}, ISBN={0471227617 9780471227618}, url={http://dx.doi.org/10.1002/0471227617.eoc089.pub2}, DOI={10.1002/0471227617.eoc089.pub2}, abstractNote={Extremophiles are microorganisms with the ability to survive under extreme environmental conditions, including geothermal and arctic waters, glacial ices, deserts, saline lakes, and acidic, sulfurous hot springs. Adaptation of extremophiles to harsh conditions and unique stability of the enzymes (extremozymes) from these organisms have recently attracted a great deal of attention. Extremozymes have been replacing enzymes, which do not cope with harsh conditions, in many industries, such as pharmaceutical, food, chemical, laundry detergents, and bioremediation. Furthermore, there is an increasing demand of novel applications of these biocatalysts, working optimally over a range of extreme conditions, such as high temperature, high salinity, and high alkalinity. Developments in gene discovery and gene expression technologies hopefully will expand the exploitation of these biocatalysts. In this study, different types of extremophiles are introduced and the adaptations to extreme conditions for each condition are pointed. The biocatalysts from overlooked extremophiles and the applications of these biocatalysts are highlighted.}, journal={Encyclopedia of Catalysis}, publisher={John Wiley & Sons, Inc.}, author={Ozdemir, Inci and Kelly, Robert M.}, editor={Horváth, I.T.Editor}, year={2010}, month={Sep} }
 @article{auernik_kelly_2010, title={Impact of Molecular Hydrogen on Chalcopyrite Bioleaching by the Extremely Thermoacidophilic Archaeon Metallosphaera sedula}, volume={76}, ISSN={["1098-5336"]}, DOI={10.1128/aem.02016-09}, abstractNote={ABSTRACT Hydrogen served as a competitive inorganic energy source, impacting the CuFeS 2 bioleaching efficiency of the extremely thermoacidophilic archaeon Metallosphaera sedula . Open reading frames encoding key terminal oxidase and electron transport chain components were triggered by CuFeS 2 . Evidence of heterotrophic metabolism was noted after extended periods of bioleaching, presumably related to cell lysis.}, number={8}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Auernik, Kathryne S. and Kelly, Robert M.}, year={2010}, month={Apr}, pages={2668–2672} }
 @article{harris_epting_kelly_2010, title={N-terminal Fusion of a Hyperthermophilic Chitin-Binding Domain to Xylose Isomerase from Thermotoga neapolitana Enhances Kinetics and Thermostability of Both Free and Immobilized Enzymes}, volume={26}, ISSN={["1520-6033"]}, DOI={10.1002/btpr.416}, abstractNote={Immobilization of a thermostable D-xylose isomerase (EC 5.3.1.5) from Thermotoga neapolitana 5068 (TNXI) on chitin beads was accomplished via a N-terminal fusion with a chitin-binding domain (CBD) from a hyperthermophilic chitinase produced by Pyrococcus furiosus (PF1233) to create a fusion protein (CBD-TNXI). The turnover numbers for glucose to fructose conversion for both unbound and immobilized CBD-TNXI were greater than the wild-type enzyme: kcat (min−1) was ∼1,000, 3,800, and 5,800 at 80°C compared to 1,140, 10,350, and 7,000 at 90°C, for the wild-type, unbound, and immobilized enzymes, respectively. These kcat values for the glucose to fructose isomerization measured are the highest reported to date for any XI at any temperature. Enzyme kinetic inactivation at 100°C, as determined from a bi-phasic inactivation model, showed that the CBD-TNXI bound to chitin had a half-life approximately three times longer than the soluble wild-type TNXI (19.9 hours vs. 6.8 hours, respectively). Surprisingly, the unbound soluble CBD-TNXI had a significantly longer half-life (56.5 hours) than the immobilized enzyme. Molecular modeling results suggest that the N-terminal fusion impacted subunit interactions, thereby contributing to the enhanced thermostability of both the unbound and immobilized CBD-TNXI. These interactions likely also played a role in modifying active site structure, thereby diminishing substrate-binding affinities and generating higher turnover rates in the unbound fusion protein. © 2010 American Institute of Chemical Engineers Biotechnol. Prog., 2010}, number={4}, journal={BIOTECHNOLOGY PROGRESS}, author={Harris, James M. and Epting, Kevin L. and Kelly, Robert M.}, year={2010}, pages={993–1000} }
 @article{muddiman_andrews_lewis_notey_kelly_2010, title={Part I: characterization of the extracellular proteome of the extreme thermophile Caldicellulosiruptor saccharolyticus by GeLC-MS2}, volume={398}, ISSN={["1618-2650"]}, DOI={10.1007/s00216-010-3955-6}, number={1}, journal={ANALYTICAL AND BIOANALYTICAL CHEMISTRY}, author={Muddiman, David and Andrews, Genna and Lewis, Derrick and Notey, Jaspreet and Kelly, Robert}, year={2010}, month={Sep}, pages={377–389} }
 @article{andrews_lewis_notey_kelly_muddiman_2010, title={Part I: characterization of the extracellular proteome of the extreme thermophile Caldicellulosiruptor saccharolyticus by GeLC-MS2 (vol 398, pg 377, 2010)}, volume={398}, ISSN={["1618-2650"]}, DOI={10.1007/s00216-010-4102-0}, number={4}, journal={ANALYTICAL AND BIOANALYTICAL CHEMISTRY}, author={Andrews, Genna and Lewis, Derrick and Notey, Jaspreet and Kelly, Robert and Muddiman, David}, year={2010}, month={Oct}, pages={1837–1837} }
 @article{muddiman_andrews_lewis_notey_kelly_2010, title={Part II: defining and quantifying individual and co-cultured intracellular proteomes of two thermophilic microorganisms by GeLC-MS2 and spectral counting}, volume={398}, ISSN={["1618-2642"]}, DOI={10.1007/s00216-010-3929-8}, abstractNote={Probing the intracellular proteome of Thermotoga maritima and Caldicellulosiruptor saccharolyticus in pure and co-culture affords a global investigation into the machinery and mechanisms enduring inside the bacterial thermophilic cell at the time of harvest. The second of a two part study, employing GeLC-MS2 a variety of proteins were confidently identified with <1% false discovery rate, and spectral counts for label-free relative quantification afforded indication of the dynamic proteome as a function of environmental stimuli. Almost 25% of the T. maritima proteome and 10% of the C. saccharolyticus proteome were identified. Through comparison of growth temperatures for T. maritima, a protein associated with chemotaxis was uniquely present in the sample cultivated at the non-optimal growth temperature. It is suspected that movement was induced due to the non-optimal condition as the organism may need to migrate in the culture to locate more nutrients. The inventory of C. saccharolyticus proteins identified in these studies and attributed to spectral counting, demonstrated that two CRISPR-associated proteins had increased expression in the pure culture versus the co-culture. Further focusing on this relationship, a C. saccharolyticus phage-shock protein was identified in the co-culture expanding a scenario that the co-culture had decreased antiviral resistance and accordingly an infection-related protein was present. Alterations in growth conditions of these bacterial thermophilic microorganisms offer a glimpse into the intricacy of microbial behavior and interaction.}, number={1}, journal={ANALYTICAL AND BIOANALYTICAL CHEMISTRY}, author={Muddiman, David and Andrews, Genna and Lewis, Derrick and Notey, Jaspreet and Kelly, Robert}, year={2010}, month={Sep}, pages={391–404} }
 @article{andrews_lewis_notey_kelly_muddiman_2010, title={Part II: defining and quantifying individual and co-cultured intracellular proteomes of two thermophilic microorganisms by GeLC-MS2 and spectral counting (vol 398, pg 391, 2010)}, volume={398}, ISSN={["1618-2650"]}, DOI={10.1007/s00216-010-4050-8}, number={4}, journal={ANALYTICAL AND BIOANALYTICAL CHEMISTRY}, author={Andrews, Genna and Lewis, Derrick and Notey, Jaspreet and Kelly, Robert and Muddiman, David}, year={2010}, month={Oct}, pages={1839–1839} }
 @article{blumer-schuette_lewis_kelly_2010, title={Phylogenetic, Microbiological, and Glycoside Hydrolase Diversities within the Extremely Thermophilic, Plant Biomass-Degrading Genus Caldicellulosiruptor}, volume={76}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01400-10}, abstractNote={ABSTRACT Phylogenetic, microbiological, and comparative genomic analyses were used to examine the diversity among members of the genus Caldicellulosiruptor , with an eye toward the capacity of these extremely thermophilic bacteria to degrade the complex carbohydrate content of plant biomass. Seven species from this genus ( C. saccharolyticus , C. bescii , C. hydrothermalis , C. owensensis , C. kronotskyensis , C. lactoaceticus , and C. kristjanssonii ) were compared on the basis of 16S rRNA gene phylogeny and cross-species DNA-DNA hybridization to a whole-genome C. saccharolyticus oligonucleotide microarray, revealing that C. saccharolyticus was the most divergent within this group. Growth physiology of the seven Caldicellulosiruptor species on a range of carbohydrates showed that, while all could be cultivated on acid-pretreated switchgrass, only C. saccharolyticus , C. bescii , C. kronotskyensis , and C. lactoaceticus were capable of hydrolyzing Whatman no. 1 filter paper. Two-dimensional gel electrophoresis of the secretomes from cells grown on microcrystalline cellulose revealed that the cellulolytic species also had diverse secretome fingerprints. The C. saccharolyticus secretome contained a prominent S-layer protein that appears in the cellulolytic Caldicellulosiruptor species, suggesting a possible role in cell-substrate interactions. Growth physiology also correlated with glycoside hydrolase (GH) and carbohydrate-binding module (CBM) inventories for the seven bacteria, as deduced from draft genome sequence information. These inventories indicated that the absence of a single GH and CBM family was responsible for diminished cellulolytic capacity. Overall, the genus Caldicellulosiruptor appears to contain more genomic and physiological diversity than previously reported, and this argues for continued efforts to isolate new members from high-temperature terrestrial biotopes.}, number={24}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Blumer-Schuette, Sara E. and Lewis, Derrick L. and Kelly, Robert M.}, year={2010}, month={Dec}, pages={8084–8092} }
 @article{auernik_kelly_2010, title={Physiological Versatility of the Extremely Thermoacidophilic Archaeon Metallosphaera sedula Supported by Transcriptomic Analysis of Heterotrophic, Autotrophic, and Mixotrophic Growth}, volume={76}, ISSN={["1098-5336"]}, DOI={10.1128/aem.01336-09}, abstractNote={ABSTRACT Comparative transcriptomic analysis of autotrophic, heterotrophic, and mixotrophic growth of the archaeon Metallosphaera sedula (70°C, pH 2.0) revealed candidates for yet-to-be-confirmed components of the 3-hydroxypropionate/4-hydroxybutyrate pathway and implicated a membrane-bound hydrogenase (Msed_0944-Msed_0946) for growth on H 2 . Routes for generation of ATP and reducing equivalents were also identified.}, number={3}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Auernik, Kathryne S. and Kelly, Robert M.}, year={2010}, month={Feb}, pages={931–935} }
 @article{frock_notey_kelly_2010, title={The genus Thermotoga: recent developments}, volume={31}, ISSN={["1479-487X"]}, DOI={10.1080/09593330.2010.484076}, abstractNote={The genus Thermotoga comprises extremely thermophilic (Topt > or = 70 degrees C) and hyperthermophilic (Topt > or = 80 degrees C) bacteria, which have been extensively studied for insights into the basis for life at elevated temperatures and for biotechnological opportunities (e.g. biohydrogen production, biocatalysis). Over the past decade, genome sequences have become available for a number of Thermotoga species, leading to functional genomics efforts to understand growth physiology as well as genomics-based identification and characterization of novel high-temperature biocatalysts. Discussed here are recent developments along these lines for this group of microorganisms.}, number={10}, journal={ENVIRONMENTAL TECHNOLOGY}, author={Frock, Andrew D. and Notey, Jaspreet S. and Kelly, Robert M.}, year={2010}, pages={1169–1181} }
 @article{vanfossen_verhaart_kengen_kelly_2009, title={Carbohydrate Utilization Patterns for the Extremely Thermophilic Bacterium Caldicellulosiruptor saccharolyticus Reveal Broad Growth Substrate Preferences}, volume={75}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.01959-09}, abstractNote={ABSTRACT Coutilization of hexoses and pentoses derived from lignocellulose is an attractive trait in microorganisms considered for consolidated biomass processing to biofuels. This issue was examined for the H 2 -producing, extremely thermophilic bacterium Caldicellulosiruptor saccharolyticus growing on individual monosaccharides (arabinose, fructose, galactose, glucose, mannose, and xylose), mixtures of these sugars, as well as on xylan and xylogluco-oligosacchrides. C. saccharolyticus grew at approximately the same rate ( t d , ∼95 min) and to the same final cell density (1 × 10 8 to 3 × 10 8 cells/ml) on all sugars and sugar mixtures tested. In the monosaccharide mixture, although simultaneous consumption of all monosaccharides was observed, not all were utilized to the same extent (fructose > xylose/arabinose > mannose/glucose/galactose). Transcriptome contrasts for monosaccharide growth revealed minimal changes in some cases (e.g., 32 open reading frames [ORFs] changed ≥2-fold for glucose versus galactose), while substantial changes occurred for cases involving mannose (e.g., 353 ORFs changed ≥2-fold for glucose versus mannose). Evidence for catabolite repression was not noted for either growth on multisugar mixtures or the corresponding transcriptomes. Based on the whole-genome transcriptional response analysis and comparative genomics, carbohydrate specificities for transport systems could be proposed for most of the 24 putative carbohydrate ATP-binding cassette transporters and single phosphotransferase system identified in C. saccharolyticus . Although most transporter genes responded to individual monosaccharides and polysaccharides, the genes Csac_0692 to Csac_0694 were upregulated only in the monosaccharide mixture. The results presented here affirm the broad growth substrate preferences of C. saccharolyticus on carbohydrates representative of lignocellulosic biomass and suggest that this bacterium holds promise for biofuel applications.}, number={24}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={VanFossen, Amy L. and Verhaart, Marcel R. A. and Kengen, Serve M. W. and Kelly, Robert M.}, year={2009}, month={Dec}, pages={7718–7724} }
 @article{carson_chisnell_kelly_2009, title={Integrating modern biology into the ChE DNA through a campus-wide core laboratory education program}, volume={43}, number={4}, journal={Chemical Engineering Education}, author={Carson, S.E. and Chisnell, J.R. and Kelly, R.M.}, year={2009}, pages={257–264} }
 @article{santa-maria_chou_yencho_haigler_thompson_kelly_sosinski_2009, title={Plant cell calcium-rich environment enhances thermostability of recombinantly produced α-amylase from the hyperthermophilic bacterium Thermotoga maritime}, volume={104}, ISSN={0006-3592 1097-0290}, url={http://dx.doi.org/10.1002/bit.22468}, DOI={10.1002/bit.22468}, abstractNote={In the industrial processing of starch for sugar syrup and ethanol production, a liquefaction step is involved where starch is initially solubilized at high temperature and partially hydrolyzed with a thermostable and thermoactive alpha-amylase. Most amylases require calcium as a cofactor for their activity and stability, therefore calcium, along with the thermostable enzyme, are typically added to the starch mixture during enzymatic liquefaction, thereby increasing process costs. An attractive alternative would be to produce the enzyme directly in the tissue to be treated. In a proof of concept study, tobacco cell cultures were used as model system to test in planta production of a hyperthermophilic alpha-amylase from Thermotoga maritima. While comparable biochemical properties to recombinant production in Escherichia coli were observed, thermostability of the plant-produced alpha-amylase benefited significantly from high intrinsic calcium levels in the tobacco cells. The plant-made enzyme retained 85% of its initial activity after 3 h incubation at 100 degrees C, whereas the E. coli-produced enzyme was completely inactivated after 30 min under the same conditions. The addition of Ca(2+) or plant cell extracts from tobacco and sweetpotato to the E. coli-produced enzyme resulted in a similar stabilization, demonstrating the importance of a calcium-rich environment for thermostability, as well as the advantage of producing this enzyme directly in plant cells where calcium is readily available.}, number={5}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Santa-Maria, Monica C. and Chou, Chung-Jung and Yencho, G. Craig and Haigler, Candace H. and Thompson, William F. and Kelly, Robert M. and Sosinski, Bryon}, year={2009}, month={Dec}, pages={947–956} }
 @article{cooper_daugherty_tachdjian_blum_kelly_2009, title={Role of vapBC toxin–antitoxin loci in the thermal stress response of Sulfolobus solfataricus}, volume={37}, ISSN={0300-5127 1470-8752}, url={http://dx.doi.org/10.1042/BST0370123}, DOI={10.1042/BST0370123}, abstractNote={TA (toxin–antitoxin) loci are ubiquitous in prokaryotic micro-organisms, including archaea, yet their physiological function is largely unknown. For example, preliminary reports have suggested that TA loci are microbial stress-response elements, although it was recently shown that knocking out all known chromosomally located TA loci in Escherichia coli did not have an impact on survival under certain types of stress. The hyperthermophilic crenarchaeon Sulfolobus solfataricus encodes at least 26 vapBC (where vap is virulence-associated protein) family TA loci in its genome. VapCs are PIN (PilT N-terminus) domain proteins with putative ribonuclease activity, while VapBs are proteolytically labile proteins, which purportedly function to silence VapCs when associated as a cognate pair. Global transcriptional analysis of S. solfataricus heat-shock-response dynamics (temperature shift from 80 to 90°C) revealed that several vapBC genes were triggered by the thermal shift, suggesting a role in heat-shock-response. Indeed, knocking out a specific vapBC locus in S. solfataricus substantially changed the transcriptome and, in one case, rendered the crenarchaeon heat-shock-labile. These findings indicate that more work needs to be done to determine the role of VapBCs in S. solfataricus and other thermophilic archaea, especially with respect to post-transcriptional regulation.}, number={1}, journal={Biochemical Society Transactions}, publisher={Portland Press Ltd.}, author={Cooper, Charlotte R. and Daugherty, Amanda J. and Tachdjian, Sabrina and Blum, Paul H. and Kelly, Robert M.}, year={2009}, month={Jan}, pages={123–126} }
 @article{nichols_johnson_chou_kelly_2009, title={Temperature, not LuxS, mediates AI-2 formation in hydrothermal habitats}, volume={68}, ISSN={["1574-6941"]}, DOI={10.1111/j.1574-6941.2009.00662.x}, abstractNote={Quorum sensing provides the basis for coordinating community-wide, microbial behaviors in many mesophilic bacteria. However, little attention has been directed toward the possibility that such phenomena occur in extremely thermal microbial environments. Despite the absence of luxS in hyperthermophile genomes, autoinducer-2 (AI-2), a boronated furanone and proposed 'universal' interspecies mesophilic bacterial communication signal, could be formed by Thermotoga maritima and Pyrococcus furiosus through a combination of biotic and abiotic reaction steps. AI-2 did not, however, induce any detectable quorum-sensing phenotypes in these organisms, although transcriptome-based evidence of an AI-2-induced stress response was observed in T. maritima. The significance, if any, of AI-2 in hydrothermal habitats is not yet clear. Nevertheless, these results show the importance of considering environmental factors, in this case high temperatures, as abiotic causative agents of biochemical and microbiological phenomena.}, number={2}, journal={FEMS MICROBIOLOGY ECOLOGY}, author={Nichols, Jason D. and Johnson, Matthew R. and Chou, Chung-Jung and Kelly, Robert M.}, year={2009}, month={Apr}, pages={173–181} }
 @misc{blumer-schuette_kataeva_westpheling_adams_kelly_2008, title={Extremely thermophilic microorganisms for biomass conversion: status and prospects}, volume={19}, ISSN={["0958-1669"]}, DOI={10.1016/j.copbio.2008.04.007}, abstractNote={Many microorganisms that grow at elevated temperatures are able to utilize a variety of carbohydrates pertinent to the conversion of lignocellulosic biomass to bioenergy. The range of substrates utilized depends on growth temperature optimum and biotope. Hyperthermophilic marine archaea (Topt ≥ 80 °C) utilize α- and β-linked glucans, such as starch, barley glucan, laminarin, and chitin, while hyperthermophilic marine bacteria (Topt ≥ 80 °C) utilize the same glucans as well as hemicellulose, such as xylans and mannans. However, none of these organisms are able to efficiently utilize crystalline cellulose. Among the thermophiles, this ability is limited to a few terrestrial bacteria with upper temperature limits for growth near 75 °C. Deconstruction of crystalline cellulose by these extreme thermophiles is achieved by ‘free’ primary cellulases, which are distinct from those typically associated with large multi-enzyme complexes known as cellulosomes. These primary cellulases also differ from the endoglucanases (referred to here as ‘secondary cellulases’) reported from marine hyperthermophiles that show only weak activity toward cellulose. Many extremely thermophilic enzymes implicated in the deconstruction of lignocellulose can be identified in genome sequences, and many more promising biocatalysts probably remain annotated as ‘hypothetical proteins’. Characterization of these enzymes will require intensive effort but is likely to generate new opportunities for the use of renewable resources as biofuels.}, number={3}, journal={CURRENT OPINION IN BIOTECHNOLOGY}, author={Blumer-Schuette, Sara E. and Kataeva, Irina and Westpheling, Janet and Adams, Michael W. W. and Kelly, Robert M.}, year={2008}, month={Jun}, pages={210–217} }
 @inbook{tachdjian_shockley_conners_kelly_2008, place={Norfolk, UK}, title={Functional Genomics of Stress Response in Extremophilic Archaea}, ISBN={9781904455271 9781910190982}, booktitle={Archaea: New Models for Prokaryotic Biology}, publisher={Caister Academic Press}, author={Tachdjian, S. and Shockley, K.R. and Conners, S.B. and Kelly, R.M.}, editor={Blum, P.Editor}, year={2008} }
 @article{comfort_chou_conners_vanfossen_kelly_2008, title={Functional-genomics-based identification and characterization of open reading frames encoding alpha-glucoside-processing enzymes in the hyperthermophilic archaeon Pyrococcus furiosus}, volume={74}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.01920-07}, abstractNote={ABSTRACT Bioinformatics analysis and transcriptional response information for Pyrococcus furiosus grown on α-glucans led to the identification of a novel isomaltase (PF0132) representing a new glycoside hydrolase (GH) family, a novel GH57 β-amylase (PF0870), and an extracellular starch-binding protein (1,141 amino acids; PF1109-PF1110), in addition to several other putative α-glucan-processing enzymes.}, number={4}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Comfort, Donald A. and Chou, Chung-Jung and Conners, Shannon B. and VanFossen, Amy L. and Kelly, Robert M.}, year={2008}, month={Feb}, pages={1281–1283} }
 @misc{chou_jenney_adams_kelly_2008, title={Hydrogenesis in hyperthermophilic microorganisms: Implications for biofuels}, volume={10}, ISSN={["1096-7184"]}, DOI={10.1016/j.ymben.2008.06.007}, abstractNote={Hydrothermal microbiotopes are characterized by the consumption and production of molecular hydrogen. Heterotrophic hyperthermophilic microorganisms (growth T(opt)> or =80 degrees C) actively participate in the production of H(2) in these environments through the fermentation of peptides and carbohydrates. Hyperthermophiles have been shown to approach the theoretical (Thauer) limit of 4 mol of H(2) produced per mole of glucose equivalent consumed, albeit at lower volumetric productivities than observed for mesophilic bacteria, especially enterics and clostridia. Potential advantages for biohydrogen production at elevated temperatures include fewer metabolic byproducts formed, absence of catabolic repression for growth on heterogeneous biomass substrates, and reduced loss of H(2) through conversion to H(2)S and CH(4) by mesophilic consortia containing sulfate reducers and methanogens. To fully exploit the use of these novel microorganisms and their constituent hydrogenases for biohydrogen production, development of versatile genetic systems and improvements in current understanding of electron flux from fermentable substrates to H(2) in hyperthermophiles are needed.}, number={6}, journal={METABOLIC ENGINEERING}, author={Chou, Chung-Jung and Jenney, Francis E., Jr. and Adams, Michael W. W. and Kelly, Robert M.}, year={2008}, month={Nov}, pages={394–404} }
 @article{werken_verhaart_vanfossen_willquist_lewis_nichols_goorissen_mongodin_nelson_niel_et al._2008, title={Hydrogenomics of the Extremely Thermophilic Bacterium Caldicellulosiruptor saccharolyticus}, volume={74}, ISSN={["0099-2240"]}, DOI={10.1128/AEM.00968-08}, abstractNote={Caldicellulosiruptor saccharolyticus is an extremely thermophilic, gram-positive anaerobe which ferments cellulose-, hemicellulose- and pectin-containing biomass to acetate, CO(2), and hydrogen. Its broad substrate range, high hydrogen-producing capacity, and ability to coutilize glucose and xylose make this bacterium an attractive candidate for microbial bioenergy production. Here, the complete genome sequence of C. saccharolyticus, consisting of a 2,970,275-bp circular chromosome encoding 2,679 predicted proteins, is described. Analysis of the genome revealed that C. saccharolyticus has an extensive polysaccharide-hydrolyzing capacity for cellulose, hemicellulose, pectin, and starch, coupled to a large number of ABC transporters for monomeric and oligomeric sugar uptake. The components of the Embden-Meyerhof and nonoxidative pentose phosphate pathways are all present; however, there is no evidence that an Entner-Doudoroff pathway is present. Catabolic pathways for a range of sugars, including rhamnose, fucose, arabinose, glucuronate, fructose, and galactose, were identified. These pathways lead to the production of NADH and reduced ferredoxin. NADH and reduced ferredoxin are subsequently used by two distinct hydrogenases to generate hydrogen. Whole-genome transcriptome analysis revealed that there is significant upregulation of the glycolytic pathway and an ABC-type sugar transporter during growth on glucose and xylose, indicating that C. saccharolyticus coferments these sugars unimpeded by glucose-based catabolite repression. The capacity to simultaneously process and utilize a range of carbohydrates associated with biomass feedstocks is a highly desirable feature of this lignocellulose-utilizing, biofuel-producing bacterium.}, number={21}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Werken, Harmen J. G. and Verhaart, Marcel R. A. and VanFossen, Amy L. and Willquist, Karin and Lewis, Derrick L. and Nichols, Jason D. and Goorissen, Heleen P. and Mongodin, Emmanuel F. and Nelson, Karen E. and Niel, Ed W. J. and et al.}, year={2008}, month={Nov}, pages={6720–6729} }
 @article{auernik_kelly_2008, title={Identification of Components of Electron Transport Chains in the Extremely Thermoacidophilic Crenarchaeon Metallosphaera sedula through Iron and Sulfur Compound Oxidation Transcriptomes}, volume={74}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.01545-08}, abstractNote={ABSTRACT The crenarchaeal order Sulfolobales collectively contain at least five major terminal oxidase complexes. Based on genome sequence information, all five complexes are found only in Metallosphaera sedula and Sulfolobus tokodaii , the two sequenced Sulfolobales capable of iron oxidization. While specific respiratory complexes in certain Sulfolobales have been characterized previously as proton pumps for maintaining intracellular pH and generating proton motive force, their contribution to sulfur and iron biooxidation has not been considered. For M. sedula growing in the presence of ferrous iron and reduced inorganic sulfur compounds (RISCs), global transcriptional analysis was used to track the response of specific genes associated with these complexes, as well as other known and putative respiratory electron transport chain elements. Open reading frames from all five terminal oxidase or bc 1 -like complexes were stimulated on one or more conditions tested. Components of the fox (Msed0467 to Msed0489) and soxNL - cbsABA (Msed0500 to Msed0505) terminal/quinol oxidase clusters were triggered by ferrous iron, while the soxABCDD ′ terminal oxidase cluster (Msed0285 to Msed0291) were induced by tetrathionate and S 0 . Chemolithotrophic electron transport elements, including a putative tetrathionate hydrolase (Msed0804), a novel polysulfide/sulfur/dimethyl sulfoxide reductase-like complex (Msed0812 to Msed0818), and a novel heterodisulfide reductase-like complex (Msed1542 to Msed1550), were also stimulated by RISCs. Furthermore, several hypothetical proteins were found to have strong responses to ferrous iron or RISCs, suggesting additional candidates in iron or sulfur oxidation-related pathways. From this analysis, a comprehensive model for electron transport in M. sedula could be proposed as the basis for examining specific details of iron and sulfur oxidation in this bioleaching archaeon.}, number={24}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Auernik, Kathryne S. and Kelly, Robert M.}, year={2008}, month={Dec}, pages={7723–7732} }
 @misc{auernik_cooper_kelly_2008, title={Life in hot acid: Pathway analyses in extremely thermoacidophilic archaea}, volume={19}, ISSN={["1879-0429"]}, DOI={10.1016/j.copbio.2008.08.001}, abstractNote={The extremely thermoacidophilic archaea are a particularly intriguing group of microorganisms that must simultaneously cope with biologically extreme pHs (≤4) and temperatures (Topt ≥ 60 °C) in their natural environments. Their expanding biotechnological significance relates to their role in biomining of base and precious metals and their unique mechanisms of survival in hot acid, at both the cellular and biomolecular levels. Recent developments, such as advances in understanding of heavy metal tolerance mechanisms, implementation of a genetic system, and discovery of a new carbon fixation pathway, have been facilitated by the availability of genome sequence data and molecular genetic systems. As a result, new insights into the metabolic pathways and physiological features that define extreme thermoacidophily have been obtained, in some cases suggesting prospects for biotechnological opportunities.}, number={5}, journal={CURRENT OPINION IN BIOTECHNOLOGY}, author={Auernik, Kathryne S. and Cooper, Charlotte R. and Kelly, Robert M.}, year={2008}, month={Oct}, pages={445–453} }
 @article{young_nichols_kelly_deiters_2008, title={Microwave activation of enzymatic catalysis}, volume={130}, ISSN={["0002-7863"]}, DOI={10.1021/ja802404g}, abstractNote={Microwave irradiation can be used to regulate biocatalysis. Herein, the utilization of hyperthermophilic enzymes in a microwave reactor is reported. While these enzymes are inactive at low temperatures, they can be activated with microwave irradiation. To the best of our knowledge, this is the first illustration of a specific microwave effect in enzymatic catalysis.}, number={31}, journal={JOURNAL OF THE AMERICAN CHEMICAL SOCIETY}, author={Young, Douglas D. and Nichols, Jason and Kelly, Robert M. and Deiters, Alexander}, year={2008}, month={Aug}, pages={10048-+} }
 @article{vanfossen_lewis_nichols_kelly_2008, title={Polysaccharide Degradation and Synthesis by Extremely Thermophilic Anaerobes}, volume={1125}, ISBN={["978-1-57331-705-4"]}, ISSN={["0077-8923"]}, DOI={10.1196/annals.1419.017}, abstractNote={Extremely thermophilic fermentative anaerobes (growth Topt ≥ 70°C) have the capacity to use a variety of carbohydrates as carbon and energy sources. As such, a wide variety of glycoside hydrolases and transferases have been identified in these microorganisms. The genomes of three model extreme thermophiles—an archaeon Pyrococcus furiosus (Topt = 98°C), and two bacteria, Thermotoga maritima (Topt = 80°C) and Caldicellulosiruptor saccharolyticus (Topt = 70°C)—encode numerous carbohydrate-active enzymes, many of which have been characterized biochemically in their native or recombinant forms. In addition to their voracious appetite for polysaccharide degradation, polysaccharide production has also been noted for extremely thermophilic fermentative anaerobes; T. maritima generates exopolysaccharides that aid in biofilm formation, a process that appears to be driven by intraspecies and interspecies interactions.}, number={1}, journal={Annals of the New York Academy of Sciences}, author={VanFossen, A.L. and Lewis, D.L. and Nichols, J.D. and Kelly, R.M.}, year={2008}, month={Mar}, pages={322–337} }
 @article{kaczowka_madding_epting_kelly_cianciolo_pizzo_2008, title={Probing the stability of native and activated forms of alpha(2)-macroglobulin}, volume={42}, ISSN={["0141-8130"]}, DOI={10.1016/j.ijbiomac.2007.09.019}, abstractNote={α2-Macroglobulin (α2M) is a 718 kDa homotetrameric proteinase inhibitor which undergoes a large conformational change upon activation. This conformational change can occur either by proteolytic attack on an ∼40 amino acid stretch, the bait region, which results in the rupture of the four thioester bonds in α2M, or by direct nucleophilic attack on these thioesters by primary amines. Amine activation circumvents both bait region cleavage and protein incorporation, which occurs by proteolytic activation. These different activation methods allow for examination of the roles bait region cleavage and thioester rupture play in α2M stability. Differential scanning calorimetry and urea gel electrophoresis demonstrate that both bait region cleavage and covalent incorporation of protein ligands in the thioester pocket play critical roles in the stability of α2M complexes.}, number={1}, journal={INTERNATIONAL JOURNAL OF BIOLOGICAL MACROMOLECULES}, author={Kaczowka, Steven J. and Madding, Lara S. and Epting, Kevin L. and Kelly, Robert M. and Cianciolo, George J. and Pizzo, Salvatore V.}, year={2008}, month={Jan}, pages={62–67} }
 @article{auernik_maezato_blum_kelly_2008, title={The genome sequence of the metal-mobilizing, extremely thermoacidophilic archaeon Metallosphaera sedula provides insights into bioleaching-associated metabolism}, volume={74}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.02019-07}, abstractNote={ABSTRACT Despite their taxonomic description, not all members of the order Sulfolobales are capable of oxidizing reduced sulfur species, which, in addition to iron oxidation, is a desirable trait of biomining microorganisms. However, the complete genome sequence of the extremely thermoacidophilic archaeon Metallosphaera sedula DSM 5348 (2.2 Mb, ∼2,300 open reading frames [ORFs]) provides insights into biologically catalyzed metal sulfide oxidation. Comparative genomics was used to identify pathways and proteins involved (directly or indirectly) with bioleaching. As expected, the M. sedula genome contains genes related to autotrophic carbon fixation, metal tolerance, and adhesion. Also, terminal oxidase cluster organization indicates the presence of hybrid quinol-cytochrome oxidase complexes. Comparisons with the mesophilic biomining bacterium Acidithiobacillus ferrooxidans ATCC 23270 indicate that the M. sedula genome encodes at least one putative rusticyanin, involved in iron oxidation, and a putative tetrathionate hydrolase, implicated in sulfur oxidation. The fox gene cluster, involved in iron oxidation in the thermoacidophilic archaeon Sulfolobus metallicus , was also identified. These iron- and sulfur-oxidizing components are missing from genomes of nonleaching members of the Sulfolobales , such as Sulfolobus solfataricus P2 and Sulfolobus acidocaldarius DSM 639. Whole-genome transcriptional response analysis showed that 88 ORFs were up-regulated twofold or more in M. sedula upon addition of ferrous sulfate to yeast extract-based medium; these included genes for components of terminal oxidase clusters predicted to be involved with iron oxidation, as well as genes predicted to be involved with sulfur metabolism. Many hypothetical proteins were also differentially transcribed, indicating that aspects of the iron and sulfur metabolism of M. sedula remain to be identified and characterized.}, number={3}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Auernik, Kathryne S. and Maezato, Yukari and Blum, Paul H. and Kelly, Robert M.}, year={2008}, month={Feb}, pages={682–692} }
 @inbook{michel_kelly_2007, place={Boca Raton, Florida}, title={Archaeal 20S Proteasome: A Simple and Thermostable Model System for the Core Particle}, ISBN={9780429118418}, url={http://dx.doi.org/10.1201/9781420008852-29}, DOI={10.1201/9781420008852-29}, booktitle={Thermophiles}, publisher={CRC Press}, author={Michel, Joshua K. and Kelly, Robert M.}, editor={Robb, Frank and Antranikian, Garabed and Grogan, Dennis and Driessen, ArnoldEditors}, year={2007}, month={Dec}, pages={347–360} }
 @article{comfort_bobrov_ivanen_shabalin_harris_kulminskaya_brumer_kelly_2007, title={Biochemical analysis of Thermotoga maritima GH36 alpha-galactosidase (TmGalA) confirms the mechanistic commonality of clan GH-D glycoside hydrolases}, volume={46}, ISSN={["0006-2960"]}, DOI={10.1021/bi061521n}, abstractNote={Organization of glycoside hydrolase (GH) families into clans expands the utility of information on catalytic mechanisms of member enzymes. This issue was examined for GH27 and GH36 through biochemical analysis of GH36 alpha-galactosidase from Thermotoga maritima (TmGalA). Catalytic residues in TmGalA were inferred through structural homology with GH27 members to facilitate design of site-directed mutants. Product analysis confirmed that the wild type (WT) acted with retention of anomeric stereochemistry, analogous to GH27 enzymes. Conserved acidic residues were confirmed through kinetic analysis of D327G and D387G mutant enzymes, azide rescue, and determination of azide rescue products. Mutation of Asp327 to Gly resulted in a mutant that had a 200-800-fold lower catalytic rate on aryl galactosides relative to the WT enzyme. Azide rescue experiments using the D327G enzyme showed a 30-fold higher catalytic rate compared to without azide. Addition of azide to the reaction resulted in formation of azide beta-d-galactopyranoside, confirming Asp327 as the nucleophilic residue. The Asp387Gly mutation was 1500-fold catalytically slower than the WT enzyme on p-nitrophenyl alpha-d-galactopyranoside. Analysis at different pH values produced a bell-shaped curve of the WT enzyme, but D387G exhibited higher activity with increasing pH. Catalyzed reactions with the D387G mutant in the presence of azide resulted in formation of azide alpha-d-galactopryanoside as the product of a retaining mechanism. These results confirm that Asp387 is the acid/base residue of TmGalA. Furthermore, they show that the biochemical characteristics of GH36 TmGalA are closely related to GH27 enzymes, confirming the mechanistic commonality of clan GH-D members.}, number={11}, journal={BIOCHEMISTRY}, author={Comfort, Donald A. and Bobrov, Kirill S. and Ivanen, Dina R. and Shabalin, Konstantin A. and Harris, James M. and Kulminskaya, Anna A. and Brumer, Harry and Kelly, Robert M.}, year={2007}, month={Mar}, pages={3319–3330} }
 @inbook{haugh_kelly_2007, place={New York}, edition={10th}, title={Biochemical/Biomolecular engineering}, ISBN={9780071441438}, booktitle={McGraw-Hill encyclopedia of science & technology}, publisher={McGraw-Hill}, author={Haugh, J.M. and Kelly, R.M.}, year={2007} }
 @inbook{jenney_tachdijan_chou_kelly_adams_2007, place={Washington, DC}, title={Functional Genomics}, ISBN={9781119738312  9781683671688}, DOI={10.1128/9781555815516.ch20}, booktitle={Archaea: Molecular and Cellular Biology}, publisher={ASM Press}, author={Jenney, F.E., Jr and Tachdijan, Sabrina and Chou, Chung-Jung and Kelly, Robert M. and Adams, M.W.W.}, editor={Cavicchioli, RickEditor}, year={2007}, pages={434–462} }
 @article{chou_shockley_conners_lewis_comfort_adams_kelly_2007, title={Impact of substrate glycoside linkage. and elemental sulfur on bioenergetics, of and hydrogen production by the hyperthermophilic Archaeon Pyrococcus furiosus}, volume={73}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.00597-07}, abstractNote={ABSTRACT Glycoside linkage (cellobiose versus maltose) dramatically influenced bioenergetics to different extents and by different mechanisms in the hyperthermophilic archaeon Pyrococcus furiosus when it was grown in continuous culture at a dilution rate of 0.45 h −1 at 90°C. In the absence of S 0 , cellobiose-grown cells generated twice as much protein and had 50%-higher specific H 2 generation rates than maltose-grown cultures. Addition of S 0 to maltose-grown cultures boosted cell protein production fourfold and shifted gas production completely from H 2 to H 2 S. In contrast, the presence of S 0 in cellobiose-grown cells caused only a 1.3-fold increase in protein production and an incomplete shift from H 2 to H 2 S production, with 2.5 times more H 2 than H 2 S formed. Transcriptional response analysis revealed that many genes and operons known to be involved in α- or β-glucan uptake and processing were up-regulated in an S 0 -independent manner. Most differentially transcribed open reading frames (ORFs) responding to S 0 in cellobiose-grown cells also responded to S 0 in maltose-grown cells; these ORFs included ORFs encoding a membrane-bound oxidoreductase complex (MBX) and two hypothetical proteins (PF2025 and PF2026). However, additional genes (242 genes; 108 genes were up-regulated and 134 genes were down-regulated) were differentially transcribed when S 0 was present in the medium of maltose-grown cells, indicating that there were different cellular responses to the two sugars. These results indicate that carbohydrate characteristics (e.g., glycoside linkage) have a major impact on S 0 metabolism and hydrogen production in P. furiosus . Furthermore, such issues need to be considered in designing and implementing metabolic strategies for production of biofuel by fermentative anaerobes.}, number={21}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Chou, Chung-Jung and Shockley, Keith R. and Conners, Shannon B. and Lewis, Derrick L. and Comfort, Donald A. and Adams, Michael W. W. and Kelly, Robert M.}, year={2007}, month={Nov}, pages={6842–6853} }
 @article{montero_johnson_chou_conners_geouge_tachdjian_nichols_kelly_2007, title={Responses of wild-type and resistant strains of the hyperthermophilic bacterium Thermotoga maritima to chloramphenicol challenge}, volume={73}, ISSN={["0099-2240"]}, DOI={10.1128/AEM.00453-07}, abstractNote={ABSTRACT Transcriptomes and growth physiologies of the hyperthermophile Thermotoga maritima and an antibiotic-resistant spontaneous mutant were compared prior to and following exposure to chloramphenicol. While the wild-type response was similar to that of mesophilic bacteria, reduced susceptibility of the mutant was attributed to five mutations in 23S rRNA and phenotypic preconditioning to chloramphenicol.}, number={15}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Montero, Clemente I. and Johnson, Matthew R. and Chou, Chung-Jung and Conners, Shannon B. and Geouge, Sarah G. and Tachdjian, Sabrina and Nichols, Jason D. and Kelly, Robert M.}, year={2007}, month={Aug}, pages={5058–5065} }
 @article{mahammad_comfort_kelly_khan_2007, title={Rheological properties of guar galactomannan solutions during hydrolysis with galactomannanase and alpha-galactosidase enzyme mixtures}, volume={8}, ISSN={["1526-4602"]}, DOI={10.1021/bm0608232}, abstractNote={Guar galactomannan, a naturally occurring polysaccharide, is susceptible to hydrolysis by three enzymes: β-mannosidase, β-mannanase, and α-galactosidase. The β-mannosidase cleaves a single mannose unit from the nonreducing end of the guar molecule, the β-mannanase cleaves interior glycosidic bonds between adjacent mannose units, and the α-galactosidase cleaves the galactose side branches off the guar. In this study, hydrolysis of guar solutions using hyperthermopilic versions of these enzymes together in different proportions and combinations are examined. The enzymatic reactions are carried out in situ in a rheometer, and the progress of the reaction is monitored through measuring the variation in zero shear viscosity. We find the presence of α-galactosidase to affect the action of both β-mannanase and β-mannosidase with respect to solution rheology. However, this effect is more pronounced when the α-galactosidase and β-mannanase or β-mannosidase enzymes were added sequentially rather than simultaneously. This likely is the result of debranching of the guar, which facilitates attack on β-1,4-linkages by both the β-mannanase and the β-mannosidase enzymes and increases hydrolytic rates by the individual enzymes. A rheology-based kinetic model is developed to estimate the reaction rate constants and interpret synergistic effects of multiple enzyme contributions. The model fits the experimental data well and reveals that both the native and the debranched guar have the same activation energy for β-mannanase action, although debranching considerably increases the frequency of enzyme−guar interactions.}, number={3}, journal={BIOMACROMOLECULES}, author={Mahammad, Shamsheer and Comfort, Donald A. and Kelly, Robert M. and Khan, Saad A.}, year={2007}, month={Mar}, pages={949–956} }
 @article{madding_michel_shockley_conners_epting_johnson_kelly_2007, title={Role of the beta 1 subunit in the function and stability of the 20S proteasome in the hyperthermophilic archaeon Pyrococcus furiosus}, volume={189}, ISSN={["0021-9193"]}, DOI={10.1128/JB.01382-06}, abstractNote={ABSTRACT The hyperthermophilic archaeon Pyrococcus furiosus genome encodes three proteasome component proteins: one α protein (PF1571) and two β proteins (β1-PF1404 and β2-PF0159), as well as an ATPase (PF0115), referred to as proteasome-activating nucleotidase. Transcriptional analysis of the P. furiosus dynamic heat shock response (shift from 90 to 105°C) showed that the β1 gene was up-regulated over twofold within 5 minutes, suggesting a specific role during thermal stress. Consistent with transcriptional data, two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed that incorporation of the β1 protein relative to β2 into the 20S proteasome (core particle [CP]) increased with increasing temperature for both native and recombinant versions. For the recombinant enzyme, the β2/β1 ratio varied linearly with temperature from 3.8, when assembled at 80°C, to 0.9 at 105°C. The recombinant α+β1+β2 CP assembled at 105°C was more thermostable than either the α+β1+β2 version assembled at 90°C or the α+β2 version assembled at either 90°C or 105°C, based on melting temperature and the biocatalytic inactivation rate at 115°C. The recombinant CP assembled at 105°C was also found to have different catalytic rates and specificity for peptide hydrolysis, compared to the 90°C assembly (measured at 95°C). Combination of the α and β1 proteins neither yielded a large proteasome complex nor demonstrated any significant activity. These results indicate that the β1 subunit in the P. furiosus 20S proteasome plays a thermostabilizing role and influences biocatalytic properties, suggesting that β subunit composition is a factor in archaeal proteasome function during thermal stress, when polypeptide turnover is essential to cell survival.}, number={2}, journal={JOURNAL OF BACTERIOLOGY}, author={Madding, Lara S. and Michel, Joshua K. and Shockley, Keith R. and Conners, Shannon B. and Epting, Kevin L. and Johnson, Matthew R. and Kelly, Robert M.}, year={2007}, month={Jan}, pages={583–590} }
 @inbook{adams_jenney_chou_hamilton-brehm_poole_shockley_tachdjian_kelly_2007, title={Transcriptomics, Proteomics, and Structural Genomics ofPyrococcus Furiosus}, ISBN={9780470750865 9781405144049}, url={http://dx.doi.org/10.1002/9780470750865.ch21}, DOI={10.1002/9780470750865.ch21}, abstractNote={This chapter contains sections titled: Introduction The P. furiosus genome and problems with genome annotation The number of genes in the P. furiosus genome The response of P. furiosus to growth phase and growth rate The response of P. furiosus to the presence of elemental sulfur The response of P. furiosus to changes in the primary carbon source The response of P. furiosus to cold shock and cold adaptation The response of P. furiosus to heat shock Use of a P. furiosus DNA microarray to assess species relationships The P. furiosus proteome Structural genomics of P. furiosus Conclusions}, booktitle={Archaea}, publisher={Blackwell Publishing Ltd}, author={Adams, Michael W. W. and Jenney, Francis E., Jr and Chou, Chung-Jung and Hamilton-Brehm, Scott and Poole, Farris L., II and Shockley, Keith R. and Tachdjian, Sabrina and Kelly, Robert M.}, year={2007}, month={Nov}, pages={239–246} }
 @article{montero_lewis_johnson_conners_nance_nichols_kelly_2006, title={Colocation of genes encoding a tRNA-mRNA hybrid and a putative signaling peptide on complementary strands in the genome of the hyperthermophilic bacterium Thermotoga maritima}, volume={188}, ISSN={["0021-9193"]}, DOI={10.1128/JB.00470-06}, abstractNote={ABSTRACT In the genome of the hyperthermophilic bacterium Thermotoga maritima , TM0504 encodes a putative signaling peptide implicated in population density-dependent exopolysaccharide formation. Although not noted in the original genome annotation, TM0504 was found to colocate, on the opposite strand, with the gene encoding ssrA , a hybrid of tRNA and mRNA (tmRNA), which is involved in a trans- translation process related to ribosome rescue and is ubiquitous in bacteria. Specific DNA probes were designed and used in real-time PCR assays to follow the separate transcriptional responses of the colocated open reading frames (ORFs) during transition from exponential to stationary phase, chloramphenicol challenge, and syntrophic coculture with Methanococcus jannaschii . TM0504 transcription did not vary under normal growth conditions. Transcription of the tmRNA gene, however, was significantly up-regulated during chloramphenicol challenge and in T. maritima bound in exopolysaccharide aggregates during methanogenic coculture. The significance of the colocation of ORFs encoding a putative signaling peptide and tmRNA in T. maritima is intriguing, since this overlapping arrangement (tmRNA associated with putative small ORFs) was found to be conserved in at least 181 bacterial genomes sequenced to date. Whether peptides related to TM0504 in other bacteria play a role in quorum sensing is not yet known, but their ubiquitous colocalization with respect to tmRNA merits further examination.}, number={19}, journal={JOURNAL OF BACTERIOLOGY}, author={Montero, Clemente I. and Lewis, Derrick L. and Johnson, Matthew R. and Conners, Shannon B. and Nance, Elizabeth A. and Nichols, Jason D. and Kelly, Robert M.}, year={2006}, month={Oct}, pages={6802–6807} }
 @article{tachdjian_kelly_2006, title={Dynamic metabolic adjustments and genome plasticity are implicated in the heat shock response of the extremely thermoacidophilic Archaeon Sulfolobus solfataricus}, volume={188}, ISSN={["1098-5530"]}, DOI={10.1128/JB.00080-06}, abstractNote={ABSTRACT Approximately one-third of the open reading frames encoded in the Sulfolobus solfataricus genome were differentially expressed within 5 min following an 80 to 90°C temperature shift at pH 4.0. This included many toxin-antitoxin loci and insertion elements, implicating a connection between genome plasticity and metabolic regulation in the early stages of stress response.}, number={12}, journal={JOURNAL OF BACTERIOLOGY}, author={Tachdjian, Sabrina and Kelly, Robert M.}, year={2006}, month={Jun}, pages={4553–4559} }
 @article{barrangou_azcarate-peril_duong_conners_kelly_klaenhammer_2006, title={Global analysis of carbohydrate utilization by Lactobacillus acidophilus using cDNA microarrays}, volume={103}, ISSN={["0027-8424"]}, DOI={10.1073/pnas.0511287103}, abstractNote={The transport and catabolic machinery involved in carbohydrate utilization by Lactobacillus acidophilus was characterized genetically by using whole-genome cDNA microarrays. Global transcriptional profiles were determined for growth on glucose, fructose, sucrose, lactose, galactose, trehalose, raffinose, and fructooligosaccharides. Hybridizations were carried out by using a round-robin design, and microarray data were analyzed with a two-stage mixed model ANOVA. Differentially expressed genes were visualized by hierarchical clustering, volcano plots, and contour plots. Overall, only 63 genes (3% of the genome) showed a >4-fold induction. Specifically, transporters of the phospho enol pyruvate:sugar transferase system were identified for uptake of glucose, fructose, sucrose, and trehalose, whereas ATP-binding cassette transporters were identified for uptake of raffinose and fructooligosaccharides. A member of the LacS subfamily of galactoside-pentose hexuronide translocators was identified for uptake of galactose and lactose. Saccharolytic enzymes likely involved in the metabolism of monosaccharides, disaccharides, and polysaccharides into substrates of glycolysis were also found, including enzymatic machinery of the Leloir pathway. The transcriptome appeared to be regulated by carbon catabolite repression. Although substrate-specific carbohydrate transporters and hydrolases were regulated at the transcriptional level, genes encoding regulatory proteins CcpA, Hpr, HprK/P, and EI were consistently highly expressed. Genes central to glycolysis were among the most highly expressed in the genome. Collectively, microarray data revealed that coordinated and regulated transcription of genes involved in sugar uptake and metabolism is based on the specific carbohydrate provided. L. acidophilus 's adaptability to environmental conditions likely contributes to its competitive ability for limited carbohydrate sources available in the human gastrointestinal tract.}, number={10}, journal={PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA}, publisher={Proceedings of the National Academy of Sciences}, author={Barrangou, R and Azcarate-Peril, MA and Duong, T and Conners, SB and Kelly, RM and Klaenhammer, TR}, year={2006}, month={Mar}, pages={3816–3821} }
 @article{ahlborn_clare_sheldon_kelly_2006, title={Identification of Eggshell Membrane Proteins and Purification of Ovotransferrin and β-NAGase from Hen Egg White}, volume={25}, ISSN={1572-3887 1573-4943}, url={http://dx.doi.org/10.1007/s10930-006-0010-8}, DOI={10.1007/s10930-006-0010-8}, number={1}, journal={The Protein Journal}, publisher={Springer Science and Business Media LLC}, author={Ahlborn, G. J. and Clare, D. A. and Sheldon, B. W. and Kelly, R. W.}, year={2006}, month={Jan}, pages={71–81} }
 @misc{conners_mongodin_johnson_montero_nelson_kelly_2006, title={Microbial biochemistry, physiology, and biotechnology of hyperthermophilic Thermotoga species}, volume={30}, ISSN={["1574-6976"]}, DOI={10.1111/j.1574-6976.2006.00039.x}, abstractNote={High-throughput sequencing of microbial genomes has allowed the application of functional genomics methods to species lacking well-developed genetic systems. For the model hyperthermophile Thermotoga maritima, microarrays have been used in comparative genomic hybridization studies to investigate diversity among Thermotoga species. Transcriptional data have assisted in prediction of pathways for carbohydrate utilization, iron-sulfur cluster synthesis and repair, expolysaccharide formation, and quorum sensing. Structural genomics efforts aimed at the T. maritima proteome have yielded hundreds of high-resolution datasets and predicted functions for uncharacterized proteins. The information gained from genomics studies will be particularly useful for developing new biotechnology applications for T. maritima enzymes.}, number={6}, journal={FEMS MICROBIOLOGY REVIEWS}, author={Conners, Shannon B. and Mongodin, Emmanuel F. and Johnson, Matthew R. and Montero, Clemente I. and Nelson, Karen E. and Kelly, Robert M.}, year={2006}, month={Nov}, pages={872–905} }
 @article{johnson_conners_montero_chou_shockley_kelly_2006, title={The Thermotoga maritima phenotype is impacted by syntrophic interaction with Methanococcus jannaschii in hyperthermophilic coculture}, volume={72}, ISSN={["0099-2240"]}, DOI={10.1128/aem.72.1.811-818.2006}, abstractNote={ABSTRACT Significant growth phase-dependent differences were noted in the transcriptome of the hyperthermophilic bacterium Thermotoga maritima when it was cocultured with the hyperthermophilic archaeon Methanococcus jannaschii . For the mid-log-to-early-stationary-phase transition of a T. maritima monoculture, 24 genes (1.3% of the genome) were differentially expressed twofold or more. In contrast, methanogenic coculture gave rise to 292 genes differentially expressed in T. maritima at this level (15.5% of the genome) for the same growth phase transition. Interspecies H 2 transfer resulted in three- to fivefold-higher T. maritima cell densities than in the monoculture, with concomitant formation of exopolysaccharide (EPS)-based cell aggregates. Differential expression of specific sigma factors and genes related to the ppGpp-dependent stringent response suggests involvement in the transition into stationary phase and aggregate formation. Cell aggregation was growth phase dependent, such that it was most prominent during mid-log phase and decayed as cells entered stationary phase. The reduction in cell aggregation was coincidental with down-regulation of genes encoding EPS-forming glycosyltranferases and up-regulation of genes encoding β-specific glycosyl hydrolases; the latter were presumably involved in hydrolysis of β-linked EPS to release cells from aggregates. Detachment of aggregates may facilitate colonization of new locations in natural environments where T. maritima coexists with other organisms. Taken together, these results demonstrate that syntrophic interactions can impact the transcriptome of heterotrophs in methanogenic coculture, and this factor should be considered in examining the microbial ecology in anaerobic environments.}, number={1}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Johnson, MR and Conners, SB and Montero, CI and Chou, CJ and Shockley, KR and Kelly, RM}, year={2006}, month={Jan}, pages={811–818} }
 @article{lee_shockley_schut_conners_montero_johnson_chou_bridger_wigner_brehm_et al._2006, title={Transcriptional and biochemical analysis of starch metabolism in the hyperthermophilic archaeon Pyrococcus furiosus}, volume={188}, ISSN={["1098-5530"]}, DOI={10.1128/JB.188.6.2115-2125.2006}, abstractNote={ABSTRACT Pyrococcus furiosus utilizes starch and its degradation products, such as maltose, as primary carbon sources, but the pathways by which these α-glucans are processed have yet to be defined. For example, its genome contains genes proposed to encode five amylolytic enzymes (including a cyclodextrin glucanotransferase [CGTase] and amylopullulanase), as well as two transporters for maltose and maltodextrins (Mal-I and Mal-II), and a range of intracellular enzymes have been purified that reportedly metabolize maltodextrins and maltose. However, precisely which of these enzymes are involved in starch processing is not clear. In this study, starch metabolism in P. furiosus was examined by biochemical analyses in conjunction with global transcriptional response data for cells grown on a variety of glucans. In addition, DNA sequencing led to the correction of two key errors in the genome sequence, and these change the predicted properties of amylopullulanase (now designated PF1935*) and CGTase (PF0478*). Based on all of these data, a pathway is proposed that is specific for starch utilization that involves one transporter (Mal-II [PF1933 to PF1939]) and only three enzymes, amylopullulanase (PF1935*), 4-α-glucanotransferase (PF0272), and maltodextrin phosphorylase (PF1535). Their expression is upregulated on starch, and together they generate glucose and glucose-1-phosphate, which then feed into the novel glycolytic pathway of this organism. In addition, the results indicate that several hypothetical proteins encoded by three gene clusters are also involved in the transport and processing of α-glucan substrates by P. furiosus .}, number={6}, journal={JOURNAL OF BACTERIOLOGY}, author={Lee, HS and Shockley, KR and Schut, GJ and Conners, SB and Montero, CI and Johnson, MR and Chou, CJ and Bridger, SL and Wigner, N and Brehm, SD and et al.}, year={2006}, month={Mar}, pages={2115–2125} }
 @article{price_shannon_sabrina_robert_payne_2005, title={Aflatoxin conducive and non-conducive growth conditions reveal new gene associations with aflatoxin production}, volume={42}, ISSN={["1096-0937"]}, DOI={10.1016/j.fgb.2005.03.009}, abstractNote={Research on aflatoxin (AF) production has traditionally focused on defining the AF biosynthetic pathway with the goal of identifying potential targets for intervention. To understand the effect of nitrogen source, carbon source, temperature, and pH on the regulation of AF biosynthesis, a targeted cDNA microarray consisting of genes associated with AF production over time was employed. Expression profiles for genes involved in AF biosynthesis grouped into five clades. A putative regulon was identified consisting of 20 genes that were induced in the conducive nitrogen and pH treatments and the non-conducive carbon and temperature treatments, as well as four other putative regulons corresponding to each of the four variables studied. Seventeen genes exhibited consistent induction/repression profiles across all the experiments. One of these genes was consistently downregulated with AF production. Overexpression of this gene resulted in repression of AF biosynthesis. The cellular function of this gene is currently unresolved.}, number={6}, journal={FUNGAL GENETICS AND BIOLOGY}, author={Price, MS and Shannon, BCB and Sabrina, TB and Robert, AKB and Payne, GA}, year={2005}, month={Jun}, pages={506–518} }
 @article{conners_montero_comfort_shockley_johnson_chhabra_kelly_2005, title={An expression-driven approach to the prediction of carbohydrate transport and utilization regulons in the hyperthermophilic bacterium Thermotoga maritima}, volume={187}, ISSN={["1098-5530"]}, DOI={10.1128/JB.187.21.7267-7282.2005}, abstractNote={ABSTRACT Comprehensive analysis of genome-wide expression patterns during growth of the hyperthermophilic bacterium Thermotoga maritima on 14 monosaccharide and polysaccharide substrates was undertaken with the goal of proposing carbohydrate specificities for transport systems and putative transcriptional regulators. Saccharide-induced regulons were predicted through the complementary use of comparative genomics, mixed-model analysis of genome-wide microarray expression data, and examination of upstream sequence patterns. The results indicate that T. maritima relies extensively on ABC transporters for carbohydrate uptake, many of which are likely controlled by local regulators responsive to either the transport substrate or a key metabolic degradation product. Roles in uptake of specific carbohydrates were suggested for members of the expanded Opp/Dpp family of ABC transporters. In this family, phylogenetic relationships among transport systems revealed patterns of possible duplication and divergence as a strategy for the evolution of new uptake capabilities. The presence of GC-rich hairpin sequences between substrate-binding proteins and other components of Opp/Dpp family transporters offers a possible explanation for differential regulation of transporter subunit genes. Numerous improvements to T. maritima genome annotations were proposed, including the identification of ABC transport systems originally annotated as oligopeptide transporters as candidate transporters for rhamnose, xylose, β-xylan, andβ -glucans and identification of genes likely to encode proteins missing from current annotations of the pentose phosphate pathway. Beyond the information obtained for T. maritima , the present study illustrates how expression-based strategies can be used for improving genome annotation in other microorganisms, especially those for which genetic systems are unavailable.}, number={21}, journal={JOURNAL OF BACTERIOLOGY}, author={Conners, SB and Montero, CI and Comfort, DA and Shockley, KR and Johnson, MR and Chhabra, SR and Kelly, RM}, year={2005}, month={Nov}, pages={7267–7282} }
 @misc{kelly_khan_leduc_tayal_prud'homme_2005, title={Compositions for fracturing subterranean formations}, volume={6,936,454}, publisher={Washington, DC: U.S. Patent and Trademark Office}, author={Kelly, R. M. and Khan, S. A. and Leduc, P. and Tayal, A. and Prud'homme, R. K.}, year={2005} }
 @article{mcguffey_epting_kelly_foegeding_2005, title={Denaturation and aggregation of three alpha-lactalbumin preparations at neutral pH}, volume={53}, ISSN={["1520-5118"]}, DOI={10.1021/jf048863p}, abstractNote={The denaturation and aggregation of reagent-grade (Sigmaalpha-La), ion-exchange chromatography purified (IEXalpha-La), and a commercial-grade (Calpha-La) alpha-lactalbumin were studied with differential scanning calorimetry (DSC), polyacrylamide gel electrophoresis, and turbidity measurement. All three preparations had similar thermal denaturation temperatures with an average of 63.7 degrees C. Heating pure preparations of alpha-lactalbumin produced three non-native monomer species and three distinct dimer species. This phenomenon was not observed in Calpha-La. Turbidity development at 95 degrees C (tau95 degrees C) indicated that pure preparations rapidly aggregate at pH 7.0, and evidence suggests that hydrophobic interactions drove this phenomenon. The Calpha-La required 4 times the phosphate or excess Ca2+ concentrations to develop a similar tau95 degrees C to the pure preparations and displayed a complex pH-dependent tau95 degrees C behavior. Turbidity development dramatically decreased when the heating temperature was below 95 degrees C. A mechanism is provided, and the interrelationship between specific electrostatic interactions and hydrophobic attraction, in relation to the formation of disulfide-bonded products, is discussed.}, number={8}, journal={JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY}, author={McGuffey, MK and Epting, KL and Kelly, RM and Foegeding, EA}, year={2005}, month={Apr}, pages={3182–3190} }
 @article{shockley_scott_pysz_conners_johnson_montero_wolfinger_kelly_2005, title={Genorne-wide transcriptional variation within and between steady states for continuous growth of the hyperthermophile Thermotoga maritima}, volume={71}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.71.9.5572-5576.2005}, abstractNote={ABSTRACT Maltose-limited, continuous growth of the hyperthermophile Thermotoga maritima at different temperatures and dilution rates (80°C/0.25 h −1 , 80°C/0.17 h −1 , and 85°C/0.25 h −1 ) showed that transcriptome-wide variation in gene expression within mechanical steady states was minimal compared to that between steady states, supporting the efficacy of chemostat-based approaches for functional genomics studies.}, number={9}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Shockley, KR and Scott, KL and Pysz, MA and Conners, SB and Johnson, MR and Montero, CI and Wolfinger, RD and Kelly, RM}, year={2005}, month={Sep}, pages={5572–5576} }
 @article{epting_vieille_zeikus_kelly_kelly_zeikus_vieille_2005, title={Influence of divalent cations on the structural thermostability and thermal inactivation kinetics of class II xylose isomerases}, volume={272}, ISSN={["1742-4658"]}, DOI={10.1111/j.1742-4658.2005.04577.x}, abstractNote={The effects of divalent metal cations on structural thermostability and the inactivation kinetics of homologous class II d-xylose isomerases (XI; EC 5.3.1.5) from mesophilic (Escherichia coli and Bacillus licheniformis), thermophilic (Thermoanaerobacterium thermosulfurigenes), and hyperthermophilic (Thermotoga neapolitana) bacteria were examined. Unlike the three less thermophilic XIs that were substantially structurally stabilized in the presence of Co2+ or Mn2+ (and Mg2+ to a lesser extent), the melting temperature [(Tm) approximately 100 degrees C] of T. neapolitana XI (TNXI) varied little in the presence or absence of a single type of metal. In the presence of any two of these metals, TNXI exhibited a second melting transition between 110 degrees C and 114 degrees C. TNXI kinetic inactivation, which was non-first order, could be modeled as a two-step sequential process. TNXI inactivation in the presence of 5 mm metal at 99-100 degrees C was slowest in the presence of Mn2+[half-life (t(1/2)) of 84 min], compared to Co2+ (t(1/2) of 14 min) and Mg2+ (t(1/2) of 2 min). While adding Co2+ to Mg2+ increased TNXI's t(1/2) at 99-100 degrees C from 2 to 7.5 min, TNXI showed no significant activity at temperatures above the first melting transition. The results reported here suggest that, unlike the other class II XIs examined, single metals are required for TNXI activity, but are not essential for its structural thermostability. The structural form corresponding to the second melting transition of TNXI in the presence of two metals is not known, but likely results from cooperative interactions between dissimilar metals in the two metal binding sites.}, number={6}, journal={FEBS JOURNAL}, author={Epting, KL and Vieille, C and Zeikus, JG and Kelly, RM and Kelly, RM and Zeikus, JG and Vieille, C}, year={2005}, month={Mar}, pages={1454–1464} }
 @article{johnson_montero_conners_shockley_bridger_kelly_2005, title={Population density-dependent regulation of exopolysaccharide formation in the hyperthermophilic bacterium Thermotoga maritima}, volume={55}, ISSN={["1365-2958"]}, DOI={10.1111/j.1365-2958.2004.04419.x}, abstractNote={Co-cultivation of the hyperthermophiles Thermotoga maritima and Methanococcus jannaschii resulted in fivefold higher T. maritima cell densities when compared with monoculture as well as concomitant formation of exopolysaccharide and flocculation of heterotroph-methanogen cellular aggregates. Transcriptional analysis of T. maritima cells from these aggregates using a whole genome cDNA microarray revealed the induction of a putative exopolysaccharide synthesis pathway, regulated by intracellular levels of cyclic diguanosine 3',5'-(cyclic)phosphate (cyclic di-GMP) and mediated by the action of several GGDEF proteins, including a putative diguanylate cyclase (TM1163) and a putative phosphodiesterase (TM1184). Transcriptional analysis also showed that TM0504, which encodes a polypeptide containing a motif common to known peptide-signalling molecules in mesophilic bacteria, was strongly upregulated in the co-culture. Indeed, when a synthetically produced peptide based on TM0504 was dosed into the culture at ecologically relevant levels, the production of exopolysaccharide was induced at significantly lower cell densities than was observed in cultures lacking added peptide. In addition to identifying a pathway for polysaccharide formation in T. maritima, these results point to the existence of peptide-based quorum sensing in hyperthermophilic bacteria and indicate that cellular communication should be considered as a component of the microbial ecology within hydrothermal habitats.}, number={3}, journal={MOLECULAR MICROBIOLOGY}, author={Johnson, MR and Montero, CI and Conners, SB and Shockley, KR and Bridger, SL and Kelly, RM}, year={2005}, month={Feb}, pages={664–674} }
 @inbook{kelly_shockley_2004, place={Totowa, NJ}, title={Applications of Genomic Data: Enzyme Discovery and Microbial Genomics}, booktitle={Microbial Genomics}, publisher={Humana Press, Inc}, author={Kelly, R.M. and Shockley, K.R.}, editor={Fraser, C.M. and Read, T. and Nelson, K.E.Editors}, year={2004} }
 @inbook{grunden_comfort_malotky_kelly_2004, title={Expression of Extremophilic Proteins}, booktitle={Expression Technologies: Current Status and Future Trends}, publisher={Horizon Scientific}, author={Grunden, A.M. and Comfort, D.A. and Malotky, E.L. and Kelly, R.M.}, editor={Baneyx, F.Editor}, year={2004} }
 @article{johnson_montero_conners_shockley_pysz_kelly_2004, title={Functional genomics-based studies of the microbial ecology of hyperthermophilic micro-organisms}, volume={32}, ISSN={["1470-8752"]}, DOI={10.1042/BST0320188}, abstractNote={Although much attention has been paid to the genetic, biochemical and physiological aspects of individual hyperthermophiles, how these unique micro-organisms relate to each other and to their natural habitats must be addressed in order to develop a comprehensive understanding of life at high temperatures. Phylogenetic 16 S rRNA-based profiling of samples from various geothermal sites has provided insights into community structure, but this must be complemented with efforts to relate metabolic strategies to biotic and abiotic characteristics in high-temperature habitats. Described here are functional genomics-based approaches, using cDNA microarrays, to gain insight into how ecological features such as biofilm formation, species interaction, and possibly even gene transfer may occur in native environments, as well as to determine what genes or sets of genes may be tied to environmental functionality.}, number={2004 Apr}, journal={BIOCHEMICAL SOCIETY TRANSACTIONS}, author={Johnson, MR and Montero, CI and Conners, SB and Shockley, KR and Pysz, MA and Kelly, RM}, year={2004}, month={Apr}, pages={188–192} }
 @inbook{hicks_chang_kelly_2004, place={London}, title={Pyrococcus furiosus Protease I (PfpI)}, booktitle={Handbook of Proteolytic Enzymes}, publisher={Academic Press Limited}, author={Hicks, P.M. and Chang, L.S. and Kelly, R.M.}, editor={Woessner, F. and Rawlings, N. and Barrett, A.Editors}, year={2004}, pages={1393–1395} }
 @inbook{pysz_montero_chhabra_kelly_rinker_2004, place={Washington, DC}, series={Geophysical Monograph Series}, title={Significance of polysaccharides in microbial physiology and the ecology of hydrothermal vent environments}, ISBN={0875904092 9781118666135 9781118665879}, booktitle={The Subseafloor Biosphere at Mid-Ocean Ridges}, publisher={American Geophysical Union}, author={Pysz, M.A. and Montero, C.I. and Chhabra, S.R. and Kelly, R.M. and Rinker, K.R.}, editor={Wilcock, W.S.D. and DeLong, E.F. and Kelley, D.S. and Baross, J.A. and Cary, S.C.Editors}, year={2004}, pages={213–226}, collection={Geophysical Monograph Series} }
 @article{comfort_chhabra_conners_chou_epting_johnson_jones_sehgal_kelly_2004, title={Strategic biocatalysis with hyperthermophilic enzymes}, volume={6}, ISSN={1463-9262 1463-9270}, url={http://dx.doi.org/10.1039/b406297c}, DOI={10.1039/b406297c}, abstractNote={With the advent of genome sequence information, in addition to capabilities for cloning and expressing genes of interest in foreign hosts, a wide range of hyperthermophilic enzymes have become accessible for potential applications for biocatalytic processes. Not only can these enzymes be useful for strategic opportunities at high temperatures, but there may also be advantages that derive from their relatively low activity at suboptimal temperatures. Examples of several possible ways in which hyperthermophilic enzymes could be used are presented, including cases where they could serve as environmentally benign alternatives in existing industrial processes.}, number={9}, journal={Green Chemistry}, publisher={Royal Society of Chemistry (RSC)}, author={Comfort, Donald A. and Chhabra, Swapnil R. and Conners, Shannon B. and Chou, Chung-Jung and Epting, Kevin L. and Johnson, Matthew R. and Jones, Kristen L. and Sehgal, Amitabh C. and Kelly, Robert M.}, year={2004}, pages={459} }
 @misc{pysz_conners_montero_shockley_johnson_ward_kelly_2004, title={Transcriptional analysis of biofilm formation processes in the anaerobic, hyperthermophilic bacterium Thermotoga maritima}, volume={70}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.70.10.6098-6112.2004}, abstractNote={ABSTRACT Thermotoga maritima , a fermentative, anaerobic, hyperthermophilic bacterium, was found to attach to bioreactor glass walls, nylon mesh, and polycarbonate filters during chemostat cultivation on maltose-based media at 80°C. A whole-genome cDNA microarray was used to examine differential expression patterns between biofilm and planktonic populations. Mixed-model statistical analysis revealed differential expression (twofold or more) of 114 open reading frames in sessile cells (6% of the genome), over a third of which were initially annotated as hypothetical proteins in the T. maritima genome. Among the previously annotated genes in the T. maritima genome, which showed expression changes during biofilm growth, were several that corresponded to biofilm formation genes identified in mesophilic bacteria (i.e., Pseudomonas species, Escherichia coli , and Staphylococcus epidermidis ). Most notably, T. maritima biofilm-bound cells exhibited increased transcription of genes involved in iron and sulfur transport, as well as in biosynthesis of cysteine, thiamine, NAD, and isoprenoid side chains of quinones. These findings were all consistent with the up-regulation of iron-sulfur cluster assembly and repair functions in biofilm cells. Significant up-regulation of several β-specific glycosidases was also noted in biofilm cells, despite the fact that maltose was the primary carbon source fed to the chemostat. The reasons for increased β-glycosidase levels are unclear but are likely related to the processing of biofilm-based polysaccharides. In addition to revealing insights into the phenotype of sessile T. maritima communities, the methodology developed here can be extended to study other anaerobic biofilm formation processes as well as to examine aspects of microbial ecology in hydrothermal environments.}, number={10}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Pysz, MA and Conners, SB and Montero, CI and Shockley, KR and Johnson, MR and Ward, DE and Kelly, RA}, year={2004}, month={Oct}, pages={6098–6112} }
 @article{pysz_ward_shockley_montero_conners_johnson_kelly_2004, title={Transcriptional analysis of dynamic heat-shock response by the hyperthermophilic bacterium Thermotoga maritima}, volume={8}, ISSN={["1433-4909"]}, DOI={10.1007/s00792-004-0379-2}, number={3}, journal={EXTREMOPHILES}, author={Pysz, MA and Ward, DE and Shockley, KR and Montero, CI and Conners, SB and Johnson, MR and Kelly, RM}, year={2004}, month={Jun}, pages={209–217} }
 @article{chhabra_shockley_conners_scott_wolfinger_kelly_2003, title={Carbohydrate-induced differential gene expression patterns in the hyperthermophilic bacterium Thermotoga maritima}, volume={278}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M211748200}, abstractNote={The hyperthermophilic bacteriumThermotoga maritima MSB8 was grown on a variety of carbohydrates to determine the influence of carbon and energy source on differential gene expression. Despite the fact that T. maritima has been phylogenetically characterized as a primitive microorganism from an evolutionary perspective, results here suggest that it has versatile and discriminating mechanisms for regulating and effecting complex carbohydrate utilization. Growth ofT. maritima on monosaccharides was found to be slower than growth on polysaccharides, although growth to cell densities of 108 to 109 cells/ml was observed on all carbohydrates tested. Differential expression of genes encoding carbohydrate-active proteins encoded in the T. maritimagenome was followed using a targeted cDNA microarray in conjunction with mixed model statistical analysis. Coordinated regulation of genes responding to specific carbohydrates was noted. Although glucose generally repressed expression of all glycoside hydrolase genes, other sugars induced or repressed these genes to varying extents. Expression profiles of most endo-acting glycoside hydrolase genes correlated well with their reported biochemical properties, although exo-acting glycoside hydrolase genes displayed less specific expression patterns. Genes encoding selected putative ABC sugar transporters were found to respond to specific carbohydrates, and in some cases putative oligopeptide transporter genes were also found to respond to specific sugar substrates. Several genes encoding putative transcriptional regulators were expressed during growth on specific sugars, thus suggesting functional assignments. The transcriptional response ofT. maritima to specific carbohydrate growth substrates indicated that sugar backbone- and linkage-specific regulatory networks are operational in this organism during the uptake and utilization of carbohydrate substrates. Furthermore, the wide ranging collection of such networks in T. maritima suggests that this organism is capable of adapting to a variety of growth environments containing carbohydrate growth substrates. The hyperthermophilic bacteriumThermotoga maritima MSB8 was grown on a variety of carbohydrates to determine the influence of carbon and energy source on differential gene expression. Despite the fact that T. maritima has been phylogenetically characterized as a primitive microorganism from an evolutionary perspective, results here suggest that it has versatile and discriminating mechanisms for regulating and effecting complex carbohydrate utilization. Growth ofT. maritima on monosaccharides was found to be slower than growth on polysaccharides, although growth to cell densities of 108 to 109 cells/ml was observed on all carbohydrates tested. Differential expression of genes encoding carbohydrate-active proteins encoded in the T. maritimagenome was followed using a targeted cDNA microarray in conjunction with mixed model statistical analysis. Coordinated regulation of genes responding to specific carbohydrates was noted. Although glucose generally repressed expression of all glycoside hydrolase genes, other sugars induced or repressed these genes to varying extents. Expression profiles of most endo-acting glycoside hydrolase genes correlated well with their reported biochemical properties, although exo-acting glycoside hydrolase genes displayed less specific expression patterns. Genes encoding selected putative ABC sugar transporters were found to respond to specific carbohydrates, and in some cases putative oligopeptide transporter genes were also found to respond to specific sugar substrates. Several genes encoding putative transcriptional regulators were expressed during growth on specific sugars, thus suggesting functional assignments. The transcriptional response ofT. maritima to specific carbohydrate growth substrates indicated that sugar backbone- and linkage-specific regulatory networks are operational in this organism during the uptake and utilization of carbohydrate substrates. Furthermore, the wide ranging collection of such networks in T. maritima suggests that this organism is capable of adapting to a variety of growth environments containing carbohydrate growth substrates. analysis of variance carboxymethylcellulose phosphotransferase system carbon catabolite repression Saccharolytic microorganisms employ a range of proteins to hydrolyze, transport, and utilize complex carbohydrates that serve as carbon and energy sources (1de Vos W.M. Kengen S.W.M. Voorhorst W.G.B. van der Oost J. Extremophiles. 1998; 2: 201-205Crossref PubMed Scopus (38) Google Scholar). In some cases, these proteins are very specific to particular carbohydrates, whereas in other situations they mediate the processing of a broader range of glycosides. For simple sugars, such as glucose, binding and transport proteins alone mediate substrate entry into specific intracellular anabolic and catabolic pathways (2Galperin M.Y. Noll K.M. Romano A.H. Appl. Environ. Microbiol. 1996; 62: 2915-2918PubMed Google Scholar). However, for complex carbohydrates, a series of glycoside hydrolases must first process the polysaccharide so that its backbone and side chain glycosidic linkages are hydrolyzed to the extent needed for binding, transport, and intracellular utilization. How specific organisms develop the capacity to utilize complex carbohydrates is not known, but this probably involves evolutionary pressures in addition to acquisition of this genetic potential through horizontal gene transfer events. In any case, a microorganism's capacity to utilize carbohydrates presumably reflects the availability of such substrates in its habitat. Therefore, insights into the repertoire of carbohydrate-active proteins in a given organism and how the expression of these proteins is regulated would reveal much about particular metabolic features in addition to how it interacts within a given ecosystem. Thermotoga maritima is an obligately anaerobic, heterotrophic, hyperthermophilic bacterium originally isolated from geothermal features associated with Vulcano Island, Italy (3Huber R. Langworthy T.A. Konig H. Thomm M. Woese C.R. Sleytr U.B. Stetter K.O. Arch. Microbiol. 1986; 144: 324-333Crossref Scopus (623) Google Scholar). Its capacity to utilize a wide range of simple and complex carbohydrates was confirmed by the inventory of glycoside hydrolases encoded in its genome (4Nelson K.E. Clayton R.A. Gill S.R. Gwinn M.L. Dodson R.J. Haft D.H. Hickey E.K. Peterson J.D. Nelson W.C. Ketchum K.A. McDonald L. Utterback T.R. Malek J.A. Linher K.D. Garrett M.M. Stewart A.M. Cotton M.D. Pratt M.S. Phillips C.A. Richardson D. Heidelberg J. Sutton G.G. Fleischmann R.D. Eisen J.A. Fraser C.M. et al.Nature. 1999; 399: 323-329Crossref PubMed Scopus (1206) Google Scholar). In fact, the T. maritima genome, despite its relatively small size, encodes the largest number of glycoside hydrolases of any bacterial or archaeal genome sequenced to date (see Fig. 1). From growth experiments and characterization of specific glycoside hydrolases (5Chhabra S.R. Shockley K.R. Ward D.E. Kelly R.M. Appl. Environ. Microbiol. 2002; 68: 545-554Crossref PubMed Scopus (91) Google Scholar), T. maritima is known to metabolize both polysaccharides and simple sugars, including carboxymethylcellulose, barley glucan, starch, galactomannan (5Chhabra S.R. Shockley K.R. Ward D.E. Kelly R.M. Appl. Environ. Microbiol. 2002; 68: 545-554Crossref PubMed Scopus (91) Google Scholar), xylan (6Bronnenmeier K. Kern A. Liebl W. Staudenbauer W.L. Appl. Environ. Microbiol. 1995; 61: 1399-1407Crossref PubMed Google Scholar), pectin, 1L. D. Kluskens, personal communication. 1L. D. Kluskens, personal communication. mannose, xylose, and glucose (2Galperin M.Y. Noll K.M. Romano A.H. Appl. Environ. Microbiol. 1996; 62: 2915-2918PubMed Google Scholar). In some cases, the proteins involved in the processing, transport, and utilization of these glycosides can be inferred from their apparent organization into operons in the T. maritimagenome sequence (4Nelson K.E. Clayton R.A. Gill S.R. Gwinn M.L. Dodson R.J. Haft D.H. Hickey E.K. Peterson J.D. Nelson W.C. Ketchum K.A. McDonald L. Utterback T.R. Malek J.A. Linher K.D. Garrett M.M. Stewart A.M. Cotton M.D. Pratt M.S. Phillips C.A. Richardson D. Heidelberg J. Sutton G.G. Fleischmann R.D. Eisen J.A. Fraser C.M. et al.Nature. 1999; 399: 323-329Crossref PubMed Scopus (1206) Google Scholar), whereas in other cases such classification is not clear. Regulation of genes encoding specific carbohydrate-active proteins in T. maritima has only been studied to a limited extent thus far (5Chhabra S.R. Shockley K.R. Ward D.E. Kelly R.M. Appl. Environ. Microbiol. 2002; 68: 545-554Crossref PubMed Scopus (91) Google Scholar, 7Nguyen T.N. Borges K.M. Romano A.H. Noll K.M. FEMS Microbiol. Lett. 2001; 195: 79-83Crossref PubMed Google Scholar), and the coordinated regulation of related genes involved in polysaccharide utilization has not been examined. Here, a targeted cDNA microarray, based on carbohydrate-active proteins from T. maritima, was used in conjunction with mixed model analysis (8Jin W. Riley R.M. Wolfinger R.D. White K.P. Passador-Gurgel G. Gibson G. Nat. Genet. 2001; 29: 389-395Crossref PubMed Scopus (522) Google Scholar, 9Wolfinger R.D. Gibson G. Wolfinger E.D. Bennett L. Hamadeh H. Bushel P. Afshari C. Paules R.S. J. Comput. Biol. 2001; 8: 625-637Crossref PubMed Scopus (856) Google Scholar) to explore issues related to saccharide utilization by this organism. Despite the fact thatT. maritima has been phylogenetically characterized as a primitive microorganism from an evolutionary perspective (10Achenbach-Richter L. Gupta R. Stetter K.O. Woese C.R. Syst. Appl. Microbiol. 1987; 9: 34-39Crossref PubMed Scopus (180) Google Scholar), results here support that it has versatile and discriminating mechanisms for regulating and effecting complex carbohydrate utilization. The relative importance of evolutionary processes and horizontal gene transfer (4Nelson K.E. Clayton R.A. Gill S.R. Gwinn M.L. Dodson R.J. Haft D.H. Hickey E.K. Peterson J.D. Nelson W.C. Ketchum K.A. McDonald L. Utterback T.R. Malek J.A. Linher K.D. Garrett M.M. Stewart A.M. Cotton M.D. Pratt M.S. Phillips C.A. Richardson D. Heidelberg J. Sutton G.G. Fleischmann R.D. Eisen J.A. Fraser C.M. et al.Nature. 1999; 399: 323-329Crossref PubMed Scopus (1206) Google Scholar) in developing its carbohydrate utilization capacity is not known, butT. maritima's ability to respond to various substrates in its growth environment underlies its ubiquity in global geothermal settings (11Nesbo C.L. Nelson K.E. Doolittle W.F. J. Bacteriol. 2002; 184: 4475-4488Crossref PubMed Scopus (55) Google Scholar). Open reading frames (total of 269) of known and putative genes related to sugar processing and other related metabolic functions were identified through BLAST (12Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Crossref PubMed Scopus (69678) Google Scholar) comparisons of protein sequences from the T. maritima MSB8 genome available on the World Wide Web at www.tigr.org/ tigrscripts/CMR2/GenomePage3.spl?database=btm. DNA primers were designed with similar annealing temperatures and minimal hairpin formation using Vector NTI 7.0 (Informax, Bethesda, MD). The selected probes were PCR-amplified in a PTC-100 Thermocycler (MJ Research, Inc., Waltham, MA) using Taq polymerase (Roche Molecular Biochemicals) and T. maritima genomic DNA, isolated as described previously (5Chhabra S.R. Shockley K.R. Ward D.E. Kelly R.M. Appl. Environ. Microbiol. 2002; 68: 545-554Crossref PubMed Scopus (91) Google Scholar). The integrity and concentration of the PCR products were verified on 1% agarose gels. PCR products were purified to 100 ng/μl using 96-well QIAquick PCR purification kits (Qiagen, Valencia, CA), resuspended in 50% Me2SO, and printed onto CMT-GAPS aminosilane-coated microscope slides (Corning Glass) using a 417 Arrayer (Affymetrix, Santa Clara, CA) in the North Carolina State University Genome Research Laboratory (Raleigh, NC). Eight replicates of each gene fragment were printed onto each slide. The DNA was then attached to the slides by UV cross-linking using a GS GeneLinker UV Chamber (Bio-Rad) set at 250 mJ and baked at 75 °C for 2 h. Growth ofT. maritima MSB8 cultures in artificial sea water was followed using optical density measurements and epifluorescence microscopic cell density enumeration, as described previously (5Chhabra S.R. Shockley K.R. Ward D.E. Kelly R.M. Appl. Environ. Microbiol. 2002; 68: 545-554Crossref PubMed Scopus (91) Google Scholar). Growth substrates glucose, mannose, xylose, β-xylan (birchwood), laminarin (Laminaria digitata), and starch (potato) were obtained from Sigma. Galactomannan (carob), glucomannan (konjac), carboxymethylcellulose, and β-glucan (barley) were obtained from Megazyme (Wicklow, Ireland). Growth substrates were prepared as described previously (5Chhabra S.R. Shockley K.R. Ward D.E. Kelly R.M. Appl. Environ. Microbiol. 2002; 68: 545-554Crossref PubMed Scopus (91) Google Scholar) and included in the medium at a final concentration of 0.25% (w/v). Substrate purities as provided by the manufacturers varied from 95 to 99%. To ensure minimum carryover between substrates, cells were grown for at least 10 passes on each carbon source using a 0.5% (v/v) starting innoculum before obtaining the growth curves. Specific growth rates on mono- and polysaccharide substrates were determined from the slopes of semilog plots of exponential cell growth versus time. Isolation of total RNA from T. maritima was performed on cells that were grown until early- to mid-exponential phase on the various growth substrates, as described in detail previously (5Chhabra S.R. Shockley K.R. Ward D.E. Kelly R.M. Appl. Environ. Microbiol. 2002; 68: 545-554Crossref PubMed Scopus (91) Google Scholar). First-strand cDNA was prepared from T. maritima total RNA using Stratascript (Stratagene, La Jolla, CA) and random hexamer primers (Invitrogen) by the incorporation of 5-[3-aminoallyl]-2′-deoxyuridine-5′-triphosphate (Sigma) as described elsewhere (13Hasseman J. TIGR Microarray Protocols. 2001; (http://www.tigr.org/tdb/microarray/protocolsTIGR.shtml)Google Scholar). The slides were scanned using a Scanarray 4000 scanner (GSI Lumonics and Billerica) in the North Carolina State University Genome Research Laboratory. Signal intensity data were obtained using Quantarray (GSI Lumonics). A loop design was constructed (see Fig. 2) to ensure reciprocal labeling for all 10 different experimental conditions. Replication of treatments, arrays, dyes, and cDNA spots allowed the use of analysis of variance (ANOVA)2 models for data analysis. ANOVAs are especially appropriate for loop designs in which a large number of conditions are compared with one another, eliminating uninteresting reference samples and allowing for the collection of more information on experimental conditions (14Kerr M.K. Churchill G.A. Genet. Res. 2001; 77: 123-128Crossref PubMed Scopus (465) Google Scholar). Mixed ANOVA models, in which some effects are considered fixed and others are considered random, have been used to re-examine published microarray data sets (9Wolfinger R.D. Gibson G. Wolfinger E.D. Bennett L. Hamadeh H. Bushel P. Afshari C. Paules R.S. J. Comput. Biol. 2001; 8: 625-637Crossref PubMed Scopus (856) Google Scholar) and examine the effects of sex, genotype, and age on transcription inDrosophila melanogaster (8Jin W. Riley R.M. Wolfinger R.D. White K.P. Passador-Gurgel G. Gibson G. Nat. Genet. 2001; 29: 389-395Crossref PubMed Scopus (522) Google Scholar). Using existing SAS procedures and customized Perl code, an automated data import system was developed to merge Quantarray intensity measurements, coordinate files generated by the array printer, and corresponding T. maritima locus numbers in a SAS data set (SAS Institute, Cary, NC). The data import system was verified through independent calculations in Excel (Microsoft, Seattle, WA). A linear normalization ANOVA model (9Wolfinger R.D. Gibson G. Wolfinger E.D. Bennett L. Hamadeh H. Bushel P. Afshari C. Paules R.S. J. Comput. Biol. 2001; 8: 625-637Crossref PubMed Scopus (856) Google Scholar) of log base 2 intensities was used to estimate global variation in the form of fixed (dye, treatment) and random (array, pin within array, pin spot within array) effects and random error using the following model: log2(y ijklmn) =m + Dj + T k +A i + A i(P1) +A i(S m P l) + εijklmn. The estimated effects calculated from this model were used to predict an expected intensity for each value, and then a residual was calculated as the difference between a replicate's observed and predicted intensity and then used as data to capture variation attributable to gene-specific effects after accounting for global variation. Gene-specific ANOVA models were then used to partition variation into gene-specific treatment effects, dye effects, and the same hierarchy of random effects described previously. Specifically, the model r ijklmn =m+ D i + T k +A i + A i(P1) +A i(S m P1) + εijklmn was fit separately to the residuals for each gene, and the resulting parameter estimates and S.E. values were then used for statistical inference. Volcano plots were used to visualize interesting contrasts or comparisons between two treatments or two groups of treatments (9Wolfinger R.D. Gibson G. Wolfinger E.D. Bennett L. Hamadeh H. Bushel P. Afshari C. Paules R.S. J. Comput. Biol. 2001; 8: 625-637Crossref PubMed Scopus (856) Google Scholar). A Bonferroni correction was utilized to adjust for the expected increase in false positives due to multiple comparisons (9Wolfinger R.D. Gibson G. Wolfinger E.D. Bennett L. Hamadeh H. Bushel P. Afshari C. Paules R.S. J. Comput. Biol. 2001; 8: 625-637Crossref PubMed Scopus (856) Google Scholar). Genes meeting the Bonferroni significance criteria were selected for further study, ensuring that genes with inconsistent fold changes would be eliminated from further analysis. Two complementary approaches were utilized to cluster data from T. maritima growth on 10 saccharides. To visualize the relative expression levels of all genes withina treatment, hierarchical clustering was performed on least squares means calculated from the linear models for each sugar (Fig. 3). To visualize the expression pattern of each single gene acrosstreatments, the least squares mean estimates were standardized using the mean and S.D. of the 10 least squares means estimates for a given gene. Each of the 10 least squares means estimates were standardized accordingly with the formula Y i = (X i − μ)/ς, where Y i = the standardized least squares means variable, μ = ΣX i/n, and ς = (Σ(X i − μ)2) 12. The standardized variable was then utilized for clustering (Fig. 3). For complete information on signal intensity, significance of expression changes, -fold changes, pairwise volcano plots, and hierarchical clustering for all of the genes included on the array, see the Supplemental Material. A targeted cDNA microarray for T. maritima was constructed that included 269 known and putative genes or about 15% of the total open reading frames in the T. maritima genome. This included the known set of genes related to glycoside utilization and modification (65 genes), proteolysis (40 genes), stress response, and proteolytic fermentation. Genes related to sugar transport (21 genes) or transcriptional regulation (69 genes) and 66 other genes of interest were also included. Genes apparently related to glycoside utilization and modification in T. maritima include 41 glycoside hydrolases, 17 glycosyl transferases, 6 carbohydrate esters, and 1 polysaccharide lyase. The corresponding encoded proteins have been classified into several families, based on amino acid sequence homology (15Henrissat B. Bairoch A. Biochem. J. 1996; 316: 695-696Crossref PubMed Scopus (1179) Google Scholar) (available on the World Wide Web at afmb.cnrs-mrs.fr/CAZY). There are over 130T. maritima proteins with sufficient BLAST homology to be classified into transcriptional regulatory or signal transduction COG categories (16Tatusov R.L. Natale D.A. Garkavtsev I.V. Tatusova T.A. Shankavaram U.T. Rao B.S. Kiryutin B. Galperin M.Y. Fedorova N.D. Koonin E.V. Nucleic Acids Res. 2001; 29: 22-28Crossref PubMed Scopus (1539) Google Scholar). These regulatory proteins have been assigned to families based on sequence homology; however, different proteins in the same families may have different DNA and substrate-binding specificities (17Mirny L.A. Gelfand M.S. J. Mol. Biol. 2002; 321: 7-20Crossref PubMed Scopus (116) Google Scholar). Also, proteins placed in different families may share the same name because of their regulon composition, as in the case of the Escherichia coli and Bacillus subtilis xylR protein (18Song S. Park C. J. Bacteriol. 1997; 179: 7025-7032Crossref PubMed Scopus (120) Google Scholar, 19Kreuzer P. Gartner D. Allmansberger R. Hillen W. J. Bacteriol. 1989; 171: 3840-3845Crossref PubMed Google Scholar). Of the 69 transcription/transduction genes on the array, six share similarity with the ROK (receptor, open reading frame,kinase) family of transcriptional regulators, which include glucokinases, B. subtilis XylR, and E. coli NagC (COG1940) (20Titgemeyer F. J. Cell. Biochem. 1993; 51: 69-74Crossref PubMed Scopus (19) Google Scholar). Six members of the PurR/LacI superfamily (COG1609) were included (21Mirny L.A. Gelfand M.S. Nucleic Acids Res. 2002; 30: 1704-1711Crossref PubMed Scopus (58) Google Scholar) along with the T. maritima IclR transcriptional regulator, whose structure was recently solved (22Zhang R.G. Kim Y. Skarina T. Beasley S. Laskowski R. Arrowsmith C. Edwards A. Joachimiak A. Savchenko A. J. Biol. Chem. 2002; 277: 19183-19190Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Several pairs of sensor histidine kinases and response regulators of putative two-component regulatory systems were included, as were regulators from the MarR (23Cohen S.P. Hachler H. Levy S.B. J. Bacteriol. 1993; 175: 1484-1492Crossref PubMed Scopus (274) Google Scholar), AraC (24Martin R.G. Rosner J.L. Curr. Opin. Microbiol. 2001; 4: 132-137Crossref PubMed Scopus (182) Google Scholar), TroR (25Hardham J.M. Stamm L.V. Porcella S.F. Frye J.G. Barnes N.Y. Howell J.K. Mueller S.L. Radolf J.D. Weinstock G.M. Norris S.J. Gene (Amst.). 1997; 197: 47-64Crossref PubMed Scopus (62) Google Scholar), LytR (26Nikolskaya A.N. Galperin M.Y. Nucleic Acids Res. 2002; 30: 2453-2459Crossref PubMed Scopus (147) Google Scholar), ArsR (27Diorio C. Cai J. Marmor J. Shinder R. DuBow M.S. J. Bacteriol. 1995; 177: 2050-2056Crossref PubMed Google Scholar), and CspC (28Phadtare S. Alsina J. Inouye M. Curr. Opin. Microbiol. 1999; 2: 175-180Crossref PubMed Scopus (271) Google Scholar) families. The T. maritima genome contains ∼120 genes involved in oligopeptide/sugar transport. In the targeted microarray used here, 21 genes related to sugar transport were included on the basis of their proximity to the genes involved in glycoside utilization. This targeted microarray was used to examine the differential response of T. maritima grown on a range of mono- and polysaccharides at its optimal growth temperature of 80 °C. Growth conditions were analyzed based on an incomplete loop design (Fig.2). Treatments in the loop design were balanced with respect to dyes so that treatment effects were not confounded with dye effects. T. maritima cultures were grown on a variety of saccharides, including the monosaccharides glucose, mannose, and xylose. The polysaccharides investigated differed in backbone sugar type (glucose, mannose, and xylose), backbone linkage type (β-1,3; β-1,4; or α-1,4), and side chain residue type (galactose, glucuronic acid, or glucose) (see TableI). Included in these were a mixed backbone (konjac glucomannan: glucose/mannose) and a mixed linkage (barley glucan: β-1,4/1,3) polysaccharide. Final cell densities were in the range of 108 to 109cells/ml in all cases. Doubling times (min) for galactomannan (carob), β-glucan (barley), laminarin (L. digitata), β-xylan (birchwood), starch (potato), glucomannan (konjac), and carboxymethylcellulose were estimated to be 85, 72, 143, 61, 117, 74, and 78, respectively. On the monosaccharides, the doubling times (min) were 162, 253, and 188, for glucose, mannose, and xylose, respectively. Under identical conditions, the average doubling time for growth on monosaccharides (201 min) was observed to be substantially higher than that on the corresponding polysaccharide substrates (90 min).Table ICarbon sources used in this studyPoly/monosaccharideSourceBackbone structureSide chainMassDaGlucoseNAaNA, not available.Glc180MannoseNAMan180XyloseNAXylbXyl, xylose.150GalactomannanCarob(Man β1→4 Man)nGal (α1→6)NAGlucomannanKonjac(Glc β1→4 Man)n100,000Carboxymethyl celluloseNA(Glc β1→4 Glc)n90,000β-1,3/1,4-GlucanBarley(Glc β1→3,4 Glc)n250,000LaminarinL. digitata(Glc β1→3 Glc)n5,000StarchPotato(Glc α1→4 Glc)nGlc (α→16)nNAβ-XylanBirchwood(Xyl β1→4 Xyl)nGlr (α1→6)cGlr, glucuronic acid.NAa NA, not available.b Xyl, xylose.c Glr, glucuronic acid. Open table in a new tab Two hierarchical clusters are shown in Fig.3 to summarize the expression patterns of 269 T. maritima genes during growth on 10 saccharides. The first cluster is based on least squares means and compares the normalized expression levels of all genes within each treatment condition. The second cluster is based on standardized least squares means for a single gene across all 10 treatments to show the effect of different treatments on the relative expression of a particular gene. The hierarchical clustering based on standardized least squares means revealed many cases of apparent co-regulation of genes within potential operons (29McGuire A.M. Hughes J.D. Church G.M. Genome Res. 2000; 10: 744-757Crossref PubMed Scopus (160) Google Scholar). Several sets of spatially distant gene strings were observed to cluster with similar expression profiles, suggesting the presence of regulons in the T. maritima genome. Representative clusters are displayed in Fig.4. Overall expression levels of a number of genes remained consistently high or low regardless of the growth condition. These included constitutively expressed genes like TM0017 (pyruvate ferredoxin oxidoreductase) and TM0688 (glyceraldehyde-3-phosphate dehydrogenase) (30Blamey J.M. Adams M.W. Biochemistry. 1994; 33: 1000-1007Crossref PubMed Scopus (92) Google Scholar) as well as genes related to proteolytic activity. Both sets of genes with the corresponding known or putative functions are displayed in Fig. 5. Individual genes with high overall expression levels on only a single carbon source are indicated in Table II. Least squares means for all genes included in this study for all growth conditions are shown in Supplemental Table IV, along with the corresponding standardized values in Supplemental Table V. Below, gene regulation patterns within each functional category are examined for each monosaccharide and corresponding polysaccharide growth substrate.Figure 4Substrate-dependent regulation. Sample Clusters constructed using standardized least squares means. Known or putative functions as reported in the genome sequence are indicated.View Large Image Figure ViewerDownload (PPT)Figure 4Substrate-dependent regulation. Sample Clusters constructed using standardized least squares means. Known or putative functions as reported in the genome sequence are indicated.View Large Image Figure ViewerDownload (PPT)Figure 5Genes with overall high or low expression levels for all growth substrates. Clusters constructed using least squares means. Known or putative functions as reported in the genome sequence are indicated.View Large Image Figure ViewerDownload (PPT)Table IIGenes with high overall expression levels (log2R ≥ 0.6) on indicated growth substrateGrowth substrateLocusFunctionCarboxymethylcelluloseTM0963Oligoendopeptidase, putativeMannoseTM1755Phosphate butyryltransferaseTM1754Butyrate kinase, putativeTM1756Branched chain fatty acid kinase, putativeLaminarinTM0024LaminarinaseTM0032Transcriptional regulator, XylR-relatedStarchTM1835Cyclomaltodextrinase, putativeTM1840α-AmylaseTM1845PullulanaseXylanTM0055α-GlucuronidaseTM0065Transcriptional regulator, IclR familyXyloseTM0949Transcriptional regulator, LacI family Open table in a new tab Backbone- and linkage-specific gene regulation was observed in the case of endoglycoside hydrolase genes for growth on α- and β-specific glucans. Growth on carboxymethylcellulose (CMC) (see cluster 4.1), a β-1,4-linked glucose polymer, induced genes encoding extracellular endoglucanases TM1525 (cel12B) and TM0305 (cel74), as well as the intracellular endoglucanase TM1524 (cel12A) and the intracellular cellobiosyl phosphorylase, TM1848. Examination of cluster I (Fig. 3) reveals that expression levels of cel74 were substantially lower than those ofcel12A on glucan polysaccharides. Although the presence of a β-1,4-glucosidase gene (bglA) (accession number CAA52276) in T. maritima MSB8 has been reported (31Liebl W. Methods Enzymol. 2001; 330: 290-300Crossref PubMed Scopus (16) Google Scholar), the corresponding protein sequence does not show homology to deduced sequences identified in the T. maritima MSB8 genome (4Nelson K.E. Clayton R.A. Gill S.R. Gwinn M.L. Dodson R.J. Haft D.H. Hickey E.K. Peterson J.D. Nelson W.C. Ketchum K.A. McDonald L. Utterback T.R. Malek J.A. Linher K.D. Garrett M.M. Stewart}, number={9}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Chhabra, SR and Shockley, KR and Conners, SB and Scott, KL and Wolfinger, RD and Kelly, RM}, year={2003}, month={Feb}, pages={7540–7552} }
 @article{gao_bauer_shockley_pysz_kelly_2003, title={Growth of hyperthermophilic Archaeon Pyrococcus futiosus on chitin involves two family 18 chitinases}, volume={69}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.69.6.3119-3128.2003}, abstractNote={ABSTRACT Pyrococcus furiosus was found to grow on chitin, adding this polysacharide to the inventory of carbohydrates utilized by this hyperthermophilic archaeon. Accordingly, two open reading frames ( chiA [Pf1234] and chiB [Pf1233]) were identified in the genome of P. furiosus , which encodes chitinases with sequence similarity to proteins from the glycosyl hydrolase family 18 in less-thermophilic organisms. Both enzymes contain multiple domains that consist of at least one binding domain and one catalytic domain. ChiA (ca. 39 kDa) contains a putative signal peptide, as well as a binding domain (ChiA BD ), that is related to binding domains associated with several previously studied bacterial chitinases. chiB , separated by 37 nucleotides from chiA and in the same orientation, encodes a polypeptide with two different proline-threonine-rich linker regions (6 and 3 kDa) flanking a chitin-binding domain (ChiB BD [11 kDa]), followed by a catalytic domain (ChiB cat [35 kDa]). No apparent signal peptide is encoded within chiB . The two chitinases share little sequence homology to each other, except in the catalytic region, where both have the catalytic glutamic acid residue that is conserved in all family 18 bacterial chitinases. The genes encoding ChiA, without its signal peptide, and ChiB were cloned and expressed in Escherichia coli. ChiA exhibited no detectable activity toward chitooligomers smaller than chitotetraose, indicating that the enzyme is an endochitinase. Kinetic studies showed that ChiB followed Michaelis-Menten kinetics toward chitotriose, although substrate inhibition was observed for larger chitooligomers. Hydrolysis patterns on chitooligosaccharides indicated that ChiB is a chitobiosidase, processively cleaving off chitobiose from the nonreducing end of chitin or other chitooligomers. Synergistic activity was noted for the two chitinases on colloidal chitin, indicating that these two enzymes work together to recruit chitin-based substrates for P. furiosus growth. This was supported by the observed growth on chitin as the sole carbohydrate source in sulfur-free media.}, number={6}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Gao, J and Bauer, MW and Shockley, KR and Pysz, MA and Kelly, RM}, year={2003}, month={Jun}, pages={3119–3128} }
 @article{shockley_ward_chhabra_conners_montero_kelly_2003, title={Heat shock response by the hyperthermophilic archaeon Pyrococcus furiosus}, volume={69}, ISSN={["1098-5336"]}, DOI={10.1128/AEM.69.4.2365-2371.2003}, abstractNote={ABSTRACT Collective transcriptional analysis of heat shock response in the hyperthermophilic archaeon Pyrococcus furiosus was examined by using a targeted cDNA microarray in conjunction with Northern analyses. Differential gene expression suggests that P . furiosus relies on a cooperative strategy of rescue (thermosome [Hsp60], small heat shock protein [Hsp20], and two VAT-related chaperones), proteolysis (proteasome), and stabilization (compatible solute formation) to cope with polypeptide processing during thermal stress.}, number={4}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Shockley, KR and Ward, DE and Chhabra, SR and Conners, SB and Montero, CI and Kelly, RM}, year={2003}, month={Apr}, pages={2365–2371} }
 @inbook{gao_ward_kelly_2003, place={Hoboken, NJ}, title={Hyperthermophiles}, ISBN={0471263397 9780471263395}, url={http://dx.doi.org/10.1002/0471263397.env256}, DOI={10.1002/0471263397.env256}, abstractNote={Hyperthermophilic Environments Isolation and Cultivation of Hyperthermophiles Metabolism of Hyperthermophiles Genetics of Hyperthermophiles Microbial Ecology of Hyperthermophiles}, booktitle={Encyclopedia of Environmental Microbiology}, publisher={John Wiley & Sons, Inc.}, author={Gao, Jun and Ward, Donald F. and Kelly, Robert M.}, year={2003}, month={Jan} }
 @inproceedings{montero_conners_johnson_pysz_shockley_kelly_2003, title={Microbial ecology of hydrothermal biotypes}, volume={5163}, DOI={10.1117/12.514744}, abstractNote={Hydrothermal environments, whether terrestrial or marine, provide a window into potentially thriving ecosystems on other solar bodies. If such extraterrestrial biotopes do exist, they might be inhabited by extremophilic microorganisms, perhaps related to hyperthermophiles (optimal growth temperature > 80&deg;C) previously characterized from geothermal sites on this planet. Study of the physiological and metabolic patterns in hyperthermophiles will shed light on microbial lifestyles consistent with putative hydrothermal niches on other planets and moons.}, booktitle={Proceedings:  Optical science and technology, SPIE's 48th Annual Meeting}, publisher={SPIE}, author={Montero, C.I. and Conners, S.B. and Johnson, M.R. and Pysz, M.A. and Shockley, K.R. and Kelly, R.M.}, editor={Hoover, R.B. and Rozanov, A.Y.Editors}, year={2003}, month={Aug} }
 @article{sehgal_kelly_2003, title={Strategic selection of hyperthermophilic esterases for resolution of 2-arylpropionic esters}, volume={19}, ISSN={["8756-7938"]}, DOI={10.1021/bp034032c}, abstractNote={Homologues to Carboxylesterase NP and Candida rugosa lipase, used for the chiral separation of racemic mixtures of 2-arylpropionic methyl esters, were identified by BLAST searches of available genome sequences for hyperthermophilic microorganisms. Two potential candidates were identified: a putative lysophospholipase from Pyrococcus furiosus (Pfu-LPL) and a carboxylesterase from Sulfolobus solfataricus P1 (Sso-EST1). Although both enzymes showed hydrolytic preference toward the (S) methyl ester, only Sso-EST1 yielded highly optically pure (S) naproxen (%ee(p) >/= 90) and was thus further investigated. Changes in pH or reaction time showed little improvement in %ee(p) or E values with Sso-EST1. However, the addition of 25% methanol resulted in a 25% increase in E. The effect of various cosolvents on the enantiomeric ratio showed no correlation with the log P or dielectric constant values of the solvent. However, an inverse relationship between E and the denaturation capacity (DC) of the water miscible cosolvents was observed. This was attributed to an increase in enzyme flexibility with increasing solvent DC values leading to a concomitant reduction in the resolving power of Sso-EST1. The results here show that although bioinformatics tools can be used to select candidate biocatalysts for chiral resolution of 2-arylpropionic esters, biochemical characterization is needed to definitively determine functional characteristics.}, number={5}, journal={BIOTECHNOLOGY PROGRESS}, author={Sehgal, AC and Kelly, RM}, year={2003}, pages={1410–1416} }
 @article{chhabra_kelly_2002, title={Biochemical characterization of Thermotoga maritima endoglucanase Ce174 with and without a carbohydrate binding module (CBM)}, volume={531}, ISSN={["1873-3468"]}, DOI={10.1016/S0014-5793(02)03493-2}, abstractNote={The genome of the hyperthermophilic bacterium Thermotoga maritima (Tm) encodes at least eight glycoside hydrolases with putative signal peptides; the biochemical characteristics of seven of these have been reported previously. The eighth, Tm Cel74, is encoded by an open reading frame of 2124 bp corresponding to a polypeptide of 79 kDa with a signal peptide at the amino-terminus. The gene (lacking the signal peptide) encoding Tm Cel74 was expressed as a 77 kDa monomeric polypeptide in Escherichia coli and found to be optimally active at pH 6, 90 degrees C, with a melting temperature of approximately 105 degrees C. The cel74 gene was previously found to be induced during T. maritima growth on a variety of polysaccharides, including barley glucan, carboxymethyl cellulose (CMC), glucomannan, galactomannan and starch. However, while Tm Cel74 was most active towards barley glucan and to a lesser extent CMC, glucomannan and tamarind (xyloglucan), no activity was detected on other glycans, including galactomannan, laminarin and starch. Also, Tm Cel74 did not contain a carbohydrate binding module (CBM), versions of which have been identified in the amino acid sequences of other family 74 enzymes. As such, a CBM associated with a chitinase in another hyperthermophile, Pyrococcus furiosus, was used to create a fusion protein that was active on crystalline cellulose; Tm Cel74 lacked activity on this substrate. Based on the cleavage pattern determined for Tm Cel74 on glucan-based substrates, this enzyme likely initiates recruitment of carbohydrate carbon and energy sources by creating oligosaccharides that are transported into the cell for further processing.}, number={2}, journal={FEBS LETTERS}, author={Chhabra, SR and Kelly, RM}, year={2002}, month={Nov}, pages={375–380} }
 @misc{kelly_khan_leduc_tayal_prud'homme_2002, title={Compositions for fracturing subterranean formations}, volume={6,428,995}, number={2002 Aug. 6}, publisher={Washington, DC: U.S. Patent and Trademark Office}, author={Kelly, R. M. and Khan, S. A. and Leduc, P. and Tayal, A. and Prud'homme, R. K.}, year={2002} }
 @article{sehgal_kelly_2002, title={Enantiomeric resolution of 2-aryl propionic esters with hyperthermophilic and mesophilic esterases: Contrasting thermodynamic mechanisms}, volume={124}, ISSN={["0002-7863"]}, DOI={10.1021/ja026512q}, abstractNote={The enantiomeric resolution of 2-aryl propionic esters by hyperthermophilic and mesophilic esterases was found to be governed by contrasting thermodynamic mechanisms. Entropic contributions predominated for mesophilic esterases from Candida rugosa and Rhizomucor miehei, while enthalpic forces controlled this resolution by the esterase from the extremely thermoacidophilic archaeon, Sulfolobus solfataricus P1. This disparity in thermodynamic mechanism can be attributed to the differences in conformational flexibility of mesophilic and thermophilic enzymes as they relate to the temperature range (4-70 degrees C) examined.}, number={28}, journal={JOURNAL OF THE AMERICAN CHEMICAL SOCIETY}, author={Sehgal, AC and Kelly, RM}, year={2002}, month={Jul}, pages={8190–8191} }
 @inbook{tayal_pai_kelly_khan_2002, title={Enzymatic Modification of Guar Solutions}, ISBN={9780306459313 9780306469152}, url={http://dx.doi.org/10.1007/0-306-46915-4_4}, DOI={10.1007/0-306-46915-4_4}, booktitle={Water Soluble Polymers}, publisher={Springer US}, author={Tayal, Akash and Pai, Vandita and Kelly, Robert M. and Khan, Saad A.}, editor={Amjad, Z.Editor}, year={2002}, pages={41–49} }
 @article{bandlish_hess_epting_vieille_kelly_2002, title={Glucose-to-fructose conversion at high temperatures with xylose (glucose) isomerases from Streptomyces murinus and two hyperthermophilic Thermotoga species}, volume={80}, ISSN={["0006-3592"]}, DOI={10.1002/bit.10362}, abstractNote={The conversion of glucose to fructose at elevated temperatures, as catalyzed by soluble and immobilized xylose (glucose) isomerases from the hyperthermophiles Thermotoga maritima (TMGI) and Thermotoga neapolitana 5068 (TNGI) and from the mesophile Streptomyces murinus (SMGI), was examined. At pH 7.0 in the presence of Mg2+, the temperature optima for the three soluble enzymes were 85°C (SMGI), 95° to 100°C (TNGI), and >100°C (TMGI). Under certain conditions, soluble forms of the three enzymes exhibited an unusual, multiphasic inactivation behavior in which the decay rate slowed considerably after an initial rapid decline. However, the inactivation of the enzymes covalently immobilized to glass beads, monophasic in most cases, was characterized by a first-order decay rate intermediate between those of the initial rapid and slower phases for the soluble enzymes. Enzyme productivities for the three immobilized GIs were determined experimentally in the presence of Mg2+. The highest productivities measured were 750 and 760 kg fructose per kilogram SMGI at 60°C and 70°C, respectively. The highest productivity for both TMGI and TNGI in the presence of Mg2+ occurred at 70°C, pH 7.0, with approximately 230 and 200 kg fructose per kilogram enzyme for TNGI and TMGI, respectively. At 80°C and in the presence of Mg2+, productivities for the three enzymes ranged from 31 to 273. A simple mathematical model, which accounted for thermal effects on kinetics, glucose–fructose equilibrium, and enzyme inactivation, was used to examine the potential for high-fructose corn syrup (HFCS) production at 80°C and above using TNGI and SMGI under optimal conditions, which included the presence of both Co2+ and Mg2+. In the presence of both cations, these enzymes showed the potential to catalyze glucose-to-fructose conversion at 80°C with estimated lifetime productivities on the order of 2000 kg fructose per kilogram enzyme, a value competitive with enzymes currently used at 55° to 65°C, but with the additional advantage of higher fructose concentrations. At 90°C, the estimated productivity for SMGI dropped to 200, whereas, for TNGI, lifetime productivities on the order of 1000 were estimated. Assuming that the most favorable biocatalytic and thermostability features of these enzymes can be captured in immobilized form and the chemical lability of substrates and products can be minimized, HFCS production at high temperatures could be used to achieve higher fructose concentrations as well as create alternative processing strategies. © 2002 Wiley Periodicals, Inc. Biotechnol Bioeng 80: 185–194, 2002.}, number={2}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Bandlish, RK and Hess, JM and Epting, KL and Vieille, C and Kelly, RM}, year={2002}, month={Oct}, pages={185–194} }
 @article{ward_shockley_chang_levy_michel_conners_kelly_2002, title={Proteolysis in hyperthermophilic microorganisms}, volume={1}, ISSN={1472-3646 1472-3654}, url={http://dx.doi.org/10.1155/2002/503191}, DOI={10.1155/2002/503191}, abstractNote={Proteases are found in every cell, where they recognize and break down unneeded or abnormal polypeptides or peptide-based nutrients within or outside the cell. Genome sequence data can be used to compare proteolytic enzyme inventories of different organisms as they relate to physiological needs for protein modification and hydrolysis. In this review, we exploit genome sequence data to compare hyperthermophilic microorganisms from the euryarchaeotal genus Pyrococcus , the crenarchaeote Sulfolobus solfataricus , and the bacterium Thermotoga maritima . An overview of the proteases in these organisms is given based on those proteases that have been characterized and on putative proteases that have been identified from genomic sequences, but have yet to be characterized. The analysis revealed both similarities and differences in the mechanisms utilized for proteolysis by each of these hyperthermophiles and indicated how these mechanisms relate to proteolysis in less thermophilic cells and organisms.}, number={1}, journal={Archaea}, publisher={Hindawi Limited}, author={Ward, Donald E. and Shockley, Keith R. and Chang, Lara S. and Levy, Ryan D. and Michel, Joshua K. and Conners, Shannon B. and Kelly, Robert M.}, year={2002}, pages={63–74} }
 @article{chhabra_shockley_ward_kelly_2002, title={Regulation of endo-acting glycosyl hydrolases in the hyperthermophilic bacterium Thermotoga maritima grown on glucan- and mannan-based polysaccharides}, volume={68}, ISSN={["0099-2240"]}, DOI={10.1128/AEM.68.2.545-554.2002}, abstractNote={ABSTRACT The genome sequence of the hyperthermophilic bacterium Thermotoga maritima encodes a number of glycosyl hydrolases. Many of these enzymes have been shown in vitro to degrade specific glycosides that presumably serve as carbon and energy sources for the organism. However, because of the broad substrate specificity of many glycosyl hydrolases, it is difficult to determine the physiological substrate preferences for specific enzymes from biochemical information. In this study, T. maritima was grown on a range of polysaccharides, including barley β-glucan, carboxymethyl cellulose, carob galactomannan, konjac glucomannan, and potato starch. In all cases, significant growth was observed, and cell densities reached 10 9 cells/ml. Northern blot analyses revealed different substrate-dependent expression patterns for genes encoding the various endo-acting β-glycosidases; these patterns ranged from strong expression to no expression under the conditions tested. For example, cel74 (TM0305), a gene encoding a putative β-specific endoglucananse, was strongly expressed on all substrates tested, including starch, while no evidence of expression was observed on any substrate for lam16 (TM0024), xyl10A (TM0061), xyl10B (TM0070), and cel12A (TM1524), which are genes that encode a laminarinase, two xylanases, and an endoglucanase, respectively. The cel12B (TM1525) gene, which encodes an endoglucanase, was expressed only on carboxymethyl cellulose. An extracellular mannanase encoded by man5 (TM1227) was expressed on carob galactomannan and konjac glucomannan and to a lesser extent on carboxymethyl cellulose. An unexpected result was the finding that the cel5A (TM1751) and cel5B (TM1752) genes, which encode putative intracellular, β-specific endoglucanases, were induced only when T. maritima was grown on konjac glucomannan. To investigate the biochemical basis of this finding, the recombinant forms of Man5 ( M r , 76,900) and Cel5A ( M r , 37,400) were expressed in Escherichia coli and characterized. Man5, a T. maritima extracellular enzyme, had a melting temperature of 99°C and an optimun temperature of 90°C, compared to 90 and 80°C, respectively, for the intracellular enzyme Cel5A. While Man5 hydrolyzed both galactomannan and glucomannan, no activity was detected on glucans or xylans. Cel5A, however, not only hydrolyzed barley β-glucan, carboxymethyl cellulose, xyloglucan, and lichenin but also had activity comparable to that of Man5 on galactomannan and higher activity than Man5 on glucomannan. The biochemical characteristics of Cel5A, the fact that Cel5A was induced only when T. maritima was grown on glucomannan, and the intracellular localization of Cel5A suggest that the physiological role of this enzyme includes hydrolysis of glucomannan oligosaccharides that are transported following initial hydrolysis by extracellular glycosidases, such as Man5.}, number={2}, journal={APPLIED AND ENVIRONMENTAL MICROBIOLOGY}, author={Chhabra, SR and Shockley, KR and Ward, DE and Kelly, RM}, year={2002}, month={Feb}, pages={545–554} }
 @book{kelly_brown_costantino_anfinsen_2002, title={Saccharification enzymes from hyperthermophilic bacteria and processes for their production}, number={6,355,467}, author={Kelly, R.M. and Brown, S.H. and Costantino, H.R. and Anfinsen, C.B.}, year={2002}, month={Mar} }
 @article{sehgal_tompson_cavanagh_kelly_2002, title={Structural and catalytic response to temperature and cosolvents of carboxylesterase EST1 from the extremely thermoacidophilic archaeon Sulfolobus solfataricus P1}, volume={80}, ISSN={["0006-3592"]}, DOI={10.1002/bit.10433}, abstractNote={The interactive effects of temperature and cosolvents on the kinetic and structural features of a carboxylesterase from the extremely thermoacidophilic archaeon Sulfolobus solfataricus P1 (Sso EST1) were examined. While dimethylformamide, acetonitrile, and dioxane were all found to be deleterious to enzyme function, dimethyl sulfoxide (DMSO) activated Sso EST1 to various extents. This was particularly true at 3.5% (v/v) DMSO, where k(cat) was 20-30% higher than at 1.2% DMSO, over the temperature range of 50-85 degrees C. DMSO compensated for thermal activation in some cases; for example, k(cat) at 60 degrees C in 3.5% DMSO was comparable to k(cat) at 85 degrees C in 1.2% DMSO. The relationship between DMSO activation and enzyme structural characteristics was also investigated. Nuclear magnetic resonance spectroscopy and circular dichroism showed no gross change in enzyme conformation with 3.5% DMSO between 50 and 80 degrees C. However, low levels of DMSO were shown to have a small yet significant change in enzyme conformation. This was evident through the reduction of Sso EST1's melting temperature and changes in the microenvironment of the enzyme's tyrosine and tryptophan residues at 3.5% versus 1.2% (v/v) solvent. Finally, activation parameter analysis based on kinetic data, at 1.2% and 3.5% DMSO, implied an increase in conformational flexibility with additional cosolvent. These results suggest the activating effect of DMSO was related to small changes in the enzyme's structure resulting in an increase in its conformational flexibility. Thus, in addition to their use for solubilizing hydrophobic substrates in water, cosolvents may also serve as activators in applications involving thermostable biocatalysts at sub-optimal temperatures.}, number={7}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Sehgal, AC and Tompson, R and Cavanagh, J and Kelly, RM}, year={2002}, month={Dec}, pages={784–793} }
 @article{vieille_epting_kelly_zeikus_2001, title={Bivalent cations and amino-acid composition contribute to the thermostability of Bacillus licheniformis xylose isomerase}, volume={268}, ISSN={["0014-2956"]}, DOI={10.1046/j.0014-2956.2001.02587.x}, abstractNote={Comparative analysis of genome sequence data from mesophilic and hyperthermophilic micro-organisms has revealed a strong bias against specific thermolabile amino-acid residues (i.e. N and Q) in hyperthermophilic proteins. The N + Q content of class II xylose isomerases (XIs) from mesophiles, moderate thermophiles, and hyperthermophiles was examined. It was found to correlate inversely with the growth temperature of the source organism in all cases examined, except for the previously uncharacterized XI from Bacillus licheniformis DSM13 (BLXI), which had an N + Q content comparable to that of homologs from much more thermophilic sources. To determine whether BLXI behaves as a thermostable enzyme, it was expressed in Escherichia coli, and the thermostability and activity properties of the recombinant enzyme were studied. Indeed, it was optimally active at 70-72 degrees C, which is significantly higher than the optimal growth temperature (37 degrees C) of B. licheniformis. The kinetic properties of BLXI, determined at 60 degrees C with glucose and xylose as substrates, were comparable to those of other class II XIs. The stability of BLXI was dependent on the metallic cation present in its two metal-binding sites. The enzyme thermostability increased in the order apoenzyme < Mg2+-enzyme < Co2+-enzyme approximately Mn2+-enzyme, with melting temperatures of 50.3 degrees C, 53.3 degrees C, 73.4 degrees C, and 73.6 degrees C. BLXI inactivation was first-order in all conditions examined. The energy of activation for irreversible inactivation was also strongly influenced by the metal present, ranging from 342 kJ x mol(-1) (apoenzyme) to 604 kJ x mol(-1) (Mg2+-enzyme) to 1166 kJ x mol(-1) (Co2+-enzyme). These results suggest that the first irreversible event in BLXI unfolding is the release of one or both of its metals from the active site. Although N + Q content was an indicator of thermostability for class II XIs, this pattern may not hold for other sets of homologous enzymes. In fact, the extremely thermostable alpha-amylase from B. licheniformis was found to have an average N + Q content compared with homologous enzymes from a variety of mesophilic and thermophilic sources. Thus, it would appear that protein thermostability is a function of more complex molecular determinants than amino-acid content alone.}, number={23}, journal={EUROPEAN JOURNAL OF BIOCHEMISTRY}, author={Vieille, C and Epting, KL and Kelly, RM and Zeikus, JG}, year={2001}, month={Dec}, pages={6291–6301} }
 @inbook{sehgal_callen_mathur_short_kelly_2001, title={Carboxylesterase from Sulfolobus solfataricus P1}, ISBN={9780121822316}, ISSN={0076-6879}, url={http://dx.doi.org/10.1016/s0076-6879(01)30398-1}, DOI={10.1016/s0076-6879(01)30398-1}, abstractNote={Publisher Summary To date, relatively few investigations regarding the purification and characterization of thermostable (T opt > 60 °) esterases have been conducted. Thus far, esterases from Bacillus acidocaldarius, Pyrococcus furiosus , Bacillus stearothermophilus , Sulfolobus shibatae , Thermoanaerobacterium sp, Pyrococcus abyssi , and Sulfolobus acidocaldarius have been studied to varying extents. Those thermostable esterases that have been evaluated vary significantly with respect to molecular mass, although their biochemical properties, such as pH optimum and substrate specificity, are quite similar. This chapter describes the cloning, expression, purification, and characterization of a recombinant carboxylesterase (Sso P1 carboxylesterase) from the extreme thermoacidophile Sulfolobus solfataricus P1. S. solfataricus , which is a member of the Crenarchaeota, can be found in sulfurous caldrons and volcanic muds.}, booktitle={Methods in Enzymology}, publisher={Elsevier}, author={Sehgal, A.C and Callen, Walter and Mathur, Eric J and Short, J.M and Kelly, Robert M}, year={2001}, pages={461–471} }
 @article{sehgal_callen_mathur_short_kelly_2001, title={Carboxylesterase from Sulfolobus solfataricus P1}, volume={330}, journal={Hyperthermophilic enzymes. Part A}, publisher={San Diego, Calif.: Academic Press}, author={Sehgal, A. C. and Callen, W. and Mathur, E. J. and Short, J. M. and Kelly, R. M.}, year={2001}, pages={461–471} }
 @misc{kelly_khan_leduc_tayal_prud'homme_2001, title={Compositions for fracturing subterranean formations}, volume={6,197,730}, number={2001 Mar. 6}, publisher={Washington, DC: U.S. Patent and Trademark Office}, author={Kelly, R. M. and Khan, S. A. and Leduc, P. and Tayal, A. and Prud'homme, R. K.}, year={2001} }
 @article{pysz_rinker_shockley_kelly_2001, title={Continuous cultivation of hyperthermophiles}, volume={330}, DOI={10.1016/S0076-6879(01)30369-5}, abstractNote={This chapter describes a continuous culture system that can generate biomass from hyperthermophiles on a scale suitable for enzyme purification. Hightemperature chemostats have several advantages over large-scale batch systems. Long-term, stable, steady-state operation (arising from minimal problems with contamination) can provide biomass generated from exponential growth phase—that is, balanced growth. Because of the smaller operating volumes, continuous systems are inexpensive to construct and minimize problems with handling toxic and explosive gas substrates and products—for example, H2S, He, CH4. Small operating volumes also minimize problems associated with the growth of sulfide-producing anaerobes and thermoacidophiles in terms of choosing a proper material for reactor construction—for example, glass and gold. Continuous cultivation has also been useful for studying the bioenergetics and physiology of hyperthermophiles and for developing media formulations that induce enzyme expression.}, journal={Methods in Enzymology}, publisher={San Diego, Calif.: Academic Press}, author={Pysz, M.A. and Rinker, K.D. and Shockley, K.R. and Kelly, R.M.}, year={2001}, pages={31–40} }
 @article{parker_chhabra_lam_callen_duffaud_snead_short_mathur_kelly_2001, title={Galactomannanases man2 and man5 from Thermotoga species: Growth physiology on galactomannans, gene sequence analysis, and biochemical properties of recombinant enzymes}, volume={75}, ISSN={["0006-3592"]}, DOI={10.1002/bit.10020}, abstractNote={The enzymatic hydrolysis of mannan-based hemicelluloses is technologically important for applications ranging from pulp and paper processing to food processing to gas and oil well stimulation. In many cases, thermostability and activity at elevated temperatures can be advantageous. To this end, the genes encoding beta-mannosidase (man2) and beta-mannanase (man5) from the hyperthermophilic bacteria Thermotoga neapolitana 5068 and Thermotoga maritima were isolated, cloned, and expressed in Escherichia coli. The amino acid sequences for the mannosidases from these organisms were 77% identical and corresponded to proteins with an M(r) of approximately 92 kDa. The translated nucleotide sequences for the beta-mannanase genes (man5) encoded polypeptides with an M(r) of 76 kDa that exhibited 84% amino acid sequence identity. The recombinant versions of Man2 and Man5 had similar respective biochemical and biophysical properties, which were also comparable to those determined for the native versions of these enzymes in T. neapolitana. The optimal temperature and pH for the recombinant Man2 and Man5 from both organisms were approximately 90 degrees C and 7.0, respectively. The presence of Man2 and Man5 in these two Thermotoga species indicates that galactomannan is a potential growth substrate. This was supported by the fact that beta-mannanase and beta-mannosidase activities were significantly stimulated when T. neapolitana was grown on guar or carob galactomannan. Maximum cell densities increased by at least tenfold when either guar or carob galactomannan was added to the growth medium. For T. neapolitana grown on guar at 83 degrees C, Man5 was secreted into the culture media, whereas Man2 was intracellular. These localizations were consistent with the presence and lack of signal peptides for Man5 and Man2, respectively. The identification of the galactomannan-degrading enzymes in these Thermotoga species adds to the list of biotechnologically important hemicellulases produced by members of this hyperthermophilic genera.}, number={3}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Parker, KN and Chhabra, SR and Lam, D and Callen, W and Duffaud, GD and Snead, MA and Short, JM and Mathur, EJ and Kelly, RM}, year={2001}, month={Nov}, pages={322–333} }
 @inbook{hicks_chang_kelly_2001, title={Homomultimeric protease and putative bacteriocin homolog from Thermotoga maritima}, ISBN={9780121822316}, ISSN={0076-6879}, url={http://dx.doi.org/10.1016/s0076-6879(01)30397-x}, DOI={10.1016/s0076-6879(01)30397-x}, abstractNote={Publisher Summary Thermotoga maritima is an anaerobic heterotroph belonging to the bacterial order Thermotogales that grows optimally at 80° by fermentation of carbohydrates and proteins, including starch, glucose, galactose, glycogen, and yeast extract. The bacterium is also able to reduce thiosulfate to sulfide, with an improved growth rate. Although the microorganism is a facultative sulfur reducer, the reduction of sulfur does not provide an energetic boost as seen by the lack of effect on growth yields and fermentation balances. T. maritima appears to be motile, migrating at a speed proportional to the temperature. This chapter describes the purification protocols used to isolate maritimacin, as well as the biochemical assays used to measure its activity.}, booktitle={Methods in Enzymology}, publisher={Elsevier}, author={Hicks, Paula M and Chang, Lara S and Kelly, Robert M}, year={2001}, pages={455–460} }
 @article{hicks_chang_kelly_2001, title={Homomultimeric protease and putative bacteriocin homolog from Thermotoga maritima}, volume={330}, journal={Hyperthermophilic enzymes. Part A}, publisher={San Diego, Calif.: Academic Press}, author={Hicks, P. M. and Chang, L. S. and Kelly, R. M.}, year={2001}, pages={455–460} }
 @book{adams_kelly_2001, place={New York}, title={Hyperthermophilic Enzymes, Part A}, volume={330}, journal={Methods in Enzymology}, publisher={Academic Press}, year={2001}, pages={3–513} }
 @book{adams_kelly_2001, place={New York}, title={Hyperthermophilic Enzymes, Part B}, volume={331}, journal={Methods in Enzymology}, publisher={Academic Press}, year={2001}, pages={3–494} }
 @book{adams_kelly_2001, place={New York}, title={Hyperthermophilic Enzymes, Part C}, volume={334}, journal={Methods in Enzymology}, publisher={Academic Press}, year={2001}, pages={3–526} }
 @book{kelly_khan_leduc_tayal_prud'homme_2001, title={Methods and compositions for fracturing subterranean formations}, number={6,197,730}, author={Kelly, R.M. and Khan, S.A. and Leduc, P. and Tayal, A. and Prud'homme, R.}, year={2001}, month={Mar} }
 @inbook{chang_hicks_kelly_2001, title={Protease I from Pyrococcus furiosus}, ISBN={9780121822316}, ISSN={0076-6879}, url={http://dx.doi.org/10.1016/s0076-6879(01)30392-0}, DOI={10.1016/s0076-6879(01)30392-0}, abstractNote={Pyrococcus furiosus is a hyperthermophilic archaeon from the order Thermococcales capable of growth on a variety of proteinaceous and carbohydrate-containing substrates. Analysis of gelatin-containing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) gels indicates that at least 11 endoproteinases are active in the cell extracts of this organism 2'3 and the following proteases have been characterized: protease I (PfpI), pyrolysin, proteasome, prolyl oligopeptidase, and proline dipeptidase. The gene encoding the 19-kDa subunit of PfpI has homologs in nearly every organism and cell examined to date, ranging from Escherichia coli to Homo sapiens; this ubiquity and evolutionary conservation indicates that it may play a fundamental physiological role. Efforts to study this issue have been exacerbated by difficulties encountered in obtaining significant amounts of a particular assembly of PfpI in either a native or a recombinant form. Native PfpI undergoes autoproteolysis and/or disassembly during direct purification from P. furiosus biomass and exists in multiple (singleto multisubunit) forms in vitro. The production of a recombinant form of PfpI is also problematic due to its toxicity toward mesophilic hosts. This chapter describes several methods that have been used to purify PfpI directly from P. Furiosus cell extracts are described here, together with an assay to detect proteolytic activity, a procedure to determine its molecular mass, and approaches to minimize PfpI-catalyzed proteolysis of other P. furious proteins.}, booktitle={Methods in Enzymology}, publisher={Elsevier}, author={Chang, Lara S and Hicks, Paula M and Kelly, Robert M}, year={2001}, pages={403–413} }
 @article{chang_hicks_kelly_2001, title={Protease I from Pyrococcus furiosus}, volume={330}, journal={Hyperthermophilic enzymes. Part A}, publisher={San Diego, Calif.: Academic Press}, author={Chang, L. S. and Hicks, P. M. and Kelly, R. M.}, year={2001}, pages={403–413} }
 @inbook{vieille_sriprapundh_kelly_zeikus_2001, title={Xylose isomerases from Thermotoga}, ISBN={9780121822316}, ISSN={0076-6879}, url={http://dx.doi.org/10.1016/s0076-6879(01)30377-4}, DOI={10.1016/s0076-6879(01)30377-4}, abstractNote={Publisher Summary Typically present in microorganisms that grow on xylose, xylose isomerise (XI) converts xylose to xylulose, which is then phosphorylated and enters the pentose-phosphate pathway. Because it also accepts glucose as substrate, XI is used extensively to isomerize glucose to fructose in the manufacture of high fructose corn syrup (HFCS). Performed at temperatures around 55-60°, this isomerization process requires thermostable enzymes. XIs have been characterized from a number of eubacterial sources and from rice and barley, but they have not been reported in fungi or archaea. XIs from the hyperthermophilic eubacteria Thermotoga maritima and Thermotoga neapolitana are the most thermostable yet characterized XIs.}, booktitle={Methods in Enzymology}, publisher={Elsevier}, author={Vieille, Claire and Sriprapundh, Dinlaka and Kelly, Robert M and Zeikus, J.Gregory}, year={2001}, pages={215–224} }
 @article{vieille_sriprapundh_kelly_zeikus_2001, title={Xylose isomerases from Thermotoga}, volume={330}, journal={Hyperthermophilic enzymes. Part A}, publisher={San Diego, Calif.: Academic Press}, author={Vieille, C. and Sriprapundh, D. and Kelly, R. M. and Zeikus, J. G.}, year={2001}, pages={215–224} }
 @article{miller_parker_liebl_lam_callen_snead_mathur_short_kelly_2001, title={alpha-D-galactosidases from Thermotoga species}, volume={330}, journal={Hyperthermophilic enzymes. Part A}, publisher={San Diego, Calif.: Academic Press}, author={Miller, E. S. and Parker, K. N. and Liebl, W. and Lam, D. and Callen, W. and Snead, M. A. and Mathur, E. J. and Short, J. M. and Kelly, R. M.}, year={2001}, pages={246–260} }
 @article{chang_parker_bauer_kelly_2001, title={alpha-Glucosidase from Pyrococcus furiosus}, volume={330}, journal={Hyperthermophilic enzymes. Part A}, publisher={San Diego, Calif.: Academic Press}, author={Chang, S. T. and Parker, K. N. and Bauer, M. W. and Kelly, R. M.}, year={2001}, pages={260–269} }
 @article{cady_bauer_callen_snead_mathur_short_kelly_2001, title={beta-Endoglucanase from Pyrococcus furiosus}, volume={330}, journal={Hyperthermophilic enzymes. Part A}, publisher={San Diego, Calif.: Academic Press}, author={Cady, S. G. and Bauer, M. W. and Callen, W. and Snead, M. A. and Mathur, E. J. and Short, J. M. and Kelly, R. M.}, year={2001}, pages={346–354} }
 @article{chhabra_parker_lam_callen_snead_mathur_short_kelly_2001, title={beta-Mannanases from Thermotoga species}, volume={330}, journal={Hyperthermophilic enzymes. Part A}, publisher={San Diego, Calif.: Academic Press}, author={Chhabra, S. and Parker, K. N. and Lam, D. and Callen, W. and Snead, M. A. and Mathur, E. J. and Short, J. M. and Kelly, R. M.}, year={2001}, pages={224–238} }
 @article{parker_chhabra_lam_snead_mathur_kelly_2001, title={beta-Mannosidase from Thermotoga species}, volume={330}, journal={Hyperthermophilic enzymes. Part A}, publisher={San Diego, Calif.: Academic Press}, author={Parker, K. N. and Chhabra, S. and Lam, D. and Snead, M. A. and Mathur, E. J. and Kelly, R. M.}, year={2001}, pages={238–246} }
 @inbook{chang_parker_bauer_kelly_2001, title={α-Glucosidase from Pyrococcus furiosus}, ISBN={9780121822316}, ISSN={0076-6879}, url={http://dx.doi.org/10.1016/s0076-6879(01)30381-6}, DOI={10.1016/s0076-6879(01)30381-6}, abstractNote={Hyperthermophilic α-glucosidases could also provide valuable insights into protein function, structure, and stability at high temperatures. Indeed, it is the intrinsic high temperature activity and stability of these proteins that have fueled considerable effort into the development of these and other glycosylhydrolases for use in starch conversion technology. Currently employed mesophilic enzymes exhibit limited tolerance to the high temperatures and pH variations encountered during starch solubilization and degradation. These mesophilic enzymes often have metal ion requirements for activity, whereas their counterpart hyperthermophilic versions often do not. Although pullulanases and glucoamylases (also known as amyloglucosidases) are typically used for saccharification of intermediate starch degradation products to glucose, heat-stable α-glucosidases, together with pullulanases, could theoretically fill that role more efficiently. However, despite the potential impact of hyperthermophilic enzymes on industrial processes, including starch conversion, their application is still largely unrealized. One readily apparent obstacle is developing a costefficient method for producing sufficient quantities of enzyme either directly from the source organism or through recombinant means.}, booktitle={Methods in Enzymology}, publisher={Elsevier}, author={Chang, Stephen T and Parker, Kimberley N and Bauer, Michael W and Kelly, Robert M}, year={2001}, pages={260–269} }
 @inbook{miller_parker_liebl_lam_callen_snead_mathur_short_kelly_2001, title={αa-D-Galactosidases from Thermotoga species}, ISBN={9780121822316}, ISSN={0076-6879}, url={http://dx.doi.org/10.1016/s0076-6879(01)30380-4}, DOI={10.1016/s0076-6879(01)30380-4}, abstractNote={Publisher Summary Based on similarities in primary structure and hydrophobic cluster analyses, αGals have been grouped into three well-conserved families in the general classification of glycosylhydrolases Those from bacteria have been grouped into families 4 and 36 and those of eukaryotic origin into family 27. To date, only α Gals of the hyperthermophilic bacteria Thermotoga maritima ( Tm GalA) and T. neapolitana ( Tn GalA) have demonstrated activity and prolonged stability above 75°. These two enzymes are therefore of considerable interest from a biotechnological standpoint. Potential applications include the high temperature hydrolysis of galactomannans used for well stimulation in the oil and gas industry and oligosaccharide synthesis via glycosyltransferase reactions. Genes encoding both Tm GalA and Tn GalA have been cloned and expressed in Escherichia coli . Although these enzymes are structurally related, they exhibit different biochemical properties in terms of pH optima, activity, and thermostability. This chapter discusses the purification, cloning, and expression of recombinant α Gal from T. neapolitana and T. maritima , in addition to some of their biochemical properties.}, booktitle={Methods in Enzymology}, publisher={Elsevier}, author={Miller, E.S, Jr. and Parker, Kimberley N and Liebl, Wolfgang and Lam, David and Callen, Walter and Snead, Mabjory A and Mathur, Eric J and Short, J.M and Kelly, Robert M}, year={2001}, pages={246–260} }
 @inbook{cady_bauer_callen_snead_mathur_short_kelly_2001, title={β-Endoglucanase from Pyrococcus furiosus}, ISBN={9780121822316}, ISSN={0076-6879}, url={http://dx.doi.org/10.1016/s0076-6879(01)30387-7}, DOI={10.1016/s0076-6879(01)30387-7}, abstractNote={Publisher Summary Glycosylhydrolases have been isolated from a variety of heterotrophic hyperthermophiles and include glucanases, hemicellulases, and cellulases. Pyrococcus furiosus , a hyperthermophilic heterotroph isolated by Fiala and Stetter from geothermal regions of Vulcano Island, Italy, grows on a wide range of α - and β -1inked carbohydrates, a property supported by the enzyme inventory revealed in its genome sequence. This chapter describes the approaches used for the cloning and expression in Escherichia coli of the eglA gene, which encodes the P. furiosus endoglucanase, and protocols used to study the biochemical properties of the recombinant enzyme. It is also interesting to know that P. furiosus and other heterotrophic hyperthermophilic archaea do not seem to produce enzymes for the hydrolysis of nonglucan polysaccharides, such as mannan or xylan, even though Thermotoga maritima, a hyperthermophilic bacterium, does. Whether this is a distinguishing feature of archaeal growth physiology remains to be seen.}, booktitle={Methods in Enzymology}, publisher={Elsevier}, author={Cady, Susan G and Bauer, Michael W and Callen, Walter and Snead, Marjory A and Mathur, Eric J and Short, J.M and Kelly, Robert M}, year={2001}, pages={346–354} }
 @article{chhabra_parker_lam_callen_snead_mathur_short_kelly_2001, title={β-Mannanases from Thermotoga species}, volume={330}, DOI={10.1016/S0076-6879(01)30378-6}, abstractNote={Thermostable mannanases have been identified from Thermotoga neapolitana, Rhodothermus marinus, Bacillus stearotherrnophilus, Thermo- anaerobacterium polysaccharolyticum, Caldocellosiruptor saccharolyticus," and Dictyoglomus thermophilum. The β-mannanases from T. Neapolitana (family 5) and R. marinus (family 26) are the most thermostable of these. The mannanase from T. neapolitana is less stable at 85°, but more stable at 90°, than the corresponding enzyme from R. marinus. The former has a half-life of 34 hr at 85° and 13 hr at 90°, whereas the latter has a half life of 45.3 and 4.5 hr at the respective temperatures. Hyperthermophilic mannanases are useful in several industrial applications where thermostability and thermoactivity are desirable. These include coffee extraction, oil/gas well stimulation, and wood pulp treatment. This chapter describes the purification and characterization of a β-mannanase from T. neapolitana, as well as cloning and sequencing of this enzyme from T. neapolitana and T. maritima.}, journal={Methods in Enzymology}, author={Chhabra, S.R. and Parker, K.N. and Lam, D. and Callen, W. and Snead, M.A. and Mathur, E.J. and Short, J.M. and Kelly, R.M.}, year={2001}, pages={224–238} }
 @inbook{parker_chhabra_lam_snead_mathur_kelly_2001, title={β-Mannosidase from Thermotoga species}, ISBN={9780121822316}, ISSN={0076-6879}, url={http://dx.doi.org/10.1016/s0076-6879(01)30379-8}, DOI={10.1016/s0076-6879(01)30379-8}, abstractNote={Publisher Summary β -Mannosidase is an exo-acting glycosylhydrolase whose function is to cleave mannose residues from the nonreducing termini of mannan oligosaccharides. In microorganisms, β -mannosidases often act in concert with endo-acting β -mannanases to completely hydrolyze mannan-based carbohydrates to be subsequently used for nutritional purposes. In mammals, the deficiency of mannosidase can lead to β -mannosidosis, a genetic disorder resulting from the storage and excretion of undegraded substrates. Hyperthermophilic β -mannosidases have been identified in archaea such as Pyrococcus furiosus and in the bacteria Thermotoga maritima and T. neapolitana . This chapter presents the protocols used to purify the β -mannosidase from T. Neapolitana together with the results of cloning and expression of genes encoding the analogous enzyme of T. maritima in Escherichia coli.}, booktitle={Methods in Enzymology}, publisher={Elsevier}, author={Parker, Kimberley N and Chhabra, Swapnil and Lam, David and Snead, Marjorie A and Mathur, Eric J and Kelly, Robert M}, year={2001}, pages={238–246} }
 @article{mccutchen_duffaud_leduc_petersen_tayal_khan_kelly_2000, title={Characterization of extremely thermostable enzymatic breakers (α-1,6-galactosidase and β-1,4-mannanase) from the hyperthermophilic bacterium Thermotoga neapolitana 5068 for hydrolysis of guar gum}, volume={52}, ISSN={0006-3592 1097-0290}, url={http://dx.doi.org/10.1002/(sici)1097-0290(19961020)52:2<332::aid-bit13>3.0.co;2-l}, DOI={10.1002/(sici)1097-0290(19961020)52:2<332::aid-bit13>3.0.co;2-l}, abstractNote={An α-galactosidase and a β-mannanase produced by the hyperthermophilic bacterium, Thermotoga neapolitana 5068 (TN5068), separately and together, were evaluated for their ability to hydrolyze guar gum in relation to viscosity reduction of guar-based hydraulic fracturing fluids used in oil and gas well stimulation. In such applications, premature guar gum hydrolysis at lower temperatures before the fracturing process is completed is undesirable, whereas thermostability and thermoactivity are advantageous. Hyperthermophilic enzymes presumably possess both characteristics. The purified α-galactosidase was found to have a temperature optimum of 100–105°C with a half-life of 130 minutes at 90°C and 3 min at 100°C, while the purified β-mannanase was found to have a temperature optimum of 91°C and a half-life of 13h at this temperature and 35 min at 100°C. These represent the most thermostable versions of these enzymes yet reported. At 25°C, TN5068 culture supernatants, containing the two enzyme activities, reduced viscosity of a 0.7% (wt) guar gum solution by a factor of 1.4 after a 1.5-h incubation period and by a factor of 2.4 after 5 h. This is in contrast to a viscosity reduction of 100-fold after 1.5 h and 375-fold after 5 h for a commercial preparation of these enzymes from Aspergillus niger. In contrast, at 85°C, the TN5068 enzymes reduced viscosity by 30-fold after 1.5 h and 100-fold after 5 h compared to a 2.5-fold reduction after 5 h for the control. The A. niger enzymes were less effective at 85°C (1.6-fold reduction after 1.5 h and a 4.2-fold reduction after 5 h), presumably due to their thermal lability at this temperature. Furthermore, it was determined that the purified β-mannanase alone can substantially reduce viscosity of guar solutions, while the α-galactosidase alone had limited viscosity reduction activity. However, the α-galactosidase appeared to minimize residual particulate matter when used in conjunction with the β-mannanase. This could be the result of extensive hydrolysis of the α-1,6 linkages between mannose and galactose units in guar, allowing more extensive hydrolysis of the mannan chain by the β-mannanase. The use of thermostable enzymatic breakers from hyperthermophiles in hydraulic fracturing could be used to improve well stimulation and oil and gas recovery. © 1996 John Wiley & Sons, Inc.}, number={2}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={McCutchen, Carol M. and Duffaud, Guy D. and Leduc, Pascal and Petersen, Anja R. H. and Tayal, Akash and Khan, Saad A. and Kelly, Robert M.}, year={2000}, month={Mar}, pages={332–339} }
 @article{rinker_kelly_2000, title={Effect of carbon and nitrogen sources on growth dynamics and exopolysaccharide production for the hyperthermophilic archaeon Thermococcus litoralis and bacterium Thermotoga maritima}, volume={69}, ISSN={["0006-3592"]}, DOI={10.1002/1097-0290(20000905)69:5<537::AID-BIT8>3.0.CO;2-7}, abstractNote={Batch and continuous cultures were used to compare specific physiological features of the hyperthermophilic archaeon, Thermococcus litoralis (T(opt) of 85 degrees to 88 degrees C), to another fermentative hyperthermophile that reduces S degrees facultatively, that is, the bacterium Thermotoga maritima (T(opt) of 80 degrees to 85 degrees C). Under nutritionally optimal conditions, these two hyperthermophiles had similar growth yields on maltose and similar cell formula weights based on elemental analysis: CH(1.7)O(0. 7)N(0.2)S(0.006) for T. litoralis and CH(1.6)O(0.6)N(0.2)S(0.005) for T. maritima. However, they differed with respect to nitrogen source, fermentation product patterns, and propensity to form exopolysaccharides (EPS). T. litoralis could be cultured in the absence or presence of maltose on an amino acid-containing defined medium in which amino acids served as the sole nitrogen source. T. maritima, on the other hand, did not utilize amino acids as carbon, energy, or nitrogen sources, and could be grown in a similar defined medium only when supplemented with maltose and ammonium chloride. Not only was T. litoralis unable to utilize NH(4)Cl as a nitrogen source, its growth was inhibited at certain levels. At 1 g/L ( approximately 20 mM) NH(4)Cl, the maximum growth yield (Y(x/s(max))) for T. litoralis was reduced to 13 g cells dry weight (CDW)/mol glucose from 40 g CDW/mol glucose in media lacking NH(4)Cl. Alanine production increased with increasing NH(4)Cl concentrations and was most pronounced if growth on NH(4)Cl was carried out in an 80% H(2) atmosphere. In T. maritima cultures, which would not grow in an 80% H(2) atmosphere, alanine and EPS were produced at much lower levels, which did not change with NH(4)Cl concentration. EPS production rose sharply at high dilution rates for both organisms, such that maltose utilization plots were biphasic. Wall growth effects were also noted, because cultures failed to wash out at dilution rates significantly above maximum growth rates determined from batch growth experiments. This study illustrates the importance of effective cultivation methods for addressing physiological issues related to the growth of hyperthermophilic heterotrophs.}, number={5}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Rinker, KD and Kelly, RM}, year={2000}, month={Sep}, pages={537–547} }
 @article{bauer_driskill_callen_snead_mathur_kelly_1999, title={An endoglucanase, eglA, from the hyperthermophilic archaeon Pyrococcus furiosus hydrolyzes beta-1,4 bonds in mixed-linkage(1 -> 3),(1 -> 4)-beta-D-glucans and cellulose}, volume={181}, number={1}, journal={Journal of Bacteriology}, author={Bauer, M. W. and Driskill, L. E. and Callen, W. and Snead, M. A. and Mathur, E. J. and Kelly, R. M.}, year={1999}, pages={284–290} }
 @article{kelly_waldmann_1999, title={Biocatalysis and biotransformation - Editorial overview}, volume={3}, ISSN={["1367-5931"]}, DOI={10.1016/S1367-5931(99)80002-7}, number={1}, journal={CURRENT OPINION IN CHEMICAL BIOLOGY}, author={Kelly, RM and Waldmann, H}, year={1999}, month={Feb}, pages={9–10} }
 @misc{kelly_khan_leduc_tayal_prud'homme_1999, title={Compositions for fracturing subterranean formations}, volume={5,869,435}, number={1999 Feb. 9}, publisher={Washington, DC: U.S. Patent and Trademark Office}, author={Kelly, R. M. and Khan, S. A. and Leduc, P. and Tayal, A. and Prud'homme, R. K.}, year={1999} }
 @article{rinker_han_kelly_1999, title={Continuous culture as a tool for investigating the growth physiology of heterotrophic hyperthermophiles and extreme thermoacidophiles}, volume={85}, number={1999}, journal={Journal of Applied Microbiology}, author={Rinker, K. D. and Han, C. J. and Kelly, R. M.}, year={1999}, pages={118S–127} }
 @inbook{rinker_han_adams_kelly_1999, place={Washington, D.C.}, edition={2nd}, title={Cultivation of hyperthermophilic and extremely thermoacidophilic microorganisms}, booktitle={Manual of Industrial Microbiology and Biotechnology}, publisher={ASM Press}, author={Rinker, K.D. and Han, C.J. and Adams, M.W.W. and Kelly, R.M.}, editor={Demain, A.L. and Davies, J.E. and Atlas, R.M.Editors}, year={1999} }
 @inbook{hicks_adams_kelly_1999, place={New York}, title={Enzymes, Extremely Thermostable}, DOI={10.1002/0471250589.ebt081}, abstractNote={Introduction Extremely Thermostable Enzyme Discovery Direct Purification From Extreme Thermophile Biomass Expression Cloning Sequence Analysis of Genomic DNA Enzymes from Extreme Thermophiles General Characteristics Enzymes from Extreme Thermophiles Involved in Intermediate Metabolism Proteases from Extreme Thermophiles Glycosyl Hydrolases from Extreme Thermophiles Mechanisms of Thermostability Intrinsic Factors Influencing Protein Stability Extrinsic Factors Influencing Protein Stability Recombinant Extremely Thermophilic Enzymes Uses of Extremely Thermostable Enzymes General Considerations Polymerase Chain Reaction Replacements of Existing Industrial Enzymes New Opportunities Summary Bibliography}, booktitle={Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis, and Bioseparation}, publisher={John Wiley and Sons}, author={Hicks, P.M. and Adams, M.W.W. and Kelly, R.M.}, editor={Flickinger, M.C. and Drew, S.W.Editors}, year={1999}, pages={987–1004} }
 @article{hess_kelly_1999, title={Influence of polymolecular events on inactivation behavior of xylose isomerase from Thermotoga neapolitana 5068}, volume={62}, ISSN={["1097-0290"]}, DOI={10.1002/(SICI)1097-0290(19990305)62:5<509::AID-BIT2>3.0.CO;2-7}, abstractNote={The inactivation behavior of the xylose isomerase from Thermotoga neapolitana (TN5068 XI) was examined for both the soluble and immobilized enzyme. Polymolecular events were involved in the deactivation of the soluble enzyme. Inactivation was biphasic at 95 degrees C, pH 7.0 and 7.9, the second phase was concentration-dependent. The enzyme was most stable at low enzyme concentrations, however, the second phase of inactivation was 3- to 30-fold slower than the initial phase. Both phases of inactivation were more rapid at pH 7.9, relative to 7.0. Differential scanning calorimetry of the TN5068 XI revealed two distinct thermal transitions at 99 degrees and 109 degrees C. The relative magnitude of the second transition was dramatically reduced at pH 7.9 relative to pH 7.0. Approximately 24% and 11% activity were recoverable after the first transition at pH 7.0 and 7.9, respectively. When the TN5068 XI was immobilized by covalent attachment to glass beads, inactivation was monophasic with a rate corresponding to the initial phase of inactivation for the soluble enzyme. The immobilized enzyme inactivation rate corresponded closely to the rate of ammonia release, presumably from deamidation of labile asparagine and/or glutamine residues. A second, slower inactivation phase suggests the presence of an unfolding intermediate, which was not observed for the immobilized enzyme. The concentration dependence of the second phase of inactivation suggests that polymolecular events were involved. Formation of a reversible polymolecular aggregate capable of protecting the soluble enzyme from irreversible deactivation appears to be responsible for the second phase of inactivation seen for the soluble enzyme. Whether this characteristic is common to other hyperthermophilic enzymes remains to be seen.}, number={5}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Hess, JM and Kelly, RM}, year={1999}, month={Mar}, pages={509–517} }
 @book{kelly_khan_leduc_tayal_prud'homme_1999, title={Methods and compositions for fracturing subterranean formations}, number={5,869,435}, author={Kelly, R.M. and Khan, S.A. and Leduc, P. and Tayal, A. and Prud'homme, R.}, year={1999} }
 @article{driskill_kusy_bauer_kelly_1999, title={Relationship between glycosyl hydrolase inventory and growth physiology of the hyperthermophile Pyrococcus furiosus on carbohydrate-based media}, volume={65}, number={3}, journal={Applied and Environmental Microbiology}, author={Driskill, L. E. and Kusy, K. and Bauer, M. W. and Kelly, R. M.}, year={1999}, pages={893–897} }
 @article{tayal_kelly_khan_1999, title={Rheology and molecular weight changes during enzymatic degradation of a water-soluble polymer}, volume={32}, ISSN={["1520-5835"]}, DOI={10.1021/ma980773w}, abstractNote={The rheological behavior and molecular weight characteristics of a natural polymer undergoing enzymatic hydrolysis were examined for aqueous guar solutions. Changes in weight-average molecular weight (Mw), deduced from gel permeation chromatography (GPC), were used to construct a kinetic model for the process, such that 1/Mw ∝ kt, with the rate constant, k, varying inversely with polymer concentration. This relationship suggests that enzymatic degradation was zeroth-order in guar concentration. These findings contrast with previous studies of natural polymer degradation which usually have interpreted the linear relationship between 1/M and time as first-order processes. Our analysis reveals that this linear relationship is expected regardless of the reaction order and that the true order can be determined only from the dependence of the degradation rate on initial polymer concentration. Rheological properties were sensitive to extent of degradation; several orders of magnitude change in zero shear viscosity were observed over the course of polymer chain scission. Moreover, the viscosity−time profiles for different enzyme concentrations could be collapsed onto a single curve by temporal scaling. This could be used to predict, a priori, guar solution viscosity as a function of degradation time and enzyme concentration. This “concentration−degradation time” superposition was based on a unique relationship between zero shear viscosity, η0, and the product of enzyme concentration and degradation time.}, number={2}, journal={MACROMOLECULES}, author={Tayal, A and Kelly, RM and Khan, SA}, year={1999}, month={Jan}, pages={294–300} }
 @article{driskill_bauer_kelly_1999, title={Synergistic interactions among beta-laminarinase, beta-1,4-glucanase, and beta-glucosidase from the hyperthermophilicarchaeon Pyrococcus furiosus during hydrolysis of beta-1,4-,beta-1,3-, and mixed-linked polysaccharides}, volume={66}, DOI={10.1002/(SICI)1097-0290(1999)66:1<51::AID-BIT5>3.3.CO;2-B}, number={1}, journal={Biotechnology and Bioengineering}, author={Driskill, L. E. and Bauer, M. W. and Kelly, Robert}, year={1999}, pages={51–60} }
 @inbook{hicks_kelly_1999, place={New York}, title={Thermophilic Microorganisms}, DOI={10.1002/0471250589.ebt209}, booktitle={Encyclopedia of Bioprocess Technology: Fermentation, Biocatalysis, and Bioseparation}, publisher={John Wiley and Sons}, author={Hicks, P.M. and Kelly, R.M.}, editor={Flickinger, M.C. and Drew, S.W.Editors}, year={1999}, pages={2536–2552} }
 @article{han_kelly_1998, title={Biooxidation capacity of the extremely thermoacidophilic archaeon Metallosphaera sedula under bioenergetic challenge}, volume={58}, ISSN={["0006-3592"]}, DOI={10.1002/(SICI)1097-0290(19980620)58:6<617::AID-BIT7>3.0.CO;2-L}, abstractNote={The biooxidation capacity of an extremely thermoacidophilic archaeon Metallosphaera sedula (DSMZ 5348) was examined under bioenergetic challenges imparted by thermal or chemical stress in regard to its potential use in microbial bioleaching processes. Within the normal growth temperature range of M. sedula (70-79 degrees C) at pH 2.0, upward temperature shifts resulted in bioleaching rates that followed an Arrhenius-like dependence. When the cells were subjected to supraoptimal temperatures through gradual thermal acclimation at 81 degrees C (Han et al., 1997), cell densities were reduced but 3 to 5 times faster specific leaching rates (Fe3+ released from iron pyrite/cell/h) could be achieved by the stressed cells compared to cells at 79 degrees C and 73 degrees C, respectively. The respiration capacity of M. sedula growing at 74 degrees C was challenged by poisoning the cells with uncouplers to generate chemical stress. When the protonophore 2,4-dinitrophenol (5-10 μM) was added to a growing culture of M. sedula on iron pyrite, there was little effect on specific leaching rates compared to a culture with no protonophore at 74 degrees C; 25 μM levels proved to be toxic to M. sedula. However, a significant stimulation in specific rate was observed when the cells were subjected to 1 μM nigericin (+135%) and 2 μM (+63%); 5 μM levels of the ionophore completely arrested cell growth. The ionophore effect was further investigated in continuous culture growing on ferrous sulfate at 74 degrees C. When 1 μM nigericin was added as a pulse to a continuous culture, a 30% increase in specific iron oxidation rate was observed for short intervals, indicating a potential positive impact on leaching when periodic chemical stress is applied. This study suggests that biooxidation rates can be increased by strategic exposure of extreme thermoacidophiles to chemical or thermal stress, and this approach should be considered for improving process performance. Copyright 1998 John Wiley & Sons, Inc.}, number={6}, journal={BIOTECHNOLOGY AND BIOENGINEERING}, author={Han, CJ and Kelly, RM}, year={1998}, month={Jun}, pages={617–624} }
 @article{adams_kelly_1998, title={Finding and using hyperthermophilic enzymes}, volume={16}, ISSN={["0167-7799"]}, DOI={10.1016/S0167-7799(98)01193-7}, abstractNote={Recent developments have enhanced the prospects for the discovery of hyperthermophilic enzymes. This is important because the intrinsic basis underlying the extraordinary thermostability of hyperthermophilic enzymes has yet to be revealed, and so engineering this characteristic into less thermophilic enzymes is not possible at this time. Successful efforts to clone and express the genes encoding hyperthermophilic enzymes in mesophilic hosts have improved the availability of high-temperature biocatalysts. The remaining task is the identification of opportunities to make strategic use of the thermoactivity and thermostability of hyperthermophilic enzymes.}, number={8}, journal={TRENDS IN BIOTECHNOLOGY}, author={Adams, MWW and Kelly, RM}, year={1998}, month={Aug}, pages={329–332} }
 @misc{bauer_driskill_kelly_1998, title={Glycosyl hydrolases from hyperthermophilic microorganisms}, volume={9}, ISSN={["0958-1669"]}, DOI={10.1016/S0958-1669(98)80106-7}, abstractNote={Glycosyl hydrolases from hyperthermophiles are, thus far, the most widely studied enzyme class from these organisms. Not only are there many biotechnological opportunities for these enzymes, but the rapidly increasing amount of information about their genetic, biochemical and biophysical characteristics (recently genomic sequencing data for both P. furiosus and P. horikoshi have been published on the Internet) make them ideal candidates for the study of biocatalysis and protein thermostability at extremely high temperatures.}, number={2}, journal={CURRENT OPINION IN BIOTECHNOLOGY}, author={Bauer, MW and Driskill, LE and Kelly, RM}, year={1998}, month={Apr}, pages={141–145} }
 @article{hicks_rinker_baker_kelly_1998, title={Homomultimeric protease in the hyperthermophilic bacterium Thermotoga maritima has structural and amino acid sequence homology to bacteriocins in mesophilic bacteria}, volume={440}, ISSN={["0014-5793"]}, DOI={10.1016/S0014-5793(98)01451-3}, abstractNote={A novel homomultimeric protease (> 669 kDa), based on 31 kDa subunits, was purified from cell extracts of the hyperthermophilic bacterium Thermotoga maritima. This protease exhibits activity toward chymotrypsin and trypsin substrates, optimally at 90 degrees C and pH 7.1, and has a half-life of 36 min at 95 degrees C. Transmission electron microscopy established that the protease consists of a large globular assembly which appears circular from the front view. The function of this protease in T. maritima remains unclear, although putative homologs include a 29 kDa antigen from Mycobacterium tuberculosis and a 31 kDa monomer of a high molecular weight bacteriocin produced by Brevibacterium linens [Valdes-Stauber, N. and Scherer, S. (1996) Appl. Environ. Microbiol. 62, 1283-1286]. The relationship of these mesophilic proteins to the T. maritima protease suggests that their antibacterial activity may involve elements of proteolysis, and raises the prospect for antimicrobial ecological strategies in hyperthermophilic niches.}, number={3}, journal={FEBS LETTERS}, author={Hicks, PM and Rinker, KD and Baker, JR and Kelly, RM}, year={1998}, month={Dec}, pages={393–398} }
 @article{duffaud_d'hennezel_peek_reysenbach_kelly_1998, title={Isolation and characterization of Thermococcus barossii, sp. nov., a hyperthermophilic Archaeon isolated from a hydrothermal vent flange formation}, volume={21}, ISSN={["0723-2020"]}, DOI={10.1016/S0723-2020(98)80007-6}, abstractNote={A new hyperthermophilic microorganism, Thermococcus barossii, was isolated from rock fragments of a hydrothermal vent flange formation, located along the East Pacific Rise of the Juan de Fuca Ridge. This organism is obligately anaerobic and grows over a temperature range of at least 60–92 °C in artificial seawater-based media, containing elemental sulfur, tryptone and yeast extract. The addition of a maltooligosaccharide mixture and tungsten to this medium improved growth to some extent. At the Topt for growth (82.5 °C), cell densities as high as 4×108 cells/ml could be obtained in 18-liter batch fermentations, with a doubling time of approximately 40 minutes, if culture access to elemental sulfur was sufficient. In continuous culture at the same temperature, comparable cell densities could be obtained but only at slower growth rates. Morphologically, T. barossii is coccoid-shaped, forming irregularly-shaped spheres; under optimal conditions, these coccoids become more regular and smaller, a characteristic of other hyperthermophilic archaea. Negatively-stained preparations showed no pili or flagella associated with the cell surface. 16S rRNA sequencing reveals that T. barossii is most similar to Thermococcus celer (99.7%). Yet, further comparisons with T. celer showed that T. barossii is a new Thermococcus species: different growth temperature optimum (82.5 °C vs. 88 °C), obligate requirement for sulfur, higher G+C content (60% vs. 56.7%) and 47.7% DNA-DNA hybridization. The nucleotide and translated amino acid sequence for the gene encoding a DNA polymerase from T. barossii was compared to sequences of related genes from other Thermococcales. The polymerase phylogenies were congruent with those obtained from the 16S rRNA phylogenetic analyses. Based on the high degree of similarity among members of the genus Termococcus for the criteria used thus far, aspects of enzymology may be an important mechanism of differentiating one species from another.}, number={1}, journal={SYSTEMATIC AND APPLIED MICROBIOLOGY}, author={Duffaud, GD and d'Hennezel, OB and Peek, AS and Reysenbach, AL and Kelly, RM}, year={1998}, month={Mar}, pages={40–49} }
 @article{kowalski_kelly_konisky_clark_wittrup_1998, title={Purification and functional characterization of a chaperone from Methanococcus jannaschii}, volume={21}, ISSN={["0723-2020"]}, DOI={10.1016/S0723-2020(98)80021-0}, abstractNote={A chaperone from Methanococcus jannaschii has been purified to homogeneity with a single chromatographic step. The chaperone was identified and characterized using activity assays for characteristic chaperone abilities. The M. jannaschii chaperone binds unfolded proteins, protects proteins against heat-induced aggregation, and has a strongly temperature dependent ATPase activity. The chaperone has also been shown to inhibit the spontaneous refolding of a mesophilic protein at low temperatures. The purified chaperone complex has a M(r) of about 1,000,000 and consists of a single type of subunit with an approximate M(r) of 60,000. Analysis of partial sequence data reveals that this chaperone is the predicted protein product of the previously identified chaperonin gene in M. jannaschii (BULT et al., 1996). To our knowledge, this is the first functional characterization of a chaperone from a methanogen.}, number={2}, journal={SYSTEMATIC AND APPLIED MICROBIOLOGY}, author={Kowalski, JM and Kelly, RM and Konisky, J and Clark, DS and Wittrup, KD}, year={1998}, month={Jun}, pages={173–178} }
 @inbook{hicks_kelly_1998, place={London}, title={Pyrococcus furiosus Protease I (PfpI)}, booktitle={Handbook of Proteolytic Enzymes}, publisher={Academic Press Limited}, author={Hicks, P.M. and Kelly, R.M.}, editor={Woessner, F. and Rawlings, N. and Barrett, A.Editors}, year={1998} }
 @article{bauer_kelly_1998, title={The family 1 beta-glucosidases from Pyrococcus furiosus and Agrobacterium faecalis share a common catalytic mechanism}, volume={37}, ISSN={["0006-2960"]}, DOI={10.1021/bi9814944}, abstractNote={Comparisons of catalytic mechanisms have not previously been performed for homologous enzymes from hyperthermophilic and mesophilic sources. Here, the beta-glucosidase from the hyperthermophilic archaeon Pyrococcus furiosus was recombinantly produced in Escherichia coli and shown to have biophyscial and biochemical properties identical to those of the wild-type enzyme. Moreover, the recombinant enzyme was subjected to a detailed kinetic investigation at 95 degreesC to compare its catalytic mechanism to that determined at 37 degreesC for the beta-glucosidase (abg) from the mesophilic bacterium, Agrobacterium faecalis [Kempton, J., and Withers, S. G. (1992) Biochemistry 31, 9961]. These enzymes have amino acid sequences that are 33% identical and have been classified as family 1 glycosyl hydrolases on the basis of amino acid sequence similarities. Both enzymes have similar broad specificities for both sugar and aglycone moieties and exhibit nearly identical pH dependences for their kinetic parameters with several different substrates. Bronsted plots were constructed for bgl at several temperatures using a series of aryl glucoside substrates. These plots were concave downward at all temperatures, indicating that bgl utilized a two-step mechanism similar to that of abg and that the rate-limiting step in this mechanism did not change with temperature for any given aryl glucoside. The Bronsted coefficient for bgl at 95 degreesC (beta1g = -0.7) was identical to that for abg at 37 degreesC and implies that these enzymes utilize nearly identical transition states, at least in regard to charge accumulation on the departing glycosidic oxygen. In addition, a high correlation coefficient (rho = 0.97) for the linear free energy relationship between these two enzymes and similar inhibition constants for these two enzymes with several ground state and transition state analogue inhibitors further indicate that these enzymes stabilize similar transition states. The mechanistic similarities between these two enzymes are noteworthy in light of the large difference in their temperature optima. This suggests that, in the presumed evolution that occurred between the hyperthermophilic archaeal enzyme and the mesophilic bacterial enzyme, structural modifications must have been selected which maintained the integrity of the active site structure and, therefore, the specificity of transition state interactions, while adapting the overall protein structure to permit function at the appropriate temperature.}, number={49}, journal={BIOCHEMISTRY}, author={Bauer, MW and Kelly, RM}, year={1998}, month={Dec}, pages={17170–17178} }
 @article{hess_tchernajenko_vieille_zeikus_kelly_1998, title={Thermotoga neapolitana homotetrameric xylose isomerase is expressed as a catalytically active and thermostable dimer in Escherichia coli}, volume={64}, number={7}, journal={Applied and Environmental Microbiology}, author={Hess, J. M. and Tchernajenko, V. and Vieille, C. and Zeikus, J. G. and Kelly, R. M.}, year={1998}, pages={2357–2360} }
 @article{han_park_kelly_1997, title={Acquired thermotolerance and stressed-phase growth of the extremely thermoacidophilic Archaeon Metallosphaera sedula in continuous culture}, volume={63}, number={6}, journal={Applied and Environmental Microbiology}, author={Han, C. J. and Park, S. H. and Kelly, R. M.}, year={1997}, pages={2391–2396} }
 @article{muralidharan_rinker_hirsh_bouwer_kelly_1997, title={Hydrogen transfer between methanogens and fermentative heterotrophs in hyperthermophilic cocultures}, volume={56}, DOI={10.1002/(sici)1097-0290(19971105)56:3<268::aid-bit4>3.0.co;2-h}, abstractNote={Interactions involving hydrogen transfer were studied in a coculture of two hyperthermophilic microorganisms: Thermotoga maritima, an anaerobic heterotroph, and Methanococcus jannaschii, a hydrogenotrophic methanogen. Cell densities of T. maritima increased 10-fold when cocultured with M. jannaschii at 85 degrees C, and the methanogen was able to grow in the absence of externally supplied H(2) and CO(2). The coculture could not be established if the two organisms were physically separated by a dialysis membrane, suggesting the importance of spatial proximity. The significance of spatial proximity was also supported by cell cytometry, where the methanogen was only found in cell sorts at or above 4.5 microm in samples of the coculture in exponential phase. An unstructured mathematical model was used to compare the influence of hydrogen transport and metabolic properties on mesophilic and hyperthermophilic cocultures. Calculations suggest the increases in methanogenesis rates with temperature result from greater interactions between the methanogenic and fermentative organisms, as evidenced by the sharp decline in H(2) concentration in the proximity of a hyperthermophilic methanogen. The experimental and modeling results presented here illustrate the need to consider the interactions within hyperthermophilic consortia when choosing isolation strategies and evaluating biotransformations at elevated temperatures.}, number={3}, journal={Biotechnology and Bioengineering}, author={Muralidharan, V. and Rinker, K. D. and Hirsh, I. S. and Bouwer, E. J. and Kelly, Robert}, year={1997}, pages={268–278} }
 @article{bauer_bauer_kelly_1997, title={Purification and Characterization of a Proteasome from the Hyperthermophilic Archaeon Pyrococcus furiosus}, volume={63}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.63.3.1160-1164.1997}, DOI={10.1128/aem.63.3.1160-1164.1997}, abstractNote={A 640-kDa proteasome consisting of (alpha) (25-kDa) and (beta) (22-kDa) subunits, and with a temperature optimum of 95(deg)C, was purified from crude cell extracts of a hyperthermophilic archaeon, Pyrococcus furiosus. Although this is the fourth member of the kingdom Euryarchaeota (and the first hyperthermophile) found to contain a proteasome, none has been identified among the members of the kingdom Crenarchaeota.}, number={3}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Bauer, M W and Bauer, S H and Kelly, R M}, year={1997}, month={Mar}, pages={1160–1164} }
 @article{duffaud_mccutchen_leduc_parker_kelly_1997, title={Purification and characterization of extremely thermostable beta mannanase, beta mannosidase, and alpha galactosidase from the hyperthermophilic eubacterium Thermotoga neapolitana}, volume={63}, number={1}, journal={Applied and Environmental Microbiology}, author={Duffaud, G. D. and McCutchen, C. M. and Leduc, P. and Parker, K. N. and Kelly, R. M.}, year={1997}, pages={169–177} }
 @article{halio_bauer_mukund_adams_kelly_1997, title={Purification and characterization of two functional forms of intracellular protease PFPI from the hyperthermophilic Archaeon Pyrococcus furiosus}, volume={63}, number={1}, journal={Applied and Environmental Microbiology}, author={Halio, S. B. and Bauer, M. W. and Mukund, S. and Adams, M. W. W. and Kelly, R. M.}, year={1997}, pages={289–295} }
 @misc{luhm_d'hennezel_duffaud_jolly_kelly_ting_1997, title={Purified Thermococcus barossii DNA polymerase}, volume={5,602,011}, number={1997 Feb. 11}, publisher={Washington, DC: U.S. Patent and Trademark Office}, author={Luhm, R. A. and d'Hennezel, O. B. and Duffaud, G. D. and Jolly, J. F. and Kelly, R. M. and Ting, E. Y.}, year={1997} }
 @article{tayal_kelly_khan_1997, title={Viscosity Reduction Of Hydraulic Fracturing Fluids Through Enzymatic Hydrolysis}, volume={2}, ISSN={1086-055X 1930-0220}, url={http://dx.doi.org/10.2118/38432-pa}, DOI={10.2118/38432-pa}, abstractNote={Abstract High viscosity formulations of guar are used as fracturing fluids to enhance oil and gas production. Following fracturing, these fluids are hydrolyzed and flushed out of the well to provide outflow for oil or gas. Enzymes offer an effective and environmentally benign method for hydrolyzing the guar to a low viscosity fluid. In this study, we used steady shear rheometry to elicit fundamental information on the capabilities and limitations of enzymes. The effect of commercial and new thermostable enzymes on polymer viscosity was investigated in terms of process variables such as temperature of hydrolysis, pH of solution and enzyme concentration. The commercial enzyme was most effective in degrading the guar at slightly acidic conditions and up to 60°C. Above 60°C, the extent of hydrolysis of guar solutions decreased. With increasing temperature, enzymatic activity increased but enzyme stability decreased and this balance was critical in determining the extent of viscosity reduction. Experiments using preheated enzyme also revealed lower viscosity reduction, suggesting that most of the hydrolysis occurs during the enzyme heat up, following which the enzymes deactivate rapidly. Similar experiments with the thermostable enzyme system demonstrated high levels of viscosity reduction at elevated temperatures (up to 85°C) and limited viscosity reduction at ambient conditions. This is suggestive of enhanced capability of this enzyme system at elevated temperatures compared to that of the commercial system. Experiments using purified enzymes from both enzyme systems also revealed that the largest reduction in viscosity of guar solutions occurs with endo-β-D mannanase, the enzyme cleaving the bonds between the mannose backbone units.}, number={02}, journal={SPE Journal}, publisher={Society of Petroleum Engineers (SPE)}, author={Tayal, Akash and Kelly, Robert M. and Khan, Saad A.}, year={1997}, month={Jun}, pages={204–212} }
 @article{bauer_bylina_swanson_kelly_1996, title={Comparison of a β-Glucosidase and a β-Mannosidase from the Hyperthermophilic Archaeon Pyrococcus furiosus}, volume={271}, ISSN={0021-9258}, url={http://dx.doi.org/10.1074/jbc.271.39.23749}, DOI={10.1074/jbc.271.39.23749}, abstractNote={Two distinct exo-acting, β-specific glycosyl hydrolases were purified to homogeneity from crude cell extracts of the hyperthermophilic archaeon Pyrococcus furiosus: a β-glucosidase, corresponding to the one previously purified by Kengen et al. (Kengen, S. W. M., Luesink, E. J., Stams, A. J. M., and Zehnder, A. J. B. (1993) Eur. J. Biochem. 213, 305-312), and a β-mannosidase. The β-mannosidase and β-glucosidase genes were isolated from a genomic library by expression screening. The nucleotide sequences predicted polypeptides with 510 and 472 amino acids corresponding to calculated molecular masses of 59.0 and 54.6 kDa for the β-mannosidase and the β-glucosidase, respectively. The β-glucosidase gene was identical to that reported by Voorhorst et al. (Voorhorst, W. G. B., Eggen, R. I. L., Luesink, E. J., and deVos, W. M. (1995) J. Bacteriol. 177, 7105-7111; GenBank accession no. U37557). The deduced amino acid sequences showed homology both with each other (46.5% identical) and with several other glycosyl hydrolases, including the β-glycosidases from Sulfolobus solfataricus, Thermotoga maritima, and Caldocellum saccharolyticum. Based on these sequence similarities, the β-mannosidase and the β-glucosidase can both be classified as family 1 glycosyl hydrolases. In addition, the β-mannosidase and β-glucosidase from P. furiosus both contained the conserved active site residues found in all family 1 enzymes. The β-mannosidase showed optimal activity at pH 7.4 and 105°C. Although the enzyme had a half-life of greater than 60 h at 90°C, it is much less thermostable than the β-glucosidase, which had a reported half-life of 85 h at 100°C. Km and Vmax values for the β-mannosidase were determined to be 0.79 mM and 31.1 μmol para-nitrophenol released/min/mg with p-nitrophenyl-β-D-mannopyranoside as substrate. The catalytic efficiency of the β-mannosidase was significantly lower than that reported for the P. furiosus β-glucosidase (5.3 versus 4, 500 s−1 mM−1 with p-nitrophenyl-β-D-glucopyranoside as substrate). The kinetic differences between the two enzymes suggest that, unlike the β-glucosidase, the primary role of the β-mannosidase may not be disaccharide hydrolysis. Other possible roles for this enzyme are discussed. Two distinct exo-acting, β-specific glycosyl hydrolases were purified to homogeneity from crude cell extracts of the hyperthermophilic archaeon Pyrococcus furiosus: a β-glucosidase, corresponding to the one previously purified by Kengen et al. (Kengen, S. W. M., Luesink, E. J., Stams, A. J. M., and Zehnder, A. J. B. (1993) Eur. J. Biochem. 213, 305-312), and a β-mannosidase. The β-mannosidase and β-glucosidase genes were isolated from a genomic library by expression screening. The nucleotide sequences predicted polypeptides with 510 and 472 amino acids corresponding to calculated molecular masses of 59.0 and 54.6 kDa for the β-mannosidase and the β-glucosidase, respectively. The β-glucosidase gene was identical to that reported by Voorhorst et al. (Voorhorst, W. G. B., Eggen, R. I. L., Luesink, E. J., and deVos, W. M. (1995) J. Bacteriol. 177, 7105-7111; GenBank accession no. U37557). The deduced amino acid sequences showed homology both with each other (46.5% identical) and with several other glycosyl hydrolases, including the β-glycosidases from Sulfolobus solfataricus, Thermotoga maritima, and Caldocellum saccharolyticum. Based on these sequence similarities, the β-mannosidase and the β-glucosidase can both be classified as family 1 glycosyl hydrolases. In addition, the β-mannosidase and β-glucosidase from P. furiosus both contained the conserved active site residues found in all family 1 enzymes. The β-mannosidase showed optimal activity at pH 7.4 and 105°C. Although the enzyme had a half-life of greater than 60 h at 90°C, it is much less thermostable than the β-glucosidase, which had a reported half-life of 85 h at 100°C. Km and Vmax values for the β-mannosidase were determined to be 0.79 mM and 31.1 μmol para-nitrophenol released/min/mg with p-nitrophenyl-β-D-mannopyranoside as substrate. The catalytic efficiency of the β-mannosidase was significantly lower than that reported for the P. furiosus β-glucosidase (5.3 versus 4, 500 s−1 mM−1 with p-nitrophenyl-β-D-glucopyranoside as substrate). The kinetic differences between the two enzymes suggest that, unlike the β-glucosidase, the primary role of the β-mannosidase may not be disaccharide hydrolysis. Other possible roles for this enzyme are discussed. The hyperthermophilic archaeon Pyrococcus furiosus is an obligately anaerobic heterotroph, which grows optimally at 98-100°C (1Fiala G. Stetter K.O. Arch. Microbiol. 1986; 145: 56-60Crossref Scopus (690) Google Scholar). It employs a fermentative type of metabolism (2Schäfer T. Xavier K.B. Santos H. Schönheit P. FEMS Microbiol. Lett. 1994; 121: 107-114Crossref Scopus (32) Google Scholar), using polysaccharides, such as starch, glycogen, and pullulan (3Brown S.H. Costantino H.R. Kelly R.M. Appl. Environ. Microbiol. 1990; 56: 1985-1991Crossref PubMed Google Scholar), or disaccharides, such as maltose (3Brown S.H. Costantino H.R. Kelly R.M. Appl. Environ. Microbiol. 1990; 56: 1985-1991Crossref PubMed Google Scholar) and cellobiose (4Kengen S.W.M. Luesink E.J. Stams A.J.M. Zehnder A.J.B. Eur. J. Biochem. 1993; 213: 305-312Crossref PubMed Scopus (246) Google Scholar), as carbon and energy sources. In order to utilize the different carbohydrates, P. furiosus synthesizes several intracellular and extracellular glycosyl hydrolases. Specifically, α-amylase (5Laderman K.A. Davis B.R. Krutzsch H.C. Lewis M.S. Griko Y.V. Privalov P.L. Anfinsen C.B. J. Biol. Chem. 1993; 268: 24394-24401Abstract Full Text PDF PubMed Google Scholar), amylopullulanase (6Brown S.H. Kelly R.M. Appl. Environ. Microbiol. 1993; 59: 2614-2621Crossref Google Scholar), α-glucosidase (7Costantino H.R. Brown S.H. Kelly R.M. J. Bacteriol. 1990; 172: 3654-3660Crossref PubMed Google Scholar), and β-glucosidase (4Kengen S.W.M. Luesink E.J. Stams A.J.M. Zehnder A.J.B. Eur. J. Biochem. 1993; 213: 305-312Crossref PubMed Scopus (246) Google Scholar) activities have been purified and characterized. The α-amylase, amylopullulanase, and α-glucosidase are believed to work cooperatively to degrade α-linked polysaccharides, such as starch, glycogen, or pullulan (8Rüdiger A. Jorgensen P.L. Antranikian G. Appl. Environ. Microbiol. 1995; 61: 567-575Crossref Google Scholar). The endo-acting, α-specific amylase and amylopullulanase degrade α-linked polysaccharides to di- and trisaccharides (5Laderman K.A. Davis B.R. Krutzsch H.C. Lewis M.S. Griko Y.V. Privalov P.L. Anfinsen C.B. J. Biol. Chem. 1993; 268: 24394-24401Abstract Full Text PDF PubMed Google Scholar, 6Brown S.H. Kelly R.M. Appl. Environ. Microbiol. 1993; 59: 2614-2621Crossref Google Scholar). α-Glucosidase presumably hydrolyzes these shorter oligosaccharides to glucose for use in a novel Embden-Meyerhof pathway (8Rüdiger A. Jorgensen P.L. Antranikian G. Appl. Environ. Microbiol. 1995; 61: 567-575Crossref Google Scholar, 9Kengen S.W.M. de Bok F.A.M. van Loo N.-D. Dijkema C. Stams A.J.M. de Vos W.M. J. Biol. Chem. 1994; 269: 17537-17541Abstract Full Text PDF PubMed Google Scholar). Although P. furiosus cannot grow on cellulose or carboxymethylcellulose (4Kengen S.W.M. Luesink E.J. Stams A.J.M. Zehnder A.J.B. Eur. J. Biochem. 1993; 213: 305-312Crossref PubMed Scopus (246) Google Scholar), it is not clear whether P. furiosus can utilize other β-linked complex carbohydrates as growth substrates. To date, no endo-acting, β-specific glycosyl hydrolases, such as cellulases, xylanases, or mannanases, have been identified in P. furiosus. However, when P. furiosus is grown on 5 mM cellobiose, a cell density of 7 × 108 cells/ml has been reported (4Kengen S.W.M. Luesink E.J. Stams A.J.M. Zehnder A.J.B. Eur. J. Biochem. 1993; 213: 305-312Crossref PubMed Scopus (246) Google Scholar). Apparently, cellobiose is transported across the cell membrane and hydrolyzed to glucose by the intracellular β-glucosidase (9Kengen S.W.M. de Bok F.A.M. van Loo N.-D. Dijkema C. Stams A.J.M. de Vos W.M. J. Biol. Chem. 1994; 269: 17537-17541Abstract Full Text PDF PubMed Google Scholar). Thus, the α- and β-glucosidases may play similar roles in the degradation of polysaccharides for the nutritional requirements of P. furiosus. In addition to the physiological role of these glycosyl hydrolases within P. furiosus, it is also interesting to examine their relationship to similar enzymes from the other domains of life. This can be done on the basis of substrate specificity. However, many glycosyl hydrolases have a broad range of specificities (10Henrissat B. Biochem. J. 1991; 280: 309-316Crossref PubMed Scopus (2534) Google Scholar). Henrissat (10Henrissat B. Biochem. J. 1991; 280: 309-316Crossref PubMed Scopus (2534) Google Scholar) proposed an alternate and complementary classification scheme for glycosyl hydrolases based on amino acid sequence similarities. For example, glycosyl hydrolase family 1 is composed of exo-acting, β-specific enzymes with similar amino acid sequences. Based on substrate specificity, enzymes in this family have been characterized as β-glucosidases (EC), β-galactosidases (EC), phospho-β-gluco/galactosidases (EC/85), lactase-phlorizin hydrolases (EC/62), and thioglucosidases (EC). Family 1 glycosyl hydrolases provide a favorable framework for comparative studies of mesophilic and thermophilic enzymes for a number of reasons. First, the enzymes in this family function over a wide range of temperatures from mesophilic (11Gonzalez-Candelas L. Ramon D. Polaina J. Gene (Amst.). 1990; 95: 31-38Crossref PubMed Scopus (46) Google Scholar, 12Painbeni E. Valles S. Poliana J. Flors A. J. Bacteriol. 1992; 174: 3087-3091Crossref Google Scholar, 13Paavilainen S. Hellman J. Korpela T. Appl. Environ. Microbiol. 1993; 59: 927-932Crossref PubMed Google Scholar, 14Porter E.V. Chassey B.M. Gene (Amst.). 1988; 62: 263-276Crossref PubMed Scopus (50) Google Scholar, 15Breidt Jr., F. Stewart G.C. Appl. Environ. Microbiol. 1987; 53: 969-973Crossref PubMed Google Scholar, 16de Vos W.M. Gasson M.J. J. Gen. Microbiol. 1989; 135: 1833-1846PubMed Google Scholar, 17Mantei N. Villa M. Enzler T. Wacker H. Boll W. James P. Hunziker W. Semenza G. EMBO J. 1988; 7: 2705-2713Crossref PubMed Scopus (209) Google Scholar, 18Schnetz K. Toloczyki C. Rak B. J. Bacteriol. 1987; 169: 2579-2590Crossref PubMed Google Scholar, 19Oxtoby E. Dunn M.A. Pancoro A. Hughes M.A. Plant Mol. Biol. 1991; 17: 209-219Crossref PubMed Scopus (53) Google Scholar, 20Falk A. Xue J. Lenman M. Rask L. Plant Sci. 1992; 83: 181-186Crossref Scopus (44) Google Scholar, 21Mastromei G. Hanhart E. Perito B. Polsinelli M. GenBank accession no. X74291 (direct submission to GenBank). 1995Google Scholar, 22El Hassouni M. Henrissat B. Chippaux M. Barras F. J. Bacteriol. 1992; 174: 765-777Crossref PubMed Google Scholar, 24Xue J.P. Lenman M. Falk A. Rask L. Plant Mol. Biol. 1992; 18: 387-392Crossref PubMed Scopus (84) Google Scholar, 25Wakarchuk W.W. Greenberg N.M. Kilburn D.G. Miller Jr., R.C. Warren R.A.J. J. Bacteriol. 1988; 170: 301-307Crossref PubMed Google Scholar, 26Hall B.G. Xu L. Mol. Biol. Evol. 1992; 9: 688-706PubMed Google Scholar) to moderately thermophilic (27Ruttersmith L.D. Daniel R.M. Biochim. Biophys. Acta. 1993; 1156: 167-172Crossref PubMed Scopus (36) Google Scholar, 28Gabelsberger J. Liebl W. Schleifer K.-H. FEMS Microbiol. Lett. 1993; 109: 131-138Google Scholar, 29Plant A.R. Oliver J.E. Patchett M.L. Daniel R.M. Morgan H.W. Arch. Biochem. Biophys. 1988; 262: 181-188Crossref Scopus (45) Google Scholar, 30Ait N. Creuzet N. Cattaneo J. Biochem. Biophys. Res. Commun. 1979; 90: 537-546Crossref Scopus (65) Google Scholar, 31Gräbnitz F. Seiss M. Rücknagel K.P. Staudenbauer W.L. Eur. J. Biochem. 1991; 200: 301-309Crossref PubMed Scopus (97) Google Scholar) to hyperthermophilic (4Kengen S.W.M. Luesink E.J. Stams A.J.M. Zehnder A.J.B. Eur. J. Biochem. 1993; 213: 305-312Crossref PubMed Scopus (246) Google Scholar, 32Grogan D.W. Appl. Environ. Microbiol. 1991; 57: 1644-1649Crossref PubMed Google Scholar, 33Pisani A.M. Rella R. Raia C.A. Rozzo C. Nucci R. Gambacorta A. DeRosa M. Eur. J. Biochem. 1990; 287: 321-328Crossref Scopus (166) Google Scholar). Second, enzymes in this family have been isolated from all three domains (bacteria, eucarya, and archaea), allowing the analysis of possible evolutionary relationships. Finally, crystal structures have been determined for some family 1 enzymes (34Sanz-Aparicio J. Romero A. Martinez-Ripoll M. Madarro A. Flors A. Polaina J. J. Mol. Biol. 1994; 240: 267-270Crossref PubMed Scopus (9) Google Scholar, 35Pearl L. Hemmings A.M. Nucci R. Rossi M. J. Mol. Biol. 1993; 229: 561-563Crossref PubMed Scopus (31) Google Scholar), facilitating structural comparisons among these enzymes. For this report, crude cell extracts of P. furiosus were examined for the presence of exo-acting glycosyl hydrolases. In addition to the α-glucosidase (7Costantino H.R. Brown S.H. Kelly R.M. J. Bacteriol. 1990; 172: 3654-3660Crossref PubMed Google Scholar) and β-glucosidase (4Kengen S.W.M. Luesink E.J. Stams A.J.M. Zehnder A.J.B. Eur. J. Biochem. 1993; 213: 305-312Crossref PubMed Scopus (246) Google Scholar) reported previously, a β-mannosidase activity was isolated and characterized in relation to the other glycosyl hydrolases of P. furiosus. In order to investigate the molecular basis for substrate specificity differences between the β-mannosidase and the β-glucosidase, the genes for both of these enzymes were isolated from a genomic library by expression screening. A search for homology between the deduced amino acid sequences of the β-mannosidase and the β-glucosidase and other glycosyl hydrolases was completed. Based on the relative catalytic efficiencies of the two enzymes, it is likely that they play different physiological roles in P. furiosus. Several possible functions for the β-mannosidase are discussed. P. furiosus (DSM 3638) was grown on maltose-based medium in a 600-liter batch fermentor, and cell-free extract was prepared as described previously (36Adams M.W.W. Archaea: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1995: 3.47Google Scholar, 37Bryant F.O. Adams M.W.W. J. Biol. Chem. 1989; 264: 5070-5079Abstract Full Text PDF PubMed Google Scholar). All purification steps were carried out at room temperature using an FPLC system (Pharmacia Biotech Inc.). The purification protocol for β-mannosidase was as follows. The cell-free extract was applied directly to a column (10 × 20 cm) of DEAE-Sepharose (Pharmacia). After washing the column with 7 liters of buffer (50 mM Tris/HCl, pH 8, containing 2 mM sodium dithionite, 10% glycerol (v/v)), the adsorbed proteins were eluted with a linear gradient from 0 mM to 115 mM NaCl (90 ml) and 115 mM to 376 mM NaCl (5000 ml) at 12 ml/min. β-Mannosidase activity eluted between 264 mM and 288 mM NaCl. These fractions were pooled and concentrated using an Amicon Ultrafiltration Cell 202 with a YM10 membrane (Amicon, Beverly, MA) and a pressure of 55 p.s.i.g. The concentrated fractions from the previous column were equilibrated to 50 mM sodium phosphate buffer, pH 7.0, containing 243 g/liter ammonium sulfate (buffer A). About 10% of the equilibrate pool (268 ml) was applied to a column (5 cm × 50 cm) of phenyl-Sepharose 650 M (Toso Haas, Montgomeryville, PA) previously equilibrated with buffer A. The column was washed with 600 ml 100% buffer A followed by 1000 ml of 25% buffer A. The remaining adsorbed proteins were eluted with a 2000-ml linear gradient from 25% to 0% buffer A. β-Mannosidase activity eluted at 0% buffer A. Fractions containing β-mannosidase activity were combined, concentrated as described above, and equilibrated to 25 mM potassium phosphate buffer, pH 7.0. The concentrated pool from the previous column was applied at 10 ml/min to a column (5 cm × 30 cm) of hydroxyapatite (Calbiochem, Sunnyvale, CA) previously equilibrated with 25 mM potassium phosphate buffer, pH 7.0. After the column was washed with 900 ml of 25 mM potassium phosphate, adsorbed proteins were eluted with a 600-ml linear gradient from 25 mM to 100 mM, a 400-ml linear gradient from 100 mM to 250 mM, and a 300-ml linear gradient from 250 mM to 500 mM potassium phosphate buffer, pH 7.0. β-Mannosidase activity eluted between 110 and 135 mM potassium phosphate buffer. Active fractions were pooled, concentrated, and equilibrated to 100 mM sodium phosphate buffer, pH 7.0. The concentrated pool from the previous column was applied to a Pharmacia HiLoad 16/60 Superdex 200 gel filtration column (Vo = 39.3 ml; Vt = 120.6 ml) pre-equilibrated to 100 mM sodium phosphate buffer, pH 7.0. The column was developed at 0.5 ml/min. β-Mannosidase activity eluted as a symmetrical peak at 75.0 ml. β-Mannosidase activity was assayed routinely using 1.0 mM para-nitrophenol (pNp) 1The abbreviations used are: pNppara-nitrophenolGlcpβNpp-nitrophenyl-β-D-glucopyranosideManpβNpp-nitrophenyl-β-D-mannopyranosideGalpβNpp-nitrophenyl-β-D-galactopyranosideGalpαNpp-nitrophenyl-α-D-galactopyranosideGlcpαNpp-nitrophenyl-α-glucopyranosideXylpβNpp-nitrophenyl-β-D-xylopyranosidePAGEpolyacrylamide gel electrophoresisX-glu5-bromo-4-chloro-3-indolyl-β-D-glucosideX-gal5-bromo-4-chloro-3-indolyl-β-D-galactosideGlcNAcN-acetylglucosamine. substrate equilibrated to the desired temperature and pH. After equilibrating the sample to the desired temperature and pH in a heat block containing silicone oil (Dow Corning Corp., Midland, MI), the reaction was initiated by adding equilibrated substrate to the sample in an Eppendorf tube (U.S.A. Scientific Products, Milton Keynes, United Kingdom). The reaction was stopped at 5 min by chilling on ice. After cooling, the liquid in the Eppendorf tube was transferred to a microtiter plate (Corning, Corning, NY). The increase in absorbance at 405 nm as a result of pNp liberation was measured using an EL 340 Microplate Bio-Kinetics Reader (Bio-Tek™ Instruments, Winooski, VT). All activities were corrected for thermal degradation of the pNp substrate, which was below 0.5% of the enzyme hydrolysis rate. Absorbances were converted to concentrations of pNp using standards of known concentration. All assays were performed in triplicate. One unit of glycosidase activity was defined as that amount of enzyme required to catalyze the release of 1.0 μmol of pNp/min. para-nitrophenol p-nitrophenyl-β-D-glucopyranoside p-nitrophenyl-β-D-mannopyranoside p-nitrophenyl-β-D-galactopyranoside p-nitrophenyl-α-D-galactopyranoside p-nitrophenyl-α-glucopyranoside p-nitrophenyl-β-D-xylopyranoside polyacrylamide gel electrophoresis 5-bromo-4-chloro-3-indolyl-β-D-glucoside 5-bromo-4-chloro-3-indolyl-β-D-galactoside N-acetylglucosamine. The purified enzyme was also tested for amylase activity. A standard reaction mixture contained 17 g/liter soluble starch equilibrated to the desired temperature and pH. The procedure was the same as above. The reaction was followed using the method of Laderman et al. (5Laderman K.A. Davis B.R. Krutzsch H.C. Lewis M.S. Griko Y.V. Privalov P.L. Anfinsen C.B. J. Biol. Chem. 1993; 268: 24394-24401Abstract Full Text PDF PubMed Google Scholar). One unit of amylase activity was defined as that amount of enzyme hydrolyzing 1 mg of starch/min. All assays were performed in triplicate. Total protein concentration was determined using a BCA protein assay reagent kit (Pierce). Samples were diluted to the linear range (where A595 = 0.1-1.0) and incubated with reagent at 50°C for 30 min in a sealed microtiter plate. The absorbance at 595 nm was determined using an EL 340 Microplate Bio-Kinetics Reader with albumin as the standard (Sigma). Isoelectric focusing was carried out on a Phast System (Pharmacia), according to manufacturer's protocols. Native- and SDS-PAGE were performed using standard procedures (38Sambrook J. Fritsch E. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). High molecular mass (Boehringer Mannheim) and broad pI standards (Pharmacia) were used for PAGE and isoelectric focusing, respectively. For β-mannosidase activity staining, non-fixed gels were incubated at 95°C for several minutes in 100 mM sodium phosphate buffer, pH 7.0, containing 1.0 mM ManpβNp. Upon the appearance of a yellow band, the gel was marked at that location. The P. furiosus β-mannosidase was treated with the bifunctional reagent dimethyl suberimidate (Sigma) according to Davies and Stark (39Davies G.E. Stark G.R. Proc. Natl. Acad. Sci. U. S. A. 1970; 66: 651-656Crossref PubMed Scopus (716) Google Scholar). The homogeneous enzyme (3.0 mg/ml) in 200 mM triethanolamine/HCl, pH 8.5, was mixed (in various proportions) with dimethyl suberimidate (1 mg/ml) in the same buffer and incubated for 3 h at 25°C. The reaction was stopped, and the proteins were denatured by incubation at 90°C for 60 min in the presence of 1% SDS and 1%β-mercaptoethanol as described by Pisani et al. (33Pisani A.M. Rella R. Raia C.A. Rozzo C. Nucci R. Gambacorta A. DeRosa M. Eur. J. Biochem. 1990; 287: 321-328Crossref Scopus (166) Google Scholar) and subjected to 10% SDS-PAGE. Aldolase (Boehringer Mannheim) was used as a cross-linking control as described by Pisani et al. (33Pisani A.M. Rella R. Raia C.A. Rozzo C. Nucci R. Gambacorta A. DeRosa M. Eur. J. Biochem. 1990; 287: 321-328Crossref Scopus (166) Google Scholar). Kinetics parameters of P. furiosus β-mannosidase were determined using standard reaction mixtures, containing either ManpβNp or GlcpβNp. The reactions were performed at 95°C. The release of pNp was measured as described above using different initial concentrations of substrate (0.05-10 mM). All assays were performed in triplicate. Values for the maximal reaction velocity (Vmax) and the Michaelis-Menten constant (Km) were determined from Lineweaver-Burk plots. Substrate specificity was determined using the standard reaction mixture, except that alternate substrates to ManpβNp were used. Depending on the substrate, either the amount of pNp released or the amount of starch degraded was measured after a 5-min incubation at 95°C. For thermostability determination, the homogeneous enzyme was incubated in Eppendorf tubes submersed in oil baths, at 90, 100, and 110°C. The samples were covered with Ampliwax (Perkin-Elmer) to prevent evaporation. At appropriate time intervals, aliquots were withdrawn and tested for β-mannosidase activity at 95°C in a standard reaction mixture. All DNA sequencing reactions were performed using either the Perkin-Elmer Applied Biosystems dye primer or dye terminator cycle sequencing kits and a model 377 automated DNA sequencer (Perkin-Elmer). Sequences were aligned and edited using the program Sequencher (Genecodes, Ann Arbor, MI). Purified β-mannosidase and β-glucosidase were denatured and run on 12.5% polyacrylamide using standard procedures (38Sambrook J. Fritsch E. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Protein was electroblotted to a polyvinylidene difluoride membrane and Ponceau S-stained (38Sambrook J. Fritsch E. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). N-terminal Edman degradation was performed on single bands with approximate molecular masses of 60 and 58 kDa for the β-mannosidase and β-glucosidase, respectively, using a liquid phase sequencer (Applied Biosystems model 477). The F factor F′kan from E. coli strain CSH118 (40Miller J.H. A Short Course in Bacterial Genetics: A Lab Manual and Handbook for E. coli and Related Bacteria. Cold Spring Harbor Laboratory, 1992Google Scholar) was introduced into the pho−phn−lac− E. coli strain BW14893 (41Lee K.-S. Metcalf W.W. Wanner B.L. J. Bacteriol. 1992; 174: 2501-2510Crossref PubMed Google Scholar). A library prepared from randomly sheared genomic P. furiosus DNA was obtained from M. Snead (Recombinant BioCatalysis, Inc., La Jolla, CA) and was introduced into BW14893 F′kan. Cells were plated on 100-mm LB plates containing 100 μg/ml ampicillin, 80 μg/ml methicillin, and 1 mM isopropyl β-D-thiogalactopyranoside at a density of greater than 1000 colonies/plate. Colony lifts were performed using Millipore HATF membrane filters. Transformation plates were returned to the 37°C incubator after the filter-lift to regenerate colonies. The transferred colonies were lysed with chloroform vapor in 150-mm glass Petri dishes. The filters containing lysed colonies were transferred to 100-mm glass Petri dishes containing Whatman 3MM filter paper saturated with Z buffer (40Miller J.H. A Short Course in Bacterial Genetics: A Lab Manual and Handbook for E. coli and Related Bacteria. Cold Spring Harbor Laboratory, 1992Google Scholar) and either 1 mg/ml X-glu (Diagnostic Chemicals Ltd, Oxford, CT) or 1 mg/ml X-gal (ChemBridge Corp., Northbrook, IL). The dishes were incubated at 80-85°C. “Positives” were observed as blue spots on the filter membranes. Approximately 20-30 positives/plate were observed. One positive clone from the X-gal assay was purified by restreaking cells from the original regenerated plate. Several other positives from both assays were recovered by transforming DNA isolated from the blue spots on the filter lifts into electrocompetent E. coli DH10B cells. The filter-lift assay was repeated on transformation plates to identify “positives.” LB medium containing 100 μg/ml ampicillin was inoculated with repurified positives and incubated at 37°C overnight. Plasmid DNA was isolated from these cultures, and the plasmid insert was sequenced. The partial sequences of three clones (two from X-glu, one from X-gal) that contained inserts revealed that two of the clones overlapped (one from X-gal, one from X-glu) and one was unique (X-glu). Fractions from DEAE-Sepharose Fast Flow anion-exchange chromatography were assayed for α-amylase, α-glucosidase, β-glucosidase, and β-mannosidase activities (Fig. 1). Three peaks of β-glycosidase activity eluted at 0, 0.26-0.28, and 0.33-0.36 M NaCl, respectively. The peaks at 0 and 0.33-0.36 M NaCl had an identical substrate specificity to that reported for the β-glucosidase (4Kengen S.W.M. Luesink E.J. Stams A.J.M. Zehnder A.J.B. Eur. J. Biochem. 1993; 213: 305-312Crossref PubMed Scopus (246) Google Scholar). The peak of β-glycosidase activity that eluted between 0.26 and 0.28 M NaCl showed different relative specific activities on several aryl glycosides than the previously reported glycosyl hydrolases from P. furiosus (4Kengen S.W.M. Luesink E.J. Stams A.J.M. Zehnder A.J.B. Eur. J. Biochem. 1993; 213: 305-312Crossref PubMed Scopus (246) Google Scholar, 5Laderman K.A. Davis B.R. Krutzsch H.C. Lewis M.S. Griko Y.V. Privalov P.L. Anfinsen C.B. J. Biol. Chem. 1993; 268: 24394-24401Abstract Full Text PDF PubMed Google Scholar, 6Brown S.H. Kelly R.M. Appl. Environ. Microbiol. 1993; 59: 2614-2621Crossref Google Scholar, 7Costantino H.R. Brown S.H. Kelly R.M. J. Bacteriol. 1990; 172: 3654-3660Crossref PubMed Google Scholar). The purification procedure for this β-glycosidase activity is shown in Table I. The purified enzyme was tested for its substrate specificity. Table II shows the activity of the enzyme toward several aryl-glycosides. The substrate specificities of the P. furiosus β-glucosidase and α-glucosidase are reported for comparison. The new enzyme exhibited the highest specific activity with ManpβNp as substrate and, therefore, was characterized as a β-mannosidase. The β-mannosidase did not hydrolyze the α-glycosidic linkages of GlcpαNp or GalpαNp, nor did it degrade starch. The purified enzyme displayed optimal activity at 105°C (Fig. 2) and pH 7.4 (Fig. 3). An isoelectric point of 6.9 was determined from an activity-stained isoelectric focusing gel (data not shown). The molecular mass of denatured β-mannosidase was approximately 60 kDa as determined from SDS-PAGE. When the β-mannosidase was treated with dimethyl suberimidate (at the enzyme/bifunctional reagent molar ratio of 1:300), four protein bands were noted after SDS-PAGE, corresponding to molecular masses of 60, 140, 180, and 220 kDa (Fig. 4). These results indicate that the P. furiosus β-mannosidase in its native conformation is a tetramer consisting of four identical subunits similar to the S. solfataricus glycosidases (32Grogan D.W. Appl. Environ. Microbiol. 1991; 57: 1644-1649Crossref PubMed Google Scholar, 33Pisani A.M. Rella R. Raia C.A. Rozzo C. Nucci R. Gambacorta A. DeRosa M. Eur. J. Biochem. 1990; 287: 321-328Crossref Scopus (166) Google Scholar) and the P. furiosus β-glucosidase (4Kengen S.W.M. Luesink E.J. Stams A.J.M. Zehnder A.J.B. Eur. J. Biochem. 1993; 213: 305-312Crossref PubMed Scopus (246) Google Scholar), which were also determined to be homotetramers. The rate dependence on substrate concentration followed Michaelis-Menten kinetics. From Lineweaver-Burk plots, Km and Vmax values of 0.79 mM and 31.1 units/mg were determined with ManpβNp as substrate (Table III). In addition, the same analysis with GlcpβNp as substrate was used to determine Km and Vmax values of 2.9 mM and 14.8 units/mg. Assuming that the smallest catalytic unit of the β-mannosidase was 1 monomer unit with a molecular mass of 60 kDa, turnover numbers (kcat values) of 40 and 5.3 s−1 were calculated for ManpβNp and GlcpβNp, respectively. Table III provides a comparison between the kinetic rate constants of the β-mannosidase and β-glucosidase from P. furiosus. The β-mannosidase had a significantly lower catalytic efficiency for the hydrolysis of β-glycosidic bonds than the β-glucosidase. The β-mannosidase had a higher Km and lower Vmax with GlcpβNp as substrate than with ManpβNp, indicating both a more specific binding and a more efficient cleavage of}, number={39}, journal={Journal of Biological Chemistry}, publisher={Elsevier BV}, author={Bauer, Michael W. and Bylina, Edward J. and Swanson, Ronald V. and Kelly, Robert M.}, year={1996}, month={Sep}, pages={23749–23755} }
 @article{kelly_1996, title={Confessions of a graduate student recruiter}, volume={30}, number={4}, journal={Chemical Engineering Education}, author={Kelly, R.M.}, year={1996}, pages={262–265} }
 @article{rinker_kelly_1996, title={Growth Physiology of the Hyperthermophilic Archaeon Thermococcus litoralis: Development of a Sulfur-Free Defined Medium, Characterization of an Exopolysaccharide, and Evidence of Biofilm Formation}, volume={62}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.62.12.4478-4485.1996}, DOI={10.1128/aem.62.12.4478-4485.1996}, abstractNote={Nutritional characteristics of the hyperthermophilic archaeon Thermococcus litoralis have been investigated with emphasis on the development of a sulfur-free, defined growth medium, analysis of an exocellular polysaccharide, and formation of a biofilm. An artificial-seawater-based medium, containing 16 amino acids, adenine, uracil, vitamins, and trace elements, allowed T. litoralis to attain growth rates and cell densities similar to those found with complex media. Four amino acids (alanine, asparagine, glutamine, and glutamate) were not included due to their lack of effect on growth rates and cell yields. In this medium, cultures reached densities of 10(sup8) cells per ml, with doubling times of 55 min (without maltose) or 43 min (with maltose). Neither the addition of elemental sulfur nor the presence of H(inf2) significantly affected cell growth. A sparingly soluble exopolysaccharide was produced by T. litoralis grown in either defined or complex media. Analysis of the acid-hydrolyzed exopolysaccharide yielded mannose as the only monosaccharidic constituent. This exopolysaccharide is apparently involved in the formation of a biofilm on polycarbonate filters and glass slides, which is inhabited by high levels of T. litoralis. Biofilm formation by hyperthermophilic microorganisms in geothermal environments has not been examined to any extent, but further work in this area may provide information related to the interactions among high-temperature organisms.}, number={12}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Rinker, K D and Kelly, R M}, year={1996}, month={Dec}, pages={4478–4485} }
 @inbook{bauer_halio_kelly_1996, title={Proteases and Glycosyl Hydrolases from Hyperthermophilic Microorganisms}, ISBN={9780120342488}, ISSN={0065-3233}, url={http://dx.doi.org/10.1016/s0065-3233(08)60364-2}, DOI={10.1016/s0065-3233(08)60364-2}, abstractNote={This chapter discusses hydrolytic enzymes proteases and glycosyl hydrolases. Many heterotrophic hyperthermophilic micro-organisms (those able to grow above 90°C with an optimum above 80°C) isolated, utilize peptides and carbohydrates to fulfill their nutritional requirements. Assimilation of these substrates is initiated by an array of hydrolytic enzymes, particularly proteases and glycosyl hydrolases. A number of these hydrolases are isolated from several hyperthermophilic species and are characterized biochemically. These hydrolytic enzymes from hyperthermophiles involved in polypeptide and carbohydrate modifications are identified and characterized. These enzymes are thermostable and thermoactive, and in many cases, they have substrate specificities analogous to less thermostable counterparts from mesophilic organisms. Most proteases and glycosidases isolated from hyperthermophilic micro-organisms come from a very limited number of species of the archaeal genera Pyrococcus and Thermococcus and the eubacterial genus Thermotoga. The future study of these enzymes provides clues to the evolution of physiological functions, metabolic pathways, and protein structure. Cellular regulation pathways for many of these enzymes are not yet determined.}, booktitle={Advances in Protein Chemistry}, publisher={Elsevier}, author={Bauer, Michael W. and Halio, Sheryl B. and Kelly, Robert M.}, year={1996}, pages={271–310} }
 @article{halio_blumentals_short_merrill_kelly_1996, title={Sequence, expression in Escherichia coli, and analysis of the gene encoding a novel intracellular protease (PfpI) from the hyperthermophilic archaeon Pyrococcus furiosus}, volume={178}, ISSN={0021-9193 1098-5530}, url={http://dx.doi.org/10.1128/jb.178.9.2605-2612.1996}, DOI={10.1128/jb.178.9.2605-2612.1996}, abstractNote={A previously identified intracellular proteolytic activity in the hyperthermophilic archaeon Pyrococcus furiosus (I. I. Blumentals, A. S. Robinson, and R. M. Kelly, Appl. Environ. Microbiol. 56:1992-1998, 1990) was found to be a homomultimer consisting of 18.8-kDa subunits. Dissociation of this native P. furiosus protease I (PfpI) into a single subunit was seen by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) but only after trichloroacetic acid precipitation; heating to 95 degrees C in the presence of 2% SDS and 80 mM dithiothreitol did not dissociate the protein. The gene (pfpI) coding for this protease was located in genomic digests by Southern blotting with probes derived from the N-terminal amino acid sequence. pfpI was cloned, sequenced, and expressed in active form in Escherichia coli as a fusion protein with a histidine tag. The recombinant protease from E. coli showed maximum proteolytic activity at 95 degrees C, and its half-life was 19 min at this temperature. This level of stability was significantly below that previously reported for the enzyme purified by electroelution of a 66-kDa band from SDS-PAGE after extended incubation of cell extracts at 98 degrees C in 1% SDS (>30 h). The pfpI gene codes for a polypeptide of 166 amino acid residues lacking any conserved protease motifs; no protease activity was detected for the 18.8-kDa PfpI subunit (native or recombinant) by substrate gel assay. Although an immunological relationship of this protease to the eukaryotic proteasome has been seen previously, searches of the available databases identified only two similar amino acid sequences: an open reading frame of unknown function from Staphylococcus aureus NCTC 8325 (171 amino acid residues, 18.6 kDa, 41% identity) and an open reading frame also of unknown function in E. coli (172 amino acid residues, 18.8 kDa, 47% identity). Primer extension experiments with P. furiosus total RNA defined the 5' end of the transcript. There are only 10 nucleotides upstream of the start of translation; therefore, it is unlikely that there are any pre- or pro-regions associated with PfpI which could have been used for targeting or assembly of this protease. Although PfpI activity appears to be the dominant proteolytic activity in P. furiosus cell extracts, the physiological function of PfpI is unclear.}, number={9}, journal={Journal of Bacteriology}, publisher={American Society for Microbiology}, author={Halio, S B and Blumentals, I I and Short, S A and Merrill, B M and Kelly, R M}, year={1996}, month={May}, pages={2605–2612} }
 @inbook{kelly_1995, place={New York}, edition={8th}, title={Biochemical engineering}, ISBN={0-07-911504-7}, booktitle={McGraw-Hill Encyclopedia of Science and Technology}, publisher={McGraw-Hill}, author={Kelly, R.M.}, editor={Parker, S.P.Editor}, year={1995} }
 @article{peeples_kelly_1995, title={Bioenergetic Response of the Extreme Thermoacidophile Metallosphaera sedula to Thermal and Nutritional Stresses}, volume={61}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.61.6.2314-2321.1995}, DOI={10.1128/aem.61.6.2314-2321.1995}, abstractNote={The bioenergetic response of the extremely thermoacidophilic archaeon Metallosphaera sedula to thermal and nutritional stresses was examined. Continuous cultures (pH 2.0, 70(deg)C, and dilution rate of 0.05 h(sup-1)) in which the levels of Casamino Acids and ferrous iron in growth media were reduced by a step change of 25 to 50% resulted in higher levels of several proteins, including a 62-kDa protein immunologically related to the molecular chaperone designated thermophilic factor 55 in Sulfolobus shibatae (J. D. Trent, J. Osipiuk, and T. Pinkau, J. Bacteriol. 172:1478-1484, 1990), on sodium dodecyl sulfate-polyacrylamide gels. The 62-kDa protein was also noted at elevated levels in cells that had been shifted from 70 to either 80 or 85(deg)C. The proton motive force ((Delta)p), transmembrane pH ((Delta)pH), and membrane potential ((Delta)(psi)) were determined for samples obtained from continuous cultures (pH 2.0, 70(deg)C, and dilution rate of 0.05 h(sup-1)) and incubated under nutritionally and/or thermally stressed and unstressed conditions. At 70(deg)C under optimal growth conditions, M. sedula was typically found to have a (Delta)p of approximately -190 to -200 mV, the result of an intracellular pH of 5.4 (extracellular pH, 2.0) and a (Delta)(psi) of +40 to +50 mV (positive inside). After cells had been shifted to either 80 or 85(deg)C, (Delta)(psi) decreased to nearly 0 mV and internal pH approached 4.0 within 4 h of the shift; respiratory activity, as evidenced by iron speciation in parallel temperature-shifted cultures on iron pyrite, had ceased by this point. If cultures shifted from 70 to 80(deg)C were shifted back to 70(deg)C after 4 h, cells were able to regain pyrite oxidation capacity and internal pH increased to nearly normal levels after 13 h. However, (Delta)(psi) remained close to 0 mV, possibly the result of enhanced ionic exchange with media upon thermal damage to cell membranes. Further, when M. sedula was subjected to an intermediate temperature shift from 73 to 79(deg)C, an increase in pyrite dissolution (ferric iron levels doubled) over that of the unshifted control at 73(deg)C was noted. The improvement in leaching was attributed to the synergistic effect of chemical and biological factors. As such, periodic exposure to higher temperatures, followed by a suitable recovery period, may provide a basis for improving bioleaching rates of acidophilic chemolithotrophs.}, number={6}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Peeples, T L and Kelly, R M}, year={1995}, month={Jun}, pages={2314–2321} }
 @inbook{schicho_brown_blumentals_peeples_duffaud_kelly_1995, title={Continuous culture techniques for extremely thermophilic and hyperthermophilic microorganisms}, booktitle={Archaea - A Laboratory Manual}, publisher={Cold Spring Harbor Press}, author={Schicho, R.N. and Brown, S.H. and Blumentals, I.I. and Peeples, T.L. and Duffaud, G.D. and Kelly, R.M.}, editor={Robb, F.T.Editor}, year={1995} }
 @article{adams_kelly_1995, title={Enzymes From Microorganisms in Extreme Environments}, volume={73}, ISSN={0009-2347 2157-4936}, url={http://dx.doi.org/10.1021/cen-v073n051.p032}, DOI={10.1021/cen-v073n051.p032}, abstractNote={RETURN TO ISSUEPREVNewsNEXTENZYMES FROM MICROORGANISMS IN EXTREME ENVIRONMENTS MICHAEL W. W. ADAMS and ROBERT M. KELLYView Author Information University of Georgia North Carolina State UniversityCite this: Chem. Eng. News 1995, 73, 51, 32–42Publication Date (Print):December 18, 1995Publication History Published online12 November 2010Published inissue 18 December 1995https://doi.org/10.1021/cen-v073n051.p032Copyright © 1995 AMERICAN CHEMICAL SOCIETYArticle Views30Altmetric-Citations94LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (3 MB) SUBJECTS:Genetics,Peptides and proteins Get e-Alerts}, number={51}, journal={Chemical & Engineering News Archive}, publisher={American Chemical Society (ACS)}, author={Adams, Michael W. W. and Kelly, Robert M.}, year={1995}, month={Dec}, pages={32–42} }
 @article{adams_perler_kelly_1995, title={Extremozymes: Expanding the Limits of Biocatalysis}, volume={13}, ISSN={1087-0156 1546-1696}, url={http://dx.doi.org/10.1038/nbt0795-662}, DOI={10.1038/nbt0795-662}, number={7}, journal={Nature Biotechnology}, publisher={Springer Science and Business Media LLC}, author={Adams, Michael W.W. and Perler, Francine B. and Kelly, Robert M.}, year={1995}, month={Jul}, pages={662–668} }
 @misc{kelly_khan_leduc_tayal_prud'homme_1995, title={Methods and compositions for fracturing subterranean formations}, volume={5,421,412}, number={1995 Jun. 6}, publisher={Washington, DC: U.S. Patent and Trademark Office}, author={Kelly, R. M. and Khan, S. A. and Leduc, P. and Tayal, A. and Prud'homme, R. K.}, year={1995} }
 @book{kelly_robinson_blumentals_brown_anfinsen_1995, title={Proteolytic enzymes from hyperthermophilic bacteria and processes for their production}, number={5,391,489}, author={Kelly, R.M. and Robinson, A.S. and Blumentals, I.I. and Brown, S.H. and Anfinsen, C.B.}, year={1995}, month={Feb} }
 @article{vieille_hess_kelly_zeikus_1995, title={xylA cloning and sequencing and biochemical characterization of xylose isomerase from Thermotoga neapolitana}, volume={61}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.61.5.1867-1875.1995}, DOI={10.1128/aem.61.5.1867-1875.1995}, abstractNote={The xylA gene coding for xylose isomerase from the hyperthermophile Thermotoga neapolitana 5068 was cloned, sequenced, and expressed in Escherichia coli. The gene encoded a polypeptide of 444 residues with a calculated molecular weight of 50,892. The native enzyme was a homotetramer with a molecular weight of 200,000. This xylose isomerase was a member of the family II enzymes (these differ from family I isomerases by the presence of approximately 50 additional residues at the amino terminus). The enzyme was extremely thermostable, with optimal activity above 95 degrees C. The xylose isomerase showed maximum activity at pH 7.1, but it had high relative activity over a broad pH range. The catalytic efficiency (kcat/Km) of the enzyme was essentially constant between 60 and 90 degrees C, and the catalytic efficiency decreased between 90 and 98 degrees C primarily because of a large increase in Km. The T. neapolitana xylose isomerase had a higher turnover number and a lower Km for glucose than other family II xylose isomerases. Comparisons with other xylose isomerases showed that the catalytic and cation binding regions were well conserved. Comparison of different xylose isomerase sequences showed that numbers of asparagine and glutamine residues decreased with increasing enzyme thermostability, presumably as a thermophilic strategy for diminishing the potential for chemical denaturation through deamidation at elevated temperatures.}, number={5}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Vieille, C and Hess, J M and Kelly, R M and Zeikus, J G}, year={1995}, month={May}, pages={1867–1875} }
 @book{kelly_wittrup_karkare_1994, place={New York}, title={Biochemical Engineering VIII - Proceedings}, volume={745}, number={1}, journal={Annals of the New York Academy of Sciences}, publisher={New York Academy of Sciences}, year={1994} }
 @article{kelly_peeples_halio_rinker_duffaud_1994, title={Extremely Thermophilic Microorganisms: Metabolic strategies, genetic characteristics and biotechnological potential of extremely thermophilic microorganisms}, volume={745}, DOI={10.1111/j.1749-6632.1994.tb44393.x Citations: 5}, number={1}, journal={Annals of the New York Academy of Sciences}, author={Kelly, R.M. and Peeples, T.L. and Halio, S.B. and Rinker, K.D. and Duffaud, G.D.}, year={1994}, pages={409–425} }
 @article{adams_baross_kelly_1994, title={Life in boiling water}, volume={30}, number={7}, journal={Chemistry in Britain}, author={Adams, M.W.W. and Baross, J.A. and Kelly, R.M.}, year={1994}, pages={555–558} }
 @misc{kelly_adams_1994, title={METABOLISM IN HYPERTHERMOPHILIC MICROORGANISMS}, volume={66}, ISSN={["0003-6072"]}, DOI={10.1007/BF00871643}, number={1-3}, journal={ANTONIE VAN LEEUWENHOEK INTERNATIONAL JOURNAL OF GENERAL AND MOLECULAR MICROBIOLOGY}, author={KELLY, RM and ADAMS, MWW}, year={1994}, pages={247–270} }
 @article{adams_kelly_1994, title={Thermostability and thermoactivity of enzymes from hyperthermophilic archaea}, volume={2}, ISSN={0968-0896}, url={http://dx.doi.org/10.1016/0968-0896(94)85015-1}, DOI={10.1016/0968-0896(94)85015-1}, abstractNote={Enzymes from hyperthermophilic microorganisms are characteristically thermostable and thermoactive at extremely high temperatures. Information about the basis for the structure and function of these novel proteins is beginning to emerge. However, there are very few generalizations that can be drawn at this point that can be derived from the limited number of studies that have focused on biocatalysis and thermostability at extremely high temperatures.}, number={7}, journal={Bioorganic & Medicinal Chemistry}, publisher={Elsevier BV}, author={Adams, M.W.W. and Kelly, R.M.}, year={1994}, month={Jul}, pages={659–667} }
 @inbook{kelly_1993, place={Bethesda, MD}, title={Biocatalysis at extreme temperatures}, booktitle={Research opportunities in biomolecular engineering : the interface between chemical engineering and biology, December 7-8, 1992, proceedings}, publisher={NIH Press}, author={Kelly, R.M.}, editor={Georgiou, G. and Glowinski, I.Editors}, year={1993} }
 @inbook{kelly_whitesides_1993, place={Bethesda, MD}, title={Biocatalysis: An overview}, booktitle={Research opportunities in biomolecular engineering : the interface between chemical engineering and biology, December 7-8, 1992, proceedings}, publisher={NIH Press}, author={Kelly, R.M. and Whitesides, G.}, editor={Georgiou, G. and Glowinski, I.Editors}, year={1993} }
 @article{schicho_ma_adams_kelly_1993, title={Bioenergetics of sulfur reduction in the hyperthermophilic archaeon Pyrococcus furiosus}, volume={175}, ISSN={0021-9193 1098-5530}, url={http://dx.doi.org/10.1128/jb.175.6.1823-1830.1993}, DOI={10.1128/jb.175.6.1823-1830.1993}, abstractNote={The bioenergetic role of the reduction of elemental sulfur (S0) in the hyperthermophilic archaeon (formerly archaebacterium) Pyrococcus furiosus was investigated with chemostat cultures with maltose as the limiting carbon source. The maximal yield coefficient was 99.8 g (dry weight) of cells (cdw) per mol of maltose in the presence of S0 but only 51.3 g (cdw) per mol of maltose if S0 was omitted. However, the corresponding maintenance coefficients were not found to be significantly different. The primary fermentation products detected were H2, CO2, and acetate, together with H2S, when S0 was also added to the growth medium. If H2S was summed with H2 to represent total reducing equivalents released during fermentation, the presence of S0 had no significant effect on the pattern of fermentation products. In addition, the presence of S0 did not significantly affect the specific activities in cell extracts of hydrogenase, sulfur reductase, alpha-glucosidase, or protease. These results suggest either that S0 reduction is an energy-conserving reaction, i.e., S0 respiration, or that S0 has a stimulatory effect on or helps overcome a process that is yield limiting. A modification of the Entner-Doudoroff glycolytic pathway has been proposed as the primary route of glucose catabolism in P. furiosus (S. Mukund and M. W. W. Adams, J. Biol. Chem. 266:14208-14216, 1991). Operation of this pathway should yield 4 mol of ATP per mol of maltose oxidized, from which one can calculate a value of 12.9 g (cdw) per mol of ATP for non-S0 growth. Comparison of this value to the yield data for growth in the presence of S0 reduction is equivalent to an ATP yield of 0.5 mol of ATP per mol of S0 reduced. Possible mechanism to account for this apparent energy conservation are discussed.}, number={6}, journal={Journal of Bacteriology}, publisher={American Society for Microbiology}, author={Schicho, R N and Ma, K and Adams, M W and Kelly, R M}, year={1993}, month={Mar}, pages={1823–1830} }
 @article{peeples_kelly_1993, title={Bioenergetics of the metal/sulfur-oxidizing extreme thermoacidophile, Metallosphaera sedula}, volume={72}, ISSN={0016-2361}, url={http://dx.doi.org/10.1016/0016-2361(93)90345-3}, DOI={10.1016/0016-2361(93)90345-3}, abstractNote={Abstract Identification of more effective biocatalysts than Thiobacillus ferrooxidans has been of interest for the optimization of biological removal of inorganic sulfur from coal. The recently isolated thermoacidophile, Metallosphaera sedula , leaches metal sulfides at rapid rates and could be a feasible biocatalytic alternative for such use. The bioenergetic and biocatalytic features of M. sedula as they apply to metal leaching, with particular attention to coal pyrite oxidation, are currently being evaluated. The questions examined include 1. (1) how does M. sedula compare with other microorganisms with similar bioleaching capabilities, 2. (2) how do inorganic energy substrates factor into M. sedula's metabolic scheme, and 3. (3) how can higher metal leaching rates be achieved with M. sedula ? To answer these questions, the relation between the organism's metabolic energy sources (sulfur, iron pyrite, organic compounds) and intracellular energy-requiring reactions is being studied. It is hoped that this framework can be used to evaluate and improve the various microbial options for inorganic sulfur removal from coal.}, number={12}, journal={Fuel}, publisher={Elsevier BV}, author={Peeples, T.L and Kelly, R.M.}, year={1993}, month={Dec}, pages={1619–1624} }
 @article{brown_kelly_1993, title={Characterization of Amylolytic Enzymes, Having Both α-1,4 and α-1,6 Hydrolytic Activity, from the Thermophilic Archaea
            Pyrococcus furiosus
            and
            Thermococcus litoralis}, volume={59}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.59.8.2614-2621.1993}, DOI={10.1128/aem.59.8.2614-2621.1993}, abstractNote={Extracellular pullulanases were purified from cell-free culture supernatants of the marine thermophilic archaea Thermococcus litoralis (optimal growth temperature, 90°C) and Pyrococcus furiosus (optimal growth temperature, 98°C). The molecular mass of the T. litoralis enzyme was estimated at 119,000 Da by electrophoresis, while the P. furiosus enzyme exhibited a molecular mass of 110,000 Da under the same conditions. Both enzymes tested positive for bound sugar by the periodic acid-Schiff technique and are therefore glycoproteins. The thermoactivity and thermostability of both enzymes were enhanced in the presence of 5 mM Ca 2+ , and under these conditions, enzyme activity could be measured at temperatures of up to 130 to 140°C. The addition of Ca 2+ also affected substrate binding, as evidenced by a decrease in K m for both enzymes when assayed in the presence of this metal. Each of these enzymes was able to hydrolyze, in addition to the α-1,6 linkages in pullulan, α-1,4 linkages in amylose and soluble starch. Neither enzyme possessed activity against maltohexaose or other smaller α-1,4-linked oligosaccharides. The enzymes from T. litoralis and P. furiosus appear to represent highly thermostable amylopullulanases, versions of which have been isolated from less-thermophilic organisms. The identification of these enzymes further defines the saccharide-metabolizing systems possessed by these two organisms.}, number={8}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Brown, Stephen H. and Kelly, Robert M.}, year={1993}, month={Aug}, pages={2614–2621} }
 @article{kelly_brown_1993, title={Enzymes from high-temperature microorganisms}, volume={4}, ISSN={0958-1669}, url={http://dx.doi.org/10.1016/0958-1669(93)90123-e}, DOI={10.1016/0958-1669(93)90123-e}, abstractNote={Enzymes derived from microorganisms growing at extreme temperatures are of biotechnological use as highly thermostable biocatalysts and should provide insight into the intrinsic basis of protein stability. So far, only DNA polymerases from these organisms have been put to commercial use, although the application of other classes of highly thermostable enzymes is being considered. Problems in the cultivation of high-temperature microorganisms and in the production of their enzymes still hampers progress in this field.}, number={2}, journal={Current Opinion in Biotechnology}, publisher={Elsevier BV}, author={Kelly, Robert M. and Brown, Stephen H.}, year={1993}, month={Apr}, pages={188–192} }
 @article{ma_schicho_kelly_adams_1993, title={Hydrogenase of the hyperthermophile Pyrococcus furiosus is an elemental sulfur reductase or sulfhydrogenase: evidence for a sulfur-reducing hydrogenase ancestor.}, volume={90}, ISSN={0027-8424 1091-6490}, url={http://dx.doi.org/10.1073/pnas.90.11.5341}, DOI={10.1073/pnas.90.11.5341}, abstractNote={Microorganisms growing near and above 100 degrees C have recently been discovered near shallow and deep sea hydrothermal vents. Most are obligately dependent upon the reduction of elemental sulfur (S0) to hydrogen sulfide (H2S) for optimal growth, even though S0 reduction readily occurs abiotically at their growth temperatures. The sulfur reductase activity of the anaerobic archaeon Pyrococcus furiosus, which grows optimally at 100 degrees C by a metabolism that produces H2S if S0 is present, was found in the cytoplasm. It was purified anaerobically and was shown to be identical to the hydrogenase that had been previously purified from this organism. Both S0 and polysulfide served as substrates for H2S production, and the S0 reduction activity but not the H2-oxidation activity was enhanced by the redox protein rubredoxin. The H2-oxidizing and S0-reduction activities of the enzyme also showed different responses to pH, temperature, and inhibitors. This bifunctional "sulfhydrogenase" enzyme can, therefore, dispose of the excess reductant generated during fermentation using either protons or polysulfides as the electron acceptor. In addition, purified hydrogenases from both hyperthermophilic and mesophilic representatives of the archaeal and bacterial domains were shown to reduce S0 to H2S. It is suggested that the function of some form of ancestral hydrogenase was S0 reduction rather than, or in addition to, the reduction of protons.}, number={11}, journal={Proceedings of the National Academy of Sciences}, publisher={Proceedings of the National Academy of Sciences}, author={Ma, K. and Schicho, R. N. and Kelly, R. M. and Adams, M. W.}, year={1993}, month={Jun}, pages={5341–5344} }
 @article{schicho_snowden_mukund_park_adams_kelly_1993, title={Influence of tungsten on metabolic patterns in Pyrococcus furiosus, a hyperthermophilic archaeon}, volume={159}, ISSN={0302-8933 1432-072X}, url={http://dx.doi.org/10.1007/bf00290921}, DOI={10.1007/bf00290921}, number={4}, journal={Archives of Microbiology}, publisher={Springer Science and Business Media LLC}, author={Schicho, Richard N. and Snowden, Lesley J. and Mukund, Swarnalatha and Park, Jae-Bum and Adams, Michael W. W. and Kelly, Robert M.}, year={1993}, month={Apr}, pages={380–385} }
 @book{starnes_kelly_brown_1993, title={Method for glucose isomerization using xylose isomerase purified from Thermotoga maritima and Thermotoga neapolitana}, number={5,268,280}, author={Starnes, R.L. and Kelly, R.M. and Brown, S.H.}, year={1993}, month={Dec} }
 @book{starnes_kelly_brown_1993, title={Novel Isomerization Enzymes}, number={5,219,751}, author={Starnes, R.L. and Kelly, R.M. and Brown, S.H.}, year={1993}, month={Jun} }
 @book{kelly_robinson_blumentals_brown_anfinsen_1993, title={Proteolytic Enzymes from Hyperthermophilic Bacteria and Processes for their Production}, number={5,242,817}, author={Kelly, R.M. and Robinson, A.S. and Blumentals, I.I. and Brown, S.H. and Anfinsen, C.B.}, year={1993}, month={Sep} }
 @article{brown_sjøholm_kelly_1993, title={Purification and characterization of a highly thermostable glucose isomerase produced by the extremely thermophilic eubacterium,Thermotoga maritima}, volume={41}, ISSN={0006-3592}, url={http://dx.doi.org/10.1002/bit.260410907}, DOI={10.1002/bit.260410907}, abstractNote={Thermotoga maritima, among the most thermophilic eubacteria currently known, produces glucose isomerase when grow in the presence of xylose. The purified enzyme is a homotetramer with submit molecular Wight of about 45,000. It has a number of features in common with previously described glucose isomerases-pH optimum of 6.5 to 7.5, presence of activesite histidine, requirement for metal cations such as Co2+ and Mg2+, and preference for xylose as substrate. In addition, it has significant sequence/structural homology with other glucose isomerases, as shown by both N-terminal sequencing and immunological crossreactivity. The T. maritima enzyme is distinguished by its extreme thermostability–a temperature optimum of 105 to 110°C, and an estimated half-life of 10 minutes at 120°C, pH 7.0. The high degree of thermostability, coupled with a neutral to slightly acid pH optimum, reveal this enzyme to be a promising candidate for improvement of the industrial glucose isomerization process © 1993 Wiley & Sons, Inc.}, number={9}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Brown, Stephen H. and Sjøholm, Carsten and Kelly, Robert M.}, year={1993}, month={Apr}, pages={878–886} }
 @article{schuliger_brown_baross_kelly_1993, title={Purification and characterization of a novel amylolytic enzyme from ES 4, a marine hyperthermophilic archaeum}, volume={2}, number={2}, journal={Molecular Marine Biology and Biotechnology}, author={Schuliger, J.W. and Brown, S.H. and Baross, J.A. and Kelly, R.M.}, year={1993}, pages={76–87} }
 @article{diruggiero_achenbach_brown_kelly_robb_1993, title={Regulation of ribosomal RNA transcription by growth rate of the hyperthermophilic Archaeon,Pyrococcus furiosus}, volume={111}, ISSN={0378-1097 1574-6968}, url={http://dx.doi.org/10.1111/j.1574-6968.1993.tb06379.x}, DOI={10.1111/j.1574-6968.1993.tb06379.x}, abstractNote={We have studied the single rRNA gene cluster from the Archaeon, Pyrococcus furiosus. This isolate grows optimally at 100°C and is thus a hyperthermophile. In P. furiosus, transcription of 16S rRNA is subject to regulation over a 7.5-fold range in response to a 20-fold increase in growth rate. The single cluster encoding the 16S and 23S rRNA genes of P. furiosus was cloned and the 1.9 kb region upstream of the 16S rRNA gene was sequenced.}, number={2-3}, journal={FEMS Microbiology Letters}, publisher={Oxford University Press (OUP)}, author={DiRuggiero, Jocelyne and Achenbach, Laurie A. and Brown, Stephen H. and Kelly, Robert M. and Robb, Frank T.}, year={1993}, month={Aug}, pages={159–164} }
 @article{adams_kelly_1992, series={ACS Symposium Series}, title={Biocatalysis at Extreme Temperatures}, volume={7}, ISBN={9780841224582 9780841213548}, ISSN={0097-6156 1947-5918}, url={http://dx.doi.org/10.1021/bk-1992-0498}, DOI={10.1021/bk-1992-0498}, abstractNote={Enzymes are typically labile molecules and thus are adversely affected when exposed to any type of extreme conditions. As such, biocatalysis, in either a physiological or biotechnological sense, has usually constrained to a rather narrow range of temperature, pH, pressure, ionic strength and to an aqueous environment. In fact, given its physiological role, and the need at times to regulate enzymatic activity, this is appropriate. Unfortunately, the use of biological catalysts for technological purpose necessitates that enzymes be stable and functional in nonphysiological environments. The challenge then is to either isolate enzymes more suitable for a particular application or be able to modify existing enzymes systematically to improve their stability and/or function. While a number of thermostable enzymes have been studied previously, the focus here is on thermostable enzymes produced by high temperature microorganisms.}, publisher={American Chemical Society}, year={1992}, month={Jul}, collection={ACS Symposium Series} }
 @inbook{kelly_brown_blumentals_adams_1992, title={Characterization of Enzymes from High-Temperature Bacteria}, ISBN={9780841224582 9780841213548}, ISSN={0097-6156 1947-5918}, url={http://dx.doi.org/10.1021/bk-1992-0498.ch003}, DOI={10.1021/bk-1992-0498.ch003}, abstractNote={The purification and characterization of enzymes from bacteria that grow at extremely high temperatures presents numerous challenges. In addition to selecting and cultivating appropriate microorganisms to study, there are many other distinguishing features related to the study of "hyperthermophilic" enzymes. These are discussed and illustrated through case studies involving an α-glucosidase and a rubredoxin purified from the hyperthermophile, Pyrococcus furiosus, an organism that grows optimally at 100°C.}, booktitle={ACS Symposium Series}, publisher={American Chemical Society}, author={Kelly, Robert M. and Brown, S. H. and Blumentals, I. I. and Adams, Michael W. W.}, year={1992}, month={Jul}, pages={23–41} }
 @inbook{adams_park_mukund_blamey_kelly_1992, series={ACS Symposium Series}, title={Metabolic Enzymes from Sulfur-Dependent, Extremely Thermophilic Organisms}, ISBN={9780841224582 9780841213548}, ISSN={0097-6156 1947-5918}, url={http://dx.doi.org/10.1021/bk-1992-0498.ch002}, DOI={10.1021/bk-1992-0498.ch002}, abstractNote={Microorganisms growing near and above 100°C were discovered only in the last decade. Most of them depend upon elemental sulfur for growth. Both the organisms and their enzymes have enormous potential in both basic and applied research. To date only a few metabolic enzymes have been characterized. The majority are from two sulfur-dependent organisms, from the archaeon, Pyrococcus furiosus, and from Thermotoga maritima, the most thermophilic bacterium currently known. In this chapter we review the nature of the sulfur-dependent organisms, their evolutionary significance, and the properties of the enzymes that have been purified so far.}, booktitle={Biocatalysis at Extreme Temperatures}, publisher={American Chemical Society}, author={Adams, Michael W. W. and Park, Jae-Bum and Mukund, S. and Blamey, J. and Kelly, Robert M.}, year={1992}, month={Jul}, pages={4–22}, collection={ACS Symposium Series} }
 @article{kelly_blumentals_snowde_adams_1992, title={Physiological and Biochemical Characteristics of Pyrococcus furiosus, a Hyperthermophilic Archaebacterium}, volume={665}, ISSN={0077-8923 1749-6632}, url={http://dx.doi.org/10.1111/j.1749-6632.1992.tb42594.x}, DOI={10.1111/j.1749-6632.1992.tb42594.x}, abstractNote={Annals of the New York Academy of SciencesVolume 665, Issue 1 p. 309-319 Physiological and Biochemical Characteristics of Pyrococcus furiosus, a Hyperthermophilic Archaebacterium ROBERT M. KELLY, ROBERT M. KELLY Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218 Center of Marine Biotechnology, University of Maryland, Baltimore, Maryland 21202Search for more papers by this authorILSE I. BLUMENTALS, ILSE I. BLUMENTALS Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218Search for more papers by this authorLESLEY J. SNOWDE, LESLEY J. SNOWDE Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218Search for more papers by this authorMICHAEL W. W. ADAMS, MICHAEL W. W. ADAMS Department of Biochemistry and Center for Metalloenzyme Studies, University of Georgia, Athens, Georgia 30602Search for more papers by this author ROBERT M. KELLY, ROBERT M. KELLY Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218 Center of Marine Biotechnology, University of Maryland, Baltimore, Maryland 21202Search for more papers by this authorILSE I. BLUMENTALS, ILSE I. BLUMENTALS Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218Search for more papers by this authorLESLEY J. SNOWDE, LESLEY J. SNOWDE Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218Search for more papers by this authorMICHAEL W. W. ADAMS, MICHAEL W. W. ADAMS Department of Biochemistry and Center for Metalloenzyme Studies, University of Georgia, Athens, Georgia 30602Search for more papers by this author First published: October 1992 https://doi.org/10.1111/j.1749-6632.1992.tb42594.xCitations: 4AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Citing Literature Volume665, Issue1Biochemical Engineering VII: Cellular and Reactor EngineeringOctober 1992Pages 309-319 RelatedInformation}, number={1 Biochemical E}, journal={Annals of the New York Academy of Sciences}, publisher={Wiley}, author={Kelly, Robert M. and Blumentals, Ilse I. and Snowde, Lesley J. and Adams, Michael W. W.}, year={1992}, month={Oct}, pages={309–319} }
 @article{snowden_blumentals_kelly_1992, title={Regulation of Proteolytic Activity in the Hyperthermophile
            Pyrococcus furiosus}, volume={58}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.58.4.1134-1141.1992}, DOI={10.1128/aem.58.4.1134-1141.1992}, abstractNote={Pyrococcus furiosus was shown to grow on casein or peptides as the sole carbon, energy, and nitrogen sources, while maltose could be used as a carbon and energy source only if peptides were present in the medium. A mixture of all 20 single amino acids could not replace the peptide requirement. Specific intracellular proteolytic activity was induced under low casein or tryptone levels and was decreased by the addition of maltose to both peptide-limiting and peptide-rich media in batch and continuous cultures. In a peptide-limited chemostat, activity towards azocasein and MeO-Suc-Arg-Pro-Tyr- p -nitroanilide reached a maximum at a dilution rate of 0.28 h -1 , while activity toward l -lysine- p -nitroanilide reached a maximum at 0.50 h -1 . Under peptide-limiting conditions, levels of the 66-kDa protease (S66) were enhanced relative to those of other cell proteins. Preliminary evidence suggests that this protease is immunologically related to the eukaryotic multicatalytic proteinase complex (proteosome).}, number={4}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Snowden, Lesley J. and Blumentals, Ilse I. and Kelly, Robert M.}, year={1992}, month={Apr}, pages={1134–1141} }
 @article{olson_kelly_1991, title={Chemical and microbiological problems associated with research on the biodesulfurization of coal. A review}, volume={5}, ISSN={0921-3449}, url={http://dx.doi.org/10.1016/0921-3449(91)90024-i}, DOI={10.1016/0921-3449(91)90024-i}, abstractNote={The study of microbial processes for the removal of organic and inorganic sulfur from coals is complicated by the lack of direct methods of measurement for organic sulfur content and the related incomplete understanding of the specific forms of organic sulfur in coal. In addition, the accessibility of specific chemical groups in the coal matrix to microorganisms and their enzymes is uncertain, raising questions about the nature and validity of model compound studies. Thus, interpretation of data from numerous efforts focussed on the microbial removal of inorganic and organic sulfur from coals remains controversial. The discussion here reviews recent developments in the chemical characterization of coal sulfur related to bioprocessing research and describes some recent efforts in involving sulfur transformation by hyperthermophilic archaebacteria.}, number={2-3}, journal={Resources, Conservation and Recycling}, publisher={Elsevier BV}, author={Olson, Gregory J. and Kelly, Robert M.}, year={1991}, month={Apr}, pages={183–193} }
 @article{peeples_hirosue_olson_kelly_1991, title={Coal sulphur transformations monitored by hyperthermophilic archaebacteria}, volume={70}, ISSN={0016-2361}, url={http://dx.doi.org/10.1016/0016-2361(91)90173-8}, DOI={10.1016/0016-2361(91)90173-8}, abstractNote={The hyperthermophilic archaebacterium Pyrococcus furiosus can reduce polysulphidic compounds as well as elemental sulphur bound in coal. The presence of elemental sulphur in coals is thought to be a result of low temperature oxidation, or weathering, of coal pyrite. Results of controlled coal weathering experiments, in which the transformation of sulphur moieties was monitored using P. furiosus as well as standard chemical analyses, suggest that there may be changes in the organic sulphur content of coal during treatment. Observed transformations make coal sulphur more amenable to reduction by P. furiosus and, perhaps, other sulphur-reducing bacteria. Along these lines, the potential basis for combined biological and chemical treatment of coal to remove organic sulphur should be given serious consideration in developing coal cleaning technology.}, number={5}, journal={Fuel}, publisher={Elsevier BV}, author={Peeples, T.L. and Hirosue, S. and Olson, Gregory J. and Kelly, R.M.}, year={1991}, month={May}, pages={599–604} }
 @inproceedings{muralidharan_hirsh_suy_bouwer_kelly_1991, title={Mixed Cultures of High Temperature Bacteria: Prospects for Bioprocessing of Fossil Fuels}, booktitle={Proceedings of the 2nd International Conference on the Biological Processing of Fossil Fuels}, publisher={Department of Energy/EPRI}, author={Muralidharan, V. and Hirsh, I.S. and Suy, I. and Bouwer, E.J. and Kelly, R.M.}, year={1991}, month={May} }
 @article{brown_costantino_kelly_1990, title={Characterization of Amylolytic Enzyme Activities Associated with the Hyperthermophilic Archaebacterium
            Pyrococcus furiosus}, volume={56}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.56.7.1985-1991.1990}, DOI={10.1128/aem.56.7.1985-1991.1990}, abstractNote={The hyperthermophilic archaebacterium Pyrococcus furiosus produces several amylolytic enzymes in response to the presence of complex carbohydrates in the growth medium. These enzyme activities, α-glucosidase, pullulanase, and α-amylase, were detected in both cell extracts and culture supernatants. All activities were characterized by temperature optima of at least 100°C as well as a high degree of thermostability. The existence of this collection of activities in P. furiosus suggests that polysaccharide availability in its growth environment is a significant aspect of the niche from which it was isolated.}, number={7}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Brown, Stephen H. and Costantino, Henry R. and Kelly, Robert M.}, year={1990}, month={Jul}, pages={1985–1991} }
 @article{blumentals_robinson_kelly_1990, title={Characterization of sodium dodecyl sulfate-resistant proteolytic activity in the hyperthermophilic archaebacterium Pyrococcus furiosus}, volume={56}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.56.7.1992-1998.1990}, DOI={10.1128/aem.56.7.1992-1998.1990}, abstractNote={Cell extracts from Pyrococcus furiosus were found to contain five proteases, two of which (S66 and S102) are resistant to sodium dodecyl sulfate (SDS) denaturation. Cell extracts incubated at 98 degrees C in the presence of 1% SDS for 24 h exhibited substantial cellular proteolysis such that only four proteins could be visualized by amido black-Coomassie brilliant blue staining of SDS-polyacrylamide gels. The SDS-treated extract retained 19% of the initial proteolytic activity as represented by two proteases, S66 (66 kilodaltons [kDa]) and S102 (102 kDa). Immunoblot analysis with guinea pig sera containing antibodies against protease S66 indicated that S66 is related neither to S102 nor to the other proteases. The results of this analysis also suggest that S66 might be the hydrolysis product of a 200-kDa precursor which does not have proteolytic activity. The 24-h SDS-treated extract showed unusually thermostable proteolytic activity; the measured half-life at 98 degrees C was found to be 33 h. Proteases S66 and S102 were also resistant to denaturation by 8 M urea, 80 mM dithiothreitol, and 5% beta-mercaptoethanol. Purified protease S66 was inhibited by phenylmethylsulfonyl fluoride and diisopropyl fluorophosphate but not by EDTA, ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid, or iodoacetic acid. These results indicate that S66 is a serine protease. Amino acid ester hydrolysis studies showed that protease S66 was hydrolytically active towards N-benzoyl-L-arginine ethyl ester.}, number={7}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Blumentals, I I and Robinson, A S and Kelly, R M}, year={1990}, month={Jul}, pages={1992–1998} }
 @article{reilly_schubert_lindner_donohue_kelly_1990, title={EFFECT OF HETEROCYCLIC AMINE ADDITIVES ON THE ABSORPTION RATES OF CARBONYL SULFIDE AND CARBON DIOXIDE IN AQUEOUS METHYLDIETHANOLAMINE SOLUTIONS}, volume={93}, ISSN={0098-6445 1563-5201}, url={http://dx.doi.org/10.1080/00986449008911445}, DOI={10.1080/00986449008911445}, abstractNote={Absorption rates of carbonyl sulfide and carbon dioxide into aqueous methyldiethanolamine solutions with and without heterocyclic amine additives were measured in a stirred cell apparatus. All of the heterocyclic amine additives catalyzed COS absorption more strongly than that for CO2. In instances in which absorption rates were improved by the additives, those with the lowest pKb's were the most effective, although steric factors also apparently influence reaction kinetics.}, number={1}, journal={Chemical Engineering Communications}, publisher={Informa UK Limited}, author={Reilly, J.T. and Schubert, C.N. and Lindner, J.R. and Donohue, M.D. and Kelly, R.M.}, year={1990}, month={Jun}, pages={181–191} }
 @article{pihl_schicho_black_schulman_maier_kelly_1990, title={Hydrogen-Sulfur Autotrophy in the Hyperthermophilic Archaebacterium,Pyrodictium brockii}, volume={8}, ISSN={0264-8725 2046-5556}, url={http://dx.doi.org/10.1080/02648725.1990.10647874}, DOI={10.1080/02648725.1990.10647874}, abstractNote={Abstract : This work focused on the elucidation of physiological aspects of the hyperthermophilic archaea Pyrodictium brockii and Pyrococcus furiosus. Continuous cultivation methods were developed for both organisms to facilitate metabolic studies. For P. furiosus, we demonstrated the bioenergetic importance of a novel glycolytic pathway centered around a previously reported tungsten- requiring oxido-reductase. We also showed that sulfur reduction is implicated in P. furiosus bioenergetics and examined this issue in maltose-limited cultures. Patterns of regulation were followed through the induction of several enzyme activities involved in the organism's energetics. hyperthermophiles, microbial physiology.}, number={1}, journal={Biotechnology and Genetic Engineering Reviews}, publisher={Informa UK Limited}, author={Pihl, T.D. and Schicho, R.N. and Black, L.K. and Schulman, B.A. and Maier, R.J. and Kelly, R.M.}, year={1990}, month={Nov}, pages={345–378} }
 @inbook{olson_kelly_1990, place={New York}, title={Microbiological Processing of Coal}, booktitle={Biotechnology Applied to Fossil Fuels}, publisher={Marcel Dekker}, author={Olson, G.J. and Kelly, R.M.}, editor={Wise, D.L.Editor}, year={1990} }
 @article{clark_kelly_1990, title={Microorganisms at extreme temperatures and pressures: Engineering insights}, volume={20}, number={11}, journal={CHEMTECH}, author={Clark, D.S. and Kelly, R.M.}, year={1990}, pages={641–648} }
 @article{costantino_brown_kelly_1990, title={Purification and characterization of an alpha-glucosidase from a hyperthermophilic archaebacterium, Pyrococcus furiosus, exhibiting a temperature optimum of 105 to 115 degrees C}, volume={172}, ISSN={0021-9193 1098-5530}, url={http://dx.doi.org/10.1128/jb.172.7.3654-3660.1990}, DOI={10.1128/jb.172.7.3654-3660.1990}, abstractNote={Pyrococcus furiosus is a strictly anaerobic hyperthermophilic archaebacterium with an optimal growth temperature of about 100 degrees C. When this organism was grown in the presence of certain complex carbohydrates, the production of several amylolytic enzymes was noted. These enzymes included an alpha-glucosidase that was located in the cell cytoplasm. This alpha-glucosidase has been purified 310-fold and corresponded to a protein band of 125 kilodaltons as resolved by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The enzyme exhibited optimum activity at pH 5.0 to 6.0 and over a temperature range of 105 to 115 degrees C. Kinetic analysis conducted at 108 degrees C revealed hydrolysis of the substrates p-nitrophenyl-alpha-D-glucopyranoside (PNPG), methyl-alpha-D-glucopyranoside, maltose, and isomaltose. Trace activity was detected towards p-nitrophenyl-beta-D-glucopyranoside, and no activity could be detected towards starch or sucrose. Inhibition studies conducted at 108 degrees C with PNPG as the substrate and maltose as the inhibitor yielded a Ki for maltose of 14.3 mM. Preincubation for 30 min at 98 degrees C in 100 mM dithiothreitol and 1.0 M urea had little effect on enzyme activity, whereas preincubation in 1.0% sodium dodecyl sulfate and 1.0 M guanidine hydrochloride resulted in significant loss of enzyme activity. Purified alpha-glucosidase from P. furiosus exhibited remarkable thermostability; incubation of the enzyme at 98 degrees C resulted in a half life of nearly 48 h.}, number={7}, journal={Journal of Bacteriology}, publisher={American Society for Microbiology}, author={Costantino, H R and Brown, S H and Kelly, R M}, year={1990}, month={Jul}, pages={3654–3660} }
 @article{blumentals_itoh_olson_kelly_1990, title={Role of Polysulfides in Reduction of Elemental Sulfur by the Hyperthermophilic Archaebacterium
            Pyrococcus furiosus}, volume={56}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.56.5.1255-1262.1990}, DOI={10.1128/aem.56.5.1255-1262.1990}, abstractNote={Polysulfides formed through the breakdown of elemental sulfur or other sulfur compounds were found to be reduced to H 2 S by the hyperthermophilic archaebacterium Pyrococcus furiosus during growth. Metabolism of polysulfides by the organism was dissimilatory, as no incorporation of 35 S-labeled elemental sulfur was detected. However, [ 35 S]cysteine and [ 35 S]methionine were incorporated into cellular protein. Contact between the organism and elemental sulfur is not necessary for metabolism. The sulfide generated from metabolic reduction of polysulfides dissociates to a strong nucleophile, HS − , which in turn opens up the S 8 elemental sulfur ring. In addition to H 2 S, P. furiosus cultures produced methyl mercaptan in a growth-associated fashion.}, number={5}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Blumentals, I. I. and Itoh, M. and Olson, G. J. and Kelly, R. M.}, year={1990}, month={May}, pages={1255–1262} }
 @book{kelly_olson_1990, title={Specific Biocatalysis for Coal Sulfur Speciation and Removal}, number={ER/GS-6624}, author={Kelly, R.M. and Olson, G.J.}, year={1990}, month={May} }
 @article{blumentals_brown_schicho_skaja_costantino_kelly_1990, title={The Hyperthermophilic Archaebacterium, Pyrococcus furiosus.}, volume={589}, ISSN={0077-8923 1749-6632}, url={http://dx.doi.org/10.1111/j.1749-6632.1990.tb24254.x}, DOI={10.1111/j.1749-6632.1990.tb24254.x}, abstractNote={From this brief discussion, it is clear that there are many obstacles to overcome before hyperthermophilic archaebacteria will be an important aspect of biotechnology. Nevertheless, the prospects are intriguing. The nature of the environments that harbor these organisms and the consequent requirements for their controlled culture suggest that chemical and biochemical engineers can play an important role in elucidating their scientific and technological aspects.}, number={1 Biochemical E}, journal={Annals of the New York Academy of Sciences}, publisher={Wiley}, author={Blumentals, I. I. and Brown, S. H. and Schicho, R. N. and Skaja, A. K. and Costantino, H. R. and Kelly, R. M.}, year={1990}, month={May}, pages={301–314} }
 @inproceedings{olson_peeples_blumentals_schicho_brown_kelly_1989, title={Bioprocessing of Fossil Fuels Using Hyperthermophilic Archaebacteria}, booktitle={Proceedings of the 14th Annual EPRI Conference on Fuel Science and Conversion}, author={Olson, G.J. and Peeples, T.L. and Blumentals, I.I. and Schicho, R.N. and Brown, S.H. and Kelly, R.M.}, year={1989} }
 @article{blumentals_kelly_shiloach_1989, title={Bioreactor operation for the production of exotoxin A byPseudomonas aeruginosa}, volume={34}, ISSN={0006-3592 1097-0290}, url={http://dx.doi.org/10.1002/bit.260340913}, DOI={10.1002/bit.260340913}, abstractNote={Biotechnology and BioengineeringVolume 34, Issue 9 p. 1214-1220 Communications to the EditorFree Access Bioreactor operation for the production of exotoxin A by Pseudomonas aeruginosa Ilse I. Blumentals, Ilse I. Blumentals Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218Search for more papers by this authorRobert M. Kelly, Robert M. Kelly Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218Search for more papers by this authorJoseph Shiloach, Corresponding Author Joseph Shiloach Biotechnology Unit, Bldg 6, B1-33, NIDDK The National Institutes of Health Bethesda, Maryland 20892Biotechnology Unit, Bldg 6, B1-33, NIDDK The National Institutes of Health Bethesda, Maryland 20892Search for more papers by this author Ilse I. Blumentals, Ilse I. Blumentals Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218Search for more papers by this authorRobert M. Kelly, Robert M. Kelly Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218Search for more papers by this authorJoseph Shiloach, Corresponding Author Joseph Shiloach Biotechnology Unit, Bldg 6, B1-33, NIDDK The National Institutes of Health Bethesda, Maryland 20892Biotechnology Unit, Bldg 6, B1-33, NIDDK The National Institutes of Health Bethesda, Maryland 20892Search for more papers by this author First published: November 1989 https://doi.org/10.1002/bit.260340913AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL References 1 B. H. Iglewski and D. Kabat, Proc. Natl. Acad. Sci. USA., 72, 2284 (1975). 2 L. F. Hanne, T. R. Howe, and B. H. Iglewski, J. Bacteriol., 154, 383 (1983). 3 S. H. Leppla, O. C. Martin, and L. A. Muehl, Biochem. Biophys. Res. Commun., 40, 1437 (1978). 4 S. Lory and R. J. Collier, Infect. Immun., 28, 494 (1980). 5 M. L. Vasil, C. Chamberlain, and C. C. R. Grant, Infect. Immun., 52, 538 (1986). 6 M. J. Bjorn, B. H. Iglewski, S. K. Ives, J. C. Sadoff, and M. L. Vasil, Infect. Immun., 19, 789 (1978). 7 R. M. DeBell, Infect. Immun., 24, 132 (1979). 8 P. V. Liu, J. Infect. Dis., 128, 506 (1973). 9 I. I. Blumentals, R. M. Kelly, M. Gorziglia, J. B. Kaufman, and J. Shiloach, Appl. Environ. Microbiol., 53, 2013 (1987). 10 C. C. R. Grant and M. L. Vasil, J. Bacteriol., 168, 1112 (1986). 11 S. Lory, J. Bacteriol., 168, 1451 (1986). 12 G. L. Gray and M. L. Vasil, J. Bacteriol, 147, 275 (1981). 13 R. C. Hedstrom, C. R. Funk, J. B. Kaper, O. R. Pavlovskis, and D. R. Galloway, Infect. Immun., 51, 37 (1986). 14 V. L. Miller and J. J. Mekalanos, Proc. Natl. Acad. Sci. USA. 81, 3471 (1984). 15 V. L. Miller and J. J. Mekalanos, J. Bacteriol., 163, 580 (1985). 16 M. L. Vasil, D. Kabat, and B. H. Iglewski, Infect. Immun., 16, 353 (1977). 17 D. W. Chung and P. J. Collier, Infect. Immun., 16, 832 (1977). 18 C. L. Paddon and R. W. Hartley, Gene. 40, 231 (1985). 19 T. Maniatis, E. F. Fritsch, and J. Sambrook, Molecular Cloning, A Laboratory Manual. (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982). 20 A. Uhlrich, J. Shine, J. Chirgwin, R. Pictet, E. Tischer, W. J. Rutter, and H. M. Goodman, Science, 196, 1313 (1977). 21 C. H. Fiske and Y. Subbarow, J. Biol. Chem., 66, 375 (1925). 22 P. H. Clarke, M. A. Houldsworth, and M. D. Lilly, J. Gen. Microbiol., 51, 225 (1968). 23 A. Body, P. H. Clarke, M. A. Houldsworth and M. D. Lilly, J. Gen. Microbiol., 48, 137 (1967). 24 R. W. Smith and A. C. R. Dean, J. Gen. Microbiol., 72, 32 (1972). 25 Z. Fencl and J. Pazlarova, Folia Microbiol., 27, 340 (1982). 26 J. P. Kotze and A. Kistner, Can. J. Microbiol., 20, 861 (1974). 27 Z. Fenel, J. Ričica, and J. Kodešovä, J. Appl. Chem. Biotechnol., 22, 405 (1972). Volume34, Issue9November 1989Pages 1214-1220 ReferencesRelatedInformation}, number={9}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Blumentals, Ilse I. and Kelly, Robert M. and Shiloach, Joseph}, year={1989}, month={Nov}, pages={1214–1220} }
 @article{pihl_schicho_kelly_maier_1989, title={Characterization of hydrogen-uptake activity in the hyperthermophile Pyrodictium brockii.}, volume={86}, ISSN={0027-8424 1091-6490}, url={http://dx.doi.org/10.1073/pnas.86.1.138}, DOI={10.1073/pnas.86.1.138}, abstractNote={Pyrodictium brockii is a hyperthermophilic archaebacterium with an optimal growth temperature of 105 degrees C. P. brockii is also a chemolithotroph, requiring H2 and CO2 for growth. We have characterized P. brockii hydrogen-uptake activity with regard to temperature, ability to couple hydrogen oxidation to artificial electron acceptor reduction, sensitivity to O2, and cellular localization. The hydrogen-uptake activity was localized predominantly in a particulate fraction, was reversibly inhibited by O2, and coupled H2 uptake to the reduction of positive potential artificial electron acceptors. Comparisons between these results and those of the well-studied hydrogen-uptake hydrogenase from the mesophile Bradyrhizobium japonicum showed the two enzymes to be similar despite the very different natural environments of the organisms. However, the optimum temperature for activity differed greatly in the two organisms. We have also used immunological and genetic probes specific to the 65-kDa subunit of B. japonicum hydrogenase to assay crude extracts and genomic DNA, respectively, from P. brockii and found the enzymes to be similar in these respects as well. In addition, we report a formulation for artificial seawater capable of sustaining the growth of P. brockii.}, number={1}, journal={Proceedings of the National Academy of Sciences}, publisher={Proceedings of the National Academy of Sciences}, author={Pihl, T. D. and Schicho, R. N. and Kelly, R. M. and Maier, R. J.}, year={1989}, month={Jan}, pages={138–141} }
 @article{brown_kelly_1989, title={Cultivation Techniques for Hyperthermophilic Archaebacteria: Continuous Culture of
            Pyrococcus furiosus
            at Temperatures near 100�C}, volume={55}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.55.8.2086-2088.1989}, DOI={10.1128/aem.55.8.2086-2088.1989}, abstractNote={A system which allows continuous cultivation of hyperthermophilic archaebacteria at temperatures approaching 100�C has been developed. Continuous cultivation of the hyperthermophile Pyrococcus furiosus was carried out with this system; the resulting dilution rate and gas production profiles are discussed.}, number={8}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Brown, S. H. and Kelly, R. M.}, year={1989}, month={Aug}, pages={2086–2088} }
 @article{malik_su_wald_blumentals_kelly_1989, title={Growth and gas production for hyperthermophilic archaebacterium,Pyrococcus furiosus}, volume={34}, ISSN={0006-3592 1097-0290}, url={http://dx.doi.org/10.1002/bit.260340805}, DOI={10.1002/bit.260340805}, abstractNote={Pyrococcus furiosus represents one of the most important hyperthermophilic bacteria isolated thus far because of its relatively high cell yields and rapid growth rates. Pyrococcus furiosus exhibits several interesting growth characteristics, especially in terms of biotic gas production, which were examined in this study. In the presence of elemental sulfur, both carbon dioxide and hydrogen sulfide production appeared to be strongly growth associated, while no significant hydrogen production was observed. In the absence of sulfur, hydrogen and carbon dioxide were produced by the organism and hydrogen inhibition was observed. The addition of elemental sulfur to the medium apparently eliminated, hydrogen inhibition as growth proceeded normally even when hydrogen was added to the gas phase. Also, no apparent substrate limitation or toxic product could be attributed to the cessation of growth as cell growth in spent media was at least as good as in fresh media. An unstructured growth model was used to correlate growth and gas production for P. furiosus in complex seawater-based media at 98 degrees C both in the absence and presence of elemental sulfur. The model was shown to be useful for examining some of the observations made in this study.}, number={8}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Malik, B. and Su, W.-w. and Wald, H. L. and Blumentals, I. I. and Kelly, R. M.}, year={1989}, month={Oct}, pages={1050–1057} }
 @article{schicho_brown_olson_parks_kelly_1989, title={Probing coals for non-pyritic sulphur using sulphur-metabolizing mesophilic and hyperthermophilic bacteria}, volume={68}, ISSN={0016-2361}, url={http://dx.doi.org/10.1016/0016-2361(89)90032-x}, DOI={10.1016/0016-2361(89)90032-x}, abstractNote={The presence of elemental sulphur in several coals from the midwestern US (Illinois No. 6, Indiana No. 5, and an Indiana refuse coal) as well as in an Australian brown coal was probed using specific microbial activity to this sulphur speciation. The objective of this work was to differentiate elemental sulphur from the apparent organic sulphur fraction in these coals. Two hyperthermophilic archaebacteria, Pyrodictium brockii and Pyrococcus furiosus, are known to specifically reduce elemental sulphur to sulphide seawater-based media. The eubacterium, Thiobacillus thiooxidans, is known to specifically oxidize elemental sulphur to sulphate. These biological activities were examined in aqueous solutions containing the above coal samples by comparing the biotic production of sulphide or sulphate with both the reduction of total coal sulphur content and the reduction in the sulphur extractable by carbon disulphide. Only the heavily weathered, refuse coal contained significant elemental sulphur (≈ 1%), by both biological assay and sulphur assay of carbon disulphide-extractable material. The elemental sulphur content of the refuse coal appeared as organic sulphur by conventional analytical methods (i.e., ASTM method for coal sulphur speciation). The results here point to the prospect of using biological probes for elemental sulphur determination in coals, thereby making organic sulphur content determination more specific.}, number={11}, journal={Fuel}, publisher={Elsevier BV}, author={Schicho, R.N. and Brown, S.H. and Olson, G.J. and Parks, E.J. and Kelly, R.M.}, year={1989}, month={Nov}, pages={1368–1375} }
 @inproceedings{kelly_schicho_brown_soisson_blumentals_olson_parks_1988, title={Biological Sulfur Oxidation and Reduction for Coal Sulfur Speciation and Desulfurization}, booktitle={Proceedings of the 13th Annual EPRI Conference on Fuel Science and Conversion}, author={Kelly, R.M. and Schicho, R.N. and Brown, S.H. and Soisson, J.P. and Blumentals, I.I. and Olson, G.J. and Parks, E.J.}, year={1988} }
 @inproceedings{pihl_schicho_kelly_maier_1988, title={Characterization of the H2-Uptake Hydrogenase Activity from the Extreme Thermophile Pyrodictium brockii}, author={Pihl, T.D. and Schicho, R.N. and Kelly, R.M. and Maier, R.J.}, year={1988} }
 @article{johnston_hannah_cunningham_daggy_sturm_kelly_1988, title={Destruction of Pharmaceutical and Biopharmaceutical Wastes by the Modar Supercritical Water Oxidation Process}, volume={6}, ISSN={1087-0156 1546-1696}, url={http://dx.doi.org/10.1038/nbt1288-1423}, DOI={10.1038/nbt1288-1423}, number={12}, journal={Nature Biotechnology}, publisher={Springer Science and Business Media LLC}, author={Johnston, James B. and Hannah, Robert E. and Cunningham, Virginia L. and Daggy, Bruce P. and Sturm, Frank J. and Kelly, Robert M.}, year={1988}, month={Dec}, pages={1423–1427} }
 @article{parameswaran_schicho_soisson_kelly_1988, title={Effect of hydrogen and carbon dioxide partial pressures on growth and sulfide production of the extremely thermophilic archaebacterium Pyrodictium brockii}, volume={32}, ISSN={0006-3592 1097-0290}, url={http://dx.doi.org/10.1002/bit.260320405}, DOI={10.1002/bit.260320405}, abstractNote={The effect of hydrogen and carbon dioxide partial pressure on the growth of the extremely thermophilic archaebacterium Pyrodictium brockii at 98 degrees C was investigated. Previous work with this bacterium has been done using an 80:20 hydrogen-carbon dioxide gas phase with a total pressure of 4 atm; no attempt has been made to determine if this mixture is optimal. It was found in this study that reduced hydrogen partial pressures affected cell yield, growth rate, and sulfide production. The effect of hydrogen partial pressure on cell yield and growth rate was less dramatic when compared to the effect on sulfide production, which was not found to be growth-associated. Carbon dioxide was also found to affect growth but only at very low partial pressures. The relationship between growth rate and substrate concentration could be correlated with a Monod-type expression for either carbon dioxide or hydrogen as the limiting substrate. The results from this study indicate that a balance must be struck between cell yields and sulfide production in choosing an optimal hydrogen partial pressure for the growth of P. brockii.}, number={4}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Parameswaran, A. K. and Schicho, R. N. and Soisson, J. P. and Kelly, R. M.}, year={1988}, month={Aug}, pages={438–443} }
 @article{su_kelly_1988, title={Effect of hyperbaric oxygen and carbon dioxide on heterotrophic growth of the extreme thermophileSulfolobus acidocaldarius}, volume={31}, ISSN={0006-3592 1097-0290}, url={http://dx.doi.org/10.1002/bit.260310720}, DOI={10.1002/bit.260310720}, number={7}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Su, Wei-Wen and Kelly, Robert M.}, year={1988}, month={May}, pages={750–754} }
 @article{parameswaran_su_schicho_provan_malik_kelly_1988, title={Engineering considerations for growth of bacteria at temperatures around 100°C}, volume={18}, ISSN={0273-2289 1559-0291}, url={http://dx.doi.org/10.1007/bf02930817}, DOI={10.1007/bf02930817}, number={1}, journal={Applied Biochemistry and Biotechnology}, publisher={Springer Science and Business Media LLC}, author={Parameswaran, A. K. and Su, Wei-wen and Schicho, R. N. and Provan, C. N. and Malik, B. and Kelly, R. M.}, year={1988}, month={Aug}, pages={53–73} }
 @article{kelly_deming_1988, title={Extremely Thermophilic Archaebacteria: Biological and Engineering Considerations}, volume={4}, ISSN={8756-7938 1520-6033}, url={http://dx.doi.org/10.1002/btpr.5420040202}, DOI={10.1002/btpr.5420040202}, abstractNote={Interdisciplinary interactions between molecular biologists, microbial ecologists, and biochemical engineers portend well for the biotechnological exploitation of novel extremely thermophilic methanogens and sulfur-metabolizing archaebacteria.}, number={2}, journal={Biotechnology Progress}, publisher={Wiley}, author={Kelly, Robert M. and Deming, Jody W.}, year={1988}, month={Jun}, pages={47–62} }
 @article{lindner_schubert_kelly_1988, title={Influence of hydrodynamics on physical and chemical gas absorption in packed columns}, volume={27}, ISSN={0888-5885 1520-5045}, url={http://dx.doi.org/10.1021/ie00076a018}, DOI={10.1021/ie00076a018}, abstractNote={ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTInfluence of hydrodynamics on physical and chemical gas absorption in packed columnsJohn R. Lindner, Craig N. Schubert, and Robert M. KellyCite this: Ind. Eng. Chem. Res. 1988, 27, 4, 636–642Publication Date (Print):April 1, 1988Publication History Published online1 May 2002Published inissue 1 April 1988https://doi.org/10.1021/ie00076a018RIGHTS & PERMISSIONSArticle Views106Altmetric-Citations-LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (886 KB) Get e-Alerts Get e-Alerts}, number={4}, journal={Industrial & Engineering Chemistry Research}, publisher={American Chemical Society (ACS)}, author={Lindner, John R. and Schubert, Craig N. and Kelly, Robert M.}, year={1988}, month={Apr}, pages={636–642} }
 @article{yeh_kelly_cox_olson_1988, title={Significance of cell fluorescence color of acridine orange-stained Thiobacillus ferrooxidans under epifluoresence microscopy}, journal={Science and Technology Letters}, author={Yeh, T.Y. and Kelly, R.M. and Cox, J. and Olson, G.J.}, year={1988} }
 @article{blumentals_kelly_gorziglia_kaufman_shiloach_1987, title={Development of a defined medium and two-step culturing method for improved exotoxin A yields from Pseudomonas aeruginosa}, volume={53}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.53.9.2013-2020.1987}, DOI={10.1128/aem.53.9.2013-2020.1987}, abstractNote={A two-step method is described for the production of exotoxin A by Pseudomonas aeruginosa in which a defined growth medium is modified for the toxin production phase. As a result, specific exotoxin A yields comparable to those obtained with complex media were achieved. In the development of this two-step process, several divalent metallic cations (Ca2+, Cu2+, and Mn2+), in addition to iron, were found to inhibit the yield of exotoxin A while Ca2+ and glycerol were found to increase yields. Northern blot analysis of total RNA isolates suggests that these effects on exotoxin A yields are based on events at the transcription level.}, number={9}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Blumentals, I I and Kelly, R M and Gorziglia, M and Kaufman, J B and Shiloach, J}, year={1987}, month={Sep}, pages={2013–2020} }
 @article{blumentals_skaja_kelly_clem_shiloach_1987, title={Effect of Culturing Conditions on the Production of Exotoxin A by Pseudomonas aeruginosa}, volume={506}, ISSN={0077-8923 1749-6632}, url={http://dx.doi.org/10.1111/j.1749-6632.1987.tb23864.x}, DOI={10.1111/j.1749-6632.1987.tb23864.x}, abstractNote={Annals of the New York Academy of SciencesVolume 506, Issue 1 p. 663-668 Effect of Culturing Conditions on the Production of Exotoxin A by Pseudomonas aeruginosa ILSE I. BLUMENTALS, ILSE I. BLUMENTALS Department of Chemical Engineering The Johns Hopkins University Baltimore, Maryland 21218Search for more papers by this authorANNE K. SKAJA, ANNE K. SKAJA Department of Chemical Engineering The Johns Hopkins University Baltimore, Maryland 21218Search for more papers by this authorROBERT M. KELLY, ROBERT M. KELLY Department of Chemical Engineering The Johns Hopkins University Baltimore, Maryland 21218Search for more papers by this authorTHOMAS R. CLEM, THOMAS R. CLEM Biomedical Engineering and Instrumentation Branch Division of Research Services National Institutes of Health Bethesda, Maryland 20892Search for more papers by this authorJOSEPH SHILOACH, Corresponding Author JOSEPH SHILOACH Biotechnology Unit National Institute of Diabetes and Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland 20892Author to whom correspondence should be addressed.Search for more papers by this author ILSE I. BLUMENTALS, ILSE I. BLUMENTALS Department of Chemical Engineering The Johns Hopkins University Baltimore, Maryland 21218Search for more papers by this authorANNE K. SKAJA, ANNE K. SKAJA Department of Chemical Engineering The Johns Hopkins University Baltimore, Maryland 21218Search for more papers by this authorROBERT M. KELLY, ROBERT M. KELLY Department of Chemical Engineering The Johns Hopkins University Baltimore, Maryland 21218Search for more papers by this authorTHOMAS R. CLEM, THOMAS R. CLEM Biomedical Engineering and Instrumentation Branch Division of Research Services National Institutes of Health Bethesda, Maryland 20892Search for more papers by this authorJOSEPH SHILOACH, Corresponding Author JOSEPH SHILOACH Biotechnology Unit National Institute of Diabetes and Digestive and Kidney Diseases National Institutes of Health Bethesda, Maryland 20892Author to whom correspondence should be addressed.Search for more papers by this author First published: November 1987 https://doi.org/10.1111/j.1749-6632.1987.tb23864.xCitations: 7AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Citing Literature Volume506, Issue1Biochemical Engineering VNovember 1987Pages 663-668 RelatedInformation}, number={1 Biochemical E}, journal={Annals of the New York Academy of Sciences}, publisher={Wiley}, author={Blumentals, Ilse I. and Skaja, Anne K. and Kelly, Robert M. and Clem, Thomas R. and Shiloach, Joseph}, year={1987}, month={Nov}, pages={663–668} }
 @article{sturm_parameswaran_provan_kelly_1987, title={Growth of Extremely Thermophilic Archaebacteria under Elevated Hyperbaric Conditions}, volume={506}, ISSN={0077-8923 1749-6632}, url={http://dx.doi.org/10.1111/j.1749-6632.1987.tb23809.x}, DOI={10.1111/j.1749-6632.1987.tb23809.x}, number={1 Biochemical E}, journal={Annals of the New York Academy of Sciences}, publisher={Wiley}, author={Sturm, F. J. and Parameswaran, A. K. and Provan, C. N. and Kelly, R. M.}, year={1987}, month={Nov}, pages={51–66} }
 @article{sturm_hurwitz_deming_kelly_1987, title={Growth of the extreme thermophileSulfolobus acidocaldarius in a hyperbaric helium bioreactor}, volume={29}, ISSN={0006-3592 1097-0290}, url={http://dx.doi.org/10.1002/bit.260290905}, DOI={10.1002/bit.260290905}, abstractNote={The relationship between pressure and temperature as it affects microbial growth and metabolism has been examined only for a limited number of bacterial species. Because many newly-discovered, extremely thermophilic bacteria have been isolated from pressurized environments, this relationship merits closer scrutiny. In this study, the extremely thermophilic bacterium, Sulfolobus acidocaldarius, was cultured successfully in a hyperbaric chamber containing helium and air enriched with 5% carbon dioxide. Over a pressure range of approximately 1–120 bar and a temperature range of 67–80°C, growth was achieved in a heterotrophic medium with the air mixture at partial pressures up to 3.5 bar. Helium was used to obtain the final, desired incubation pressure. No significant growth was noted above 80°C over the same range of hyperbaric pressures, or at 70°C when pressure was applied hydrostatically. Growth experiments conducted under hyperbaric conditions may provide a means to study these bacteria under simulated in situ conditions and simultaneously avoid the complications associated with hydrostatic experiments. Results indicate that hyperbaric helium bioreactors will be important in the study of extremely thermophilic bacteria that are isolated from pressurized environments.}, number={9}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Sturm, F. J. and Hurwitz, S. A. and Deming, J. W. and Kelly, R. M.}, year={1987}, month={Jun}, pages={1066–1074} }
 @article{parameswaran_provan_sturm_kelly_1987, title={Sulfur Reduction by the Extremely Thermophilic Archaebacterium
            Pyrodictium occultum}, volume={53}, ISSN={0099-2240 1098-5336}, url={http://dx.doi.org/10.1128/aem.53.7.1690-1693.1987}, DOI={10.1128/aem.53.7.1690-1693.1987}, abstractNote={The relationship between growth and biological sulfur reduction for the extremely thermophilic archaebacterium Pyrodictium occultum was studied over a temperature range of 98 to 105°C. The addition of yeast extract (0.2 g/liter) to the medium was found to increase hydrogen sulfide production significantly, especially at higher temperatures. Sulfide production in uninoculated controls with and without yeast extract was noticeable but substantially below the levels observed in samples containing the microorganism.}, number={7}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Parameswaran, A. K. and Provan, C. N. and Sturm, F. J. and Kelly, R. M.}, year={1987}, month={Jul}, pages={1690–1693} }
 @article{yeh_godshalk_olson_kelly_1987, title={Use of epifluorescence microscopy for characterizing the activity ofThiobacillus Ferrooxidans on iron pyrite}, volume={30}, ISSN={0006-3592 1097-0290}, url={http://dx.doi.org/10.1002/bit.260300119}, DOI={10.1002/bit.260300119}, abstractNote={The enumeration and characterization of microorganisms attached to solid surfaces have always presented significant difficulties. This is particularly true for micro organisms that are indigenous to coal mines and mineral deposits where metal sulfides are ubiquitous. The complications that arise are the result of the variety of inorganic compounds that are present in these environments, the harsh conditions under which the microorganisms proliferate, and the low cell densities to which they grow. The work presented here suggests that epifluorescence microscopy using acridine orange can be a useful probe to study acidophilic metal-leaching bacteria. Experiments involving the growth of Thiobacillus ferrooxidans on iron pyrite are described which indicate a relationship between cell fluorescence color and bacterial activity. Both attached and free-solution cell densities were determined throughout the course of the leaching process and considered along with changes in cell fluorescence color which might be associated with changes in intracellular pH. As such, epifluorescence microscopy, using acridine orange, can be used for assessing the activity of T. ferrooxidans on iron pyrite as well as resolving the controversy concerning the significance of attachment during the leaching process.}, number={1}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Yeh, Timothy Y. and Godshalk, John R. and Olson, Gregory J. and Kelly, Robert M.}, year={1987}, month={Jul}, pages={138–146} }
 @article{schubert_lindner_kelly_1986, title={Experimental methods for measuring static liquid holdup in packed columns}, volume={32}, ISSN={0001-1541 1547-5905}, url={http://dx.doi.org/10.1002/aic.690321119}, DOI={10.1002/aic.690321119}, abstractNote={AIChE JournalVolume 32, Issue 11 p. 1920-1923 R & D Note Experimental methods for measuring static liquid holdup in packed columns C. N. Schubert, C. N. Schubert Department of Chemical Engineering, Johns Hopkins University, Baltimore, MD 21218Search for more papers by this authorJ. R. Lindner, J. R. Lindner Department of Chemical Engineering, Johns Hopkins University, Baltimore, MD 21218Search for more papers by this authorR. M. Kelly, Corresponding Author R. M. Kelly Department of Chemical Engineering, Johns Hopkins University, Baltimore, MD 21218Department of Chemical Engineering, Johns Hopkins University, Baltimore, MD 21218Search for more papers by this author C. N. Schubert, C. N. Schubert Department of Chemical Engineering, Johns Hopkins University, Baltimore, MD 21218Search for more papers by this authorJ. R. Lindner, J. R. Lindner Department of Chemical Engineering, Johns Hopkins University, Baltimore, MD 21218Search for more papers by this authorR. M. Kelly, Corresponding Author R. M. Kelly Department of Chemical Engineering, Johns Hopkins University, Baltimore, MD 21218Department of Chemical Engineering, Johns Hopkins University, Baltimore, MD 21218Search for more papers by this author First published: November 1986 https://doi.org/10.1002/aic.690321119Citations: 29AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Literature cited Baldi, G., and S., Sicardi, “A Model for Mass Transfer with and without Chemical Reaction in Packed Towers,” Chem. Eng. Sci., 30, 617 (1975). Bennett, A., and F., Goodridge, “Hydrodynamic and Mass Transfer Studies in Packed Absorption Columns,” Trans. Inst. Chem. Engrs., 48, T232 (1970). Hoogendoorn, C. J., and J., Lips, “Axial Mixing of Liquid in Gas-Liquid Flow through Packed Beds,” Can. J. Chem. Eng., 43, 125 (1965). Joosten, G. E. H., and P. V., Dankwerts, “Chemical Reaction and Effective Interfacial Areas in Gas Absorption,” Chem. Eng. Sci., 28, 453 (1973). Patwardhan, V. S., “Effective Interfacial Area in Packed Beds for Absorption with Chemical Reaction,” Can. J. Chem. Eng., 56, 56 (1978). Patwardhan, V. S., and V. R., Shrotri, “Mass Transfer Coefficient between the Static and Dynamic Holdups in a Packed Column,” Chem. Eng. Commun., 10, 349 (1981). Puranik, S. S., and A., Vogelpohl, “Effective Interfacial Area in Irrigated Packed Columns,” Chem. Eng. Sci., 29, 501 (1974). Ruszkay, R. D., “ Transient Response of Liquid Flowing through Packed Tower with Air Counterflow,” Ph.D. Thesis, Columbia Univ. (1963). Shulman, H. L., C. F., Ullrich, and N. Wells, “Performance of Packed Columns. 1: Total, Static, and Operating Holdups,” AIChE J., 1, 247 (1955). van Swaaij, W. P. M., J. C. Charpentier, and J. Villermaux, “Residence Time Distribution in the Liquid Phase of Trickle Flow in Packed Columns,” Chem. Eng. Sci., 24, 1,083 (1969). Citing Literature Volume32, Issue11November 1986Pages 1920-1923 ReferencesRelatedInformation}, number={11}, journal={AIChE Journal}, publisher={Wiley}, author={Schubert, C. N. and Lindner, J. R. and Kelly, R. M.}, year={1986}, month={Nov}, pages={1920–1923} }
 @article{shiloach_kaufman_kelly_1986, title={Hollow Fiber Microfiltration Methods for Recovery of Rat Basophilic Leukemia Cells (RBL-2H3) From Tissue Culture Media}, volume={2}, ISSN={8756-7938 1520-6033}, url={http://dx.doi.org/10.1002/btpr.5420020411}, DOI={10.1002/btpr.5420020411}, abstractNote={Biotechnology ProgressVolume 2, Issue 4 p. 230-233 Article Hollow Fiber Microfiltration Methods for Recovery of Rat Basophilic Leukemia Cells (RBL—2H3) From Tissue Culture Media Joseph Shiloach, Joseph Shiloach Biotechnology Unit, NIDDK, National Institutes of Health, Bethesda, Maryland 20892 Joseph Shiloach: is the head of the Biotechnology (Pilot Plant) Unit at the National Institutes of Health in Bethesda, Maryland. He received his Ph.D. from the Hebrew University in Jerusalem, Israel. He is heavily involved in fermentation processes, mammalian cell growth and recovery process of compounds with biological activity.Search for more papers by this authorJeanne B. Kaufman, Jeanne B. Kaufman Biotechnology Unit, NIDDK, National Institutes of Health, Bethesda, Maryland 20892 Jeanne Kaufman: received her B.S. in Biology at St. Mary's College in Maryland. She is currently with the Biotechnology unit at the National Institutes of Health. She is responsible for the growth of the mammalian cell culture on small and large scale.Search for more papers by this authorRobert M. Kelly, Robert M. Kelly Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218 Robert M. Kelly: is currently assistant professor of chemical engineering at the Johns Hopkins University in Baltimore, Maryland where he has been since 1981. He received his Ph.D. in chemical engineering from North Carolina State University. His research interests include separation processes, especially chemical absorption and stripping, and biochemical engineering with emphasis on engineering problems related to the growth and utilization of bacteria from extreme environments.Search for more papers by this author Joseph Shiloach, Joseph Shiloach Biotechnology Unit, NIDDK, National Institutes of Health, Bethesda, Maryland 20892 Joseph Shiloach: is the head of the Biotechnology (Pilot Plant) Unit at the National Institutes of Health in Bethesda, Maryland. He received his Ph.D. from the Hebrew University in Jerusalem, Israel. He is heavily involved in fermentation processes, mammalian cell growth and recovery process of compounds with biological activity.Search for more papers by this authorJeanne B. Kaufman, Jeanne B. Kaufman Biotechnology Unit, NIDDK, National Institutes of Health, Bethesda, Maryland 20892 Jeanne Kaufman: received her B.S. in Biology at St. Mary's College in Maryland. She is currently with the Biotechnology unit at the National Institutes of Health. She is responsible for the growth of the mammalian cell culture on small and large scale.Search for more papers by this authorRobert M. Kelly, Robert M. Kelly Department of Chemical Engineering, The Johns Hopkins University, Baltimore, Maryland 21218 Robert M. Kelly: is currently assistant professor of chemical engineering at the Johns Hopkins University in Baltimore, Maryland where he has been since 1981. He received his Ph.D. in chemical engineering from North Carolina State University. His research interests include separation processes, especially chemical absorption and stripping, and biochemical engineering with emphasis on engineering problems related to the growth and utilization of bacteria from extreme environments.Search for more papers by this author First published: December 1986 https://doi.org/10.1002/btpr.5420020411Citations: 9 AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Citing Literature Volume2, Issue4December 1986Pages 230-233 RelatedInformation}, number={4}, journal={Biotechnology Progress}, publisher={Wiley}, author={Shiloach, Joseph and Kaufman, Jeanne B. and Kelly, Robert M.}, year={1986}, month={Dec}, pages={230–233} }
 @article{olson_kelly_1986, title={Microbiological Metal Transformations: Biotechnological Applications and Potential}, volume={2}, ISSN={8756-7938 1520-6033}, url={http://dx.doi.org/10.1002/btpr.5420020104}, DOI={10.1002/btpr.5420020104}, abstractNote={Biotechnology ProgressVolume 2, Issue 1 p. 1-15 Biotechnology Progress Topics Microbiological Metal Transformations: Biotechnological Applications and Potential Gregory J. Olson, Gregory J. Olson Surface Chemistry and Bioprocesses Group, National Bureau of Standards, Gaithersburg, MD 20899 Gregory J. Olson: is currently a research microbiologist in the Institute for Materials Science and Engineering at the National Bureau of Standards in Gaithersburg, Maryland. He received a Ph.D. in Microbiology from Montana State University in 1978 and joined NBS as a National Research Council Postdoctoral Fellow (1979–81). His current research interests include biological transformations of materials and development and application of molecular measurement methods to characterize these processes.Search for more papers by this authorRobert M. Kelly, Robert M. Kelly Department of Chemical Engineering, The Johns Hopkins University, Baltimore, MD 21218 Robert M. Kelly: is currently assistant professor of chemical engineering at the Johns Hopkins University in Baltimore, Maryland where he has been since 1981. He received his BS and MS from the University of Virginia and a Ph.D. in chemical engineering from North Carolina State University. Prior to his doctoral work, he was employed with the du Pont Company at Marshall Laboratory in Philadelphia. His research interests include separation processes, especially chemical absorption and stripping, and biochemical engineering with emphasis on engineering problems related to the growth and utilization of bacteria from extreme environments.Search for more papers by this author Gregory J. Olson, Gregory J. Olson Surface Chemistry and Bioprocesses Group, National Bureau of Standards, Gaithersburg, MD 20899 Gregory J. Olson: is currently a research microbiologist in the Institute for Materials Science and Engineering at the National Bureau of Standards in Gaithersburg, Maryland. He received a Ph.D. in Microbiology from Montana State University in 1978 and joined NBS as a National Research Council Postdoctoral Fellow (1979–81). His current research interests include biological transformations of materials and development and application of molecular measurement methods to characterize these processes.Search for more papers by this authorRobert M. Kelly, Robert M. Kelly Department of Chemical Engineering, The Johns Hopkins University, Baltimore, MD 21218 Robert M. Kelly: is currently assistant professor of chemical engineering at the Johns Hopkins University in Baltimore, Maryland where he has been since 1981. He received his BS and MS from the University of Virginia and a Ph.D. in chemical engineering from North Carolina State University. Prior to his doctoral work, he was employed with the du Pont Company at Marshall Laboratory in Philadelphia. His research interests include separation processes, especially chemical absorption and stripping, and biochemical engineering with emphasis on engineering problems related to the growth and utilization of bacteria from extreme environments.Search for more papers by this author First published: March 1986 https://doi.org/10.1002/btpr.5420020104Citations: 38 AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onEmailFacebookTwitterLinkedInRedditWechat Literature Cited 1 Torma, A. E., “Biohydrometallurgy as an emerging technology,” Biotech. Bioeng., in press. 2 Brierley, J. A., C. L. Brierley, and G. M. Goyak, “ATM—Bioclaim: A new wastewater treatment and metal recovery technology,” Proc. 6th Internat. Symp. on Biohydrometallurgy, Vancouver, BC Aug. 21–24, 1985, in press. 3 Gale, N. L. and B. G. Wixson, “Removal of heavy metals from industrial effluents by algae,” Dev. Ind. Microbiol., 20, 259 (1978). 4 Zajic, J. E., and Y. S. Chiu, “Removal of heavy metals by microbes,” Dev. Ind. Microbiol., 13, 91 (1971). 5 Temple, K. L. and A. R. Colmer, “The autotrophic oxidation of iron by a new bacterium, Thiobacillus ferrooxidans,” J. Bacteriol., 62, 605 (1951). 6 Balashava, V. I., G. E. Markosyan, and G. A. Zavarzin, “The auxotrophic growth of Leptospirillum ferrooxidans,” Microbiology, 43, 491 (1974). 7 Waksman, S. A. and J. S. Joffe, “Acid production by a new sulfur oxidizing bacterium,” Science, 53, 216 (1921). 8 Brierley, J. A., “Contribution of chemautotrophic bacteria to the acid thermal waters of the Geyser Spring Group in Yellowstone National Park,” Ph.D. thesis, Montana St. Univ., Bozeman, (1966). 9 Brock, T. D., K. M. Brock, R. T. Belly, and B. L. Weiss, “Sulfolobus: a new genus of sulfur-oxidizing bacteria living at low pH and high temperatures,” Arch. Microbiol, 84, 54 (1972). 10 Brierley, C. L. and J. A. Brierley, “A chemoautotrophic and thermophilic microorganism isolated from an acid hot spring,” Can. J. Microbiol., 19, 183 (1973). 11 Harrison, A. P. Jr., “Acidiphilium cryptum gen nov., sp. nov., heterotrophic bacterium from acidic mineral environments,” Internat. J. System. Bacteriol., 31, 327 (1981). 12 Wichlacz, P. L. and R. E. Unz, “Acidophilic heterotrophic bacteria of acid mine wastes,” Appl. Environ. Microbiol., 41, 1254 (1981). 13 Brierley, J. A., “Thermophilic iron-oxidizing bacteria found in copper leach dumps,” Appl. Environ. Microbiol., 36, 523 (1978). 14 Wood, A. P. and D. P. Kelly, “Autotrophic and mixotrophic growth of three thermoacidophilic iron-oxidizing bacteria,” Trends in Biotechnol., 3, 86 (1985). 15 Gentina, J. C. and F. Acevedo, “Microbial ore leaching in developing countries,” Trends in Biotechnol, 3, 86 (1985). 16 Ehrlich, H. L., “Inorganic energy sources for chemolithotrophic and mixotropic bacteria,” Geomicrobiol. J., 1, 65 (1978). 17 Lewis, A. J., and J. D. A. Mier, “Stannous and cuprous ion oxidation by Thiobacillus ferrooxidans,” Can. J. Microbiol., 23, 319 (1977). 18 DiSpirito, A. A. and O. H. Tuovinen, “Uranous ion oxidation and carbon dioxide fixation by Thiobacillus ferrooxidans,” Arch. Microbiol., 133, 28 (1982). 19 Kelly, D. P., Bioenergetics of chemolithotrophic bacteria, Chap. 15 in Companion to Microbiology, A. T. Bull and P. M. Meadows, eds., Longman: London and New York, pp. 363–386 (1978). 20 Ingledew, W. J., “Thiobacillus ferrooxidans: The bioenergetics of an acidophilic chemolithotroph,” Biochim. Biophys. Acta, 683, 89 (1982). 21 Ingledew, W. J. and J. G. Cobley, “A potentiometric and kinetic study on the respiratory chain of ferrous-iron-grown Thiobacillus ferrooxidans,” Biochim. Biophys. Acta, 590, 141 (1980). 22 Ingledew, W. J., “The biochemistry of ferrous iron oxidation by Thiobacillus ferrooxidans,” Biotechnol. Bioeng., in press. 23 Lyalikova, N. N., “Oxidation of trivalent antimony up to higher oxides as a source of energy for the development of a new autotrophic organism, Stibiobacter, gen. nov.,” Dokl Akad Nauk SSSR, 205, 1228 (1972). 24 Harrison, A. P. Jr., “The acidophilic thiobacilli and other acidophilic bacteria that share their habitat,” Ann Rev. Microbiol., 38, 265 (1984). 25 Golovacheva, R. S. and G. I. Karavaiko, “A new genus of thermophilic spore-forming bacteria, Sulfobacillus,” Microbiology (USSR), 47, 815 (1978). 26 Woese, C. R., L. J. Magrum, and G. E. Fox, “Archaebacteria,” J. Molecular Evolution, 11, 245 (1978). 27 Stetter, K. O., H. Konig, and E. Stackebrandt, “Pyrodictum gen nov., a new genus of submarine disc-shaped sulfur reducing archaebacteria growing optimally at 105 C,” System. Appl. Microbiol., 4, 535 (1983). 28 Speiss, F. N., et al., “East Pacific Rise: Hot Springs and Geochemical Experiments,” Science, 207, 1421 (1980). 29 Baross, J. A. and J. W. Deming, “Growth of black smoker bacteria at temperatures of at least 250 C,” Nature, 303, 423 (1983). 30 Ilyaletdinov, A. N., P. B. Enker, and L. V. Loginova, “Role of sulfate-reducing bacteria in the precipitation of copper,” Microbiology, 46, 92 (1977). 31 Manders, W. F., G. J. Olson, F. E. Brinckman, and J. M. Bellama, “A novel synthesis of methyltin triiodide with environmental implications,” J. Chem. Soc. Chem. Commun. 1984, 538 (1984). 32 Thayer, J. S., G. J. Olson, and F. E. Brinckman, “Iodomethane as a potential metal mobilizing agent in nature,” Environ. Sci. Technol., 18, 726 (1984). 33 Trimble, R. B. and H. L. Ehrlich, “Bacteriology of Manganese Nodules. IV. Induction of a MnO2 Reductase System in a Marine Bacillus,” Appl. Microbiol., 19, 966 (1970). 34 Olson, G. J. F. D. Porter, J. Rubenstein, and S. Silver, “Mercuric reductase enzyme from a mercury volatizing strain of Thiobacillus ferrooxidans,” J. Bacteriol., 151, 1230 (1982). 35 Williams, J. W. and S. Silver, “Bacterial resistance and detoxification of heavy metals,” Enzyme Microb. Technol., 6, 530 (1984). 36 Pan-Hou, H. S. and N. Imura, “Involvement of mercury methylation in microbial detoxification,” Arch. Microbiol., 131, 176 (1982). 37 Nelson, J. D., W. Blair, F. E. Brinckman, R. R. Colwell, and W. P. Iverson, “Biodegradation of phenylmercuric acetate by mercury-resistant bacteria,” Appl. Microbiol., 26, 321 (1973). 38 Silver, S. and D. Keach, “Energy dependent arsenate efflux: the mechanism of plasmid mediated resistance,” Proc. Nac. Acad. Sci. U.S.A., 79, 6114 (1982). 39 Blakemore, R. P. “Magnetotactic bacteria,” Ann. Rev. Microbiol., 36, 217 (1982). 40 Bennett, J. C. and H. Tributsch, “Bacterial leaching patterns on pyrite crystal surfaces,” J. Bacteriol., 134, 310 (1978). 41 Kelly, D. P., P. R. Norris, and C. L. Brierly, Microbiological methods for the extraction and recovery of metals, in Microbiol technology: current state, future prospects, A. T. Bull, D. C. Ellwood, and C. Ratledge, eds., Cambridge Univ. Press, Cambridge, pp. 263–308 (1979). 42 Singer, P. C. and W. Stumm, “Acidic mine drainage: the rate-determining step,” Science, 167, 1121 (1970). 43 Mehta, A. P., A. E. Torma, and L. E. Murr, “Biodegradation of aluminum bearing rocks by Penicillium simplicissimum,” IRCS Med. Sci. Biochem.; Environ. Biol. Med., Microbiol., Parasit. Infect. Diseases, 6, 416 (1978). 44 Banik, S. and B. K. Dey, “Alluvial soil microorganisms capable of utilizing insoluble aluminum phosphate as a sole source of phosphorus,” Zbl. Mikrobiol., 138, 437 (1983). 45 Siegel, S. M., B. Z. Siegel, and K. E. Clark, “Bio-corrosion: solubilization and accumulation of metals by fungi,” Water, Air, Soil Pollut., 19, 229 (1983). 46 Torma, A. E., “Current standing of bacterial heap, dump, and in-situ leaching technology of copper,” Metall., 38, 1044 (1984). 47 McCready, R. G. L., D. Wadden, and A. Marchbank, “Optimization of the bacterial leaching of uranium,” Paper presented at Workshop on Biotechnology for the Mining, Metal-Refining, and Fossil Fuel Processing Industries, Troy, NY, May 28–30 (1985). 48 Lawrence, R. W. and A. Bruynesteyn, “Biological pre-oxidation to enhance gold and silver recovery from refractory pyritic ores and concentrates,” CIM Bull., 76, 107 (1983). 49 Silverman, M. P., M. H. Rogoff, and I. Wender, “Removal of pyritic sulphur from coal by bacterial action,” Fuel, 42, 113 (1963). 50 Torma, A. E. and L. E. Murr, “Desulfurization of coal by microbiological leaching,” New Mexico Energy and Minerals Department Rep. No. EMD-2-67-3319, Santa Fe (1981). 51 Myerson, A. S. and P. C. Kline, “Continuous bacterial coal desulfurization employing Thiobacillus ferrooxidans,” Biotechnol. Bioeng., 26, 92 (1984). 52 Detz, C. M. and G. Barvinchak, “Microbiol desulfurization of coal,” Mining Congress J., 65, 75 (1979). 53 Kargi, F. and J. G. Weissman, “A dynamic mathematical model for microbial removal of pyritic sulfur from coal,” Biotechnol. Bioeng., 26, 604 (1984). 54 Kargi, F. and J. M. Robinson, “Biological removal of pyritic sulfur from coal by the thermophilic organism Sulfolobus acidocaldarius,” Biotechnol. Bioengin., 27, 41 (1985). 55 Chandra, D., P. Roy, A. K. Mishra, J. N. Chakrabarti, and B. Sengupta, “Microbial removal of organic sulfur from coal,” Fuel, 58, 549 (1979). 56 Kargi, F. and J. M. Robinson, “Microbial desulfurization of coal by the thermophilic microorganism, Sulfolobus acidocaldarius,” Biotechnol. Bioeng., 24, 2115 (1982). 57 Gockay, C. F. and R. N. Yurteri, “Microbial desulfurization of lignites by a thermophilic bacteria,” Fuel, 62, 1223 (1983). 58 Atlantic Research Corp., “Pseudomonas for desulfurization of fossil fuels,” U.S. Patent Application 512,857, July 11, 1983. 59 Kargi, F., “Microbial oxidation of dibenzothiophene by the thermophilic organism Sulfolobus acidocaldarius,” Biotechnol. Bioeng., 26, 687 (1984). 60 Monticello, D. J. and W. R. Finnerty, “Microbial desulfurization of fossil fuels,” Annu. Rev. Microbiol., 39, 371 (1985). 61 Bosecker, K., “Metal recovery and detoxification of industrial waste products,” Biotechnol. Bioengin., in press. 62 Beveridge, T. J., “Ultrastructure, chemistry, and function of the bacterial wall,” Int. Rev. Cytol., 72, 229 (1981). 63 Volesky, B., “Biosorbent materials,” Biotechnol. Bioeng., in press. 64 Dunn, G. M. and A. T. Bull, “Bioaccumulation of copper by a defined community of activated sludge bacteria,” Eur. J. Appl. Microbiol. Biotechnol., 17, 30 (1983). 65 Charley, R. C. and A. T. Bull, “Bioaccumulation of silver by a multispecies community of bacteria,” Arch. Microbiol., 123, 239 (1979). 66 Nakajima, A., T. Horikoshi, and T. Sakaguchi, “Recovery of uranium by immobilized microorganisms,” Eur. J. Appl. Microbiol. Biotechnol., 16, 88 (1982). 67 Brierley, J. A., Biological accumulation of some heavy metals—biotechnological applications. in Biomineralization and Biological Metal Accumulation, P. Westbrock and E. W. de Jong, eds., D. Reidel Publ. Co., pp. 499–509 (1983). 68 Wood, J. M. and H. K. Wang, “Strategies for microbial resistance to heavy metals,” in Chemical Processes in Lakes, W. Stumm, ed., pp. 81–97 (1985). 69 Monroe, D., “Microbial metal mining,” American Biotechnol. Lab., p. 10, January/February (1985). 70 Brierley, C. L., “Bacterial leaching,” CRC Crit. Rev. Microbiol., 6, 207 (1978). 71 Ralph, B. J., “Geomicrobiology and the new biotechnology,” Dev. Ind. Microbiol., 27, 850 (1985). 72 Torma, A. E., C. C. Walden, D. W. Duncan, and R. M. R. Branion, “The effect of carbon dioxide and particle surface area on the microbiological leaching of a zinc concentrate,” Biotechnol. Bioeng., 14, 777 (1972). 73 McElroy, R. O. and A. Bruynesteyn, Continuous biological leaching of chalcopyrite concentrates: Demonstration and economic analysis, in Metallurgical Applications of Bacterial Leaching and Related Microbiological Phenomena, L. E. Murr, A. E. Torma, and J. A. Brierley, eds., pp. 441–462, Academic Press, New York (1978). 74 Babij, T. and B. J. Ralph, “Assessment of metal recovery and metal pollution potentiality of sulphidic mine wastes,” Proc. GIAM V, pp. 476–479 (1979). 75 Babij, T., R. B. Noble, and B. J. Ralph, A reactor system for mineral leaching investigations, in Biogeochemistry of Ancient and Modern Environments, P. A. Trudinger, M. R. Walter, and R. B. Ralph, eds., pp. 563–572 (1980). 76 Sanmugasunderam, V., “The continuous microbiological leaching of zinc sulphide concentrate with recycle,” Ph.D. Thesis, Univ. British Columbia (1981). 77 Rai, C., “Microbial desulfurization of coals in a slurry pipeline reactor using Thiobacillus ferrooxidans,” Biotechnol. Prog., 1, 200 (1985). 78 Yukawa, T., “Mass transfer studies in microbial systems,” Ph.D. Thesis, Univ. of South Wales (1975). 79 Ebner, H. G., Bacterial leaching in an airlift reactor, in Proc. Int. Conf. on Use of Micro-organisms in Hydrometallurgy, Hungarian Academy of Sciences, B. Czegledi, ed., pp. 211–217 (1980). 80 Kiese, S., H. G. Ebner, and U. Onken, “A simple laboratory airlift fermentor,” Biotechnol. Lett., 2, 345 (1980). 81 Livesey-Goldblatt, E., T. H. Tunley, and I. F. Nagy, Pilot-plant bacterial film oxidation (Bacfoc Process) of recycled acidified uranium plant ferrous sulphate leach solution, in CBF Monograph Series, No. 4, Conference on Bacterial Leaching, W. Schwartz, ed., pp. 175–190, Verlag Chemie, Weinham (1977). 82 Atkins, A. S. and F. D. Pooley, Comparison of bacterial reactors employed in the oxidation of sulphide concentrates, in Recent Progress in Hydrometallurgy, pp. 111–125, G. Rossi and A. E. Torma, eds., Associazione Mineraria Sarda-09016 Iglesias-Italy (1983). 83 Huber, T. F., C. H. Kos, P. Bos, N. W. F. Kossen, and J. G. Kuenen, Modelling, scale-up and design of bioreactors for microbial desulphirization of coal, in Recent Progress in Hydrometallurgy, pp. 279–289, G. Rossi and A. E. Torma, eds., Op. cit. 84 Zajic, J. E., Microbial Biogeochemistry, Academic Press, New York (1969). 85 Lawrence, R. W., A. Vizsolyi, R. J. Vos, and A. Bruynesteyn, Continuous bioleaching of copper concentrates, AIChE National Meeting, Atlanta, Georgia (1984). 86 Myerson, A. S. and P. C. Kline, “The adsorption of Thiobacillus ferrooxidans on solid particles,” Biotechnol. Bioeng., 25, 1669 (1983). 87 DiSpirito, A. A., P. R. Dugan, and O. H. Tuovinen, “Sorption of Thiobacillus ferrooxidans to particulate materials,” Biotechnol. Bioeng., 25, 1163 (1983). 88 Erickson, L. E., L. T. Fan, P. S. Shah, and M. S. K. Chen, “Growth models of cultures with two liquid phases: IV. Cell adsorption, drop size distribution, and batch growth,” Biotechnol. Bioeng., 12, 713 (1970). 89 Gormely, L. S., D. W. Duncan, R. M. R. Branion, and K. L. Pinder, “Continuous culture of Thiobacillus ferrooxidans on a zinc sulfide concentrate,” Biotechnol. Bioeng., 17, 31 (1975). 90 Sanmugasunderam, V., R. M. R. Branion, and D. W. Duncan, “A growth model for the continuous microbiological leaching of a zinc sulfide concentrate by Thiobacillus ferrooxidans,” Biotechnol. Bioeng., 27, 1173 (1985). 91 Chang, Y. C. and A. S. Myerson, “Growth models of the continuous bacterial leaching of iron pyrite by Thiobacillus ferrooxidans,” Biotechnol. Bioeng., 24, 889 (1982). 92 Yeh, T. Y., J. R. Godshalk, G. J. Olson, and R. M. Kelly, “Use of epifluorescence microscopy for characterizing the activity of Thiobacillus ferrooxidans on metal sufides,” submitted to Biotechnol. Bioeng. 93 Lancy, E. D., and O. H. Tuovinen, “Ferrous ion oxidation by Thiobacillus ferrooxidans in calcium alginate,” Appl. Microbiol. Biotechnol., 20, 94 (1984). 94 Kelly, D. P., C. A. Jones, and J. S. Green, “Factors affecting metabolism and ferrous iron oxidation in suspensions and batch cultures of Thiobacillus ferrooxidans,” paper presented at Int. Symp. Metallurg. Appl. Bacterial Leaching and Related Microbial Phenomena, Socorro, New Mexico, August, 1977. 95 Guay, R., M. Silver, and A. E. Torma, “Ferrous iron oxidation and uranium extraction by Thiobacillus ferrooxidans,” Biotechnol., Bioeng., 19, 727 (1977). 96 Liu, M. S., R. M. R. Branion, and D. W. Duncan, “Determination of the solubility of oxygen in fermentation media,” Biotechnol. Bioeng., 15, 213 (1973). 97 Tuovinen, O. H. and D. P. Kelly, “Biology of Thiobacillus ferrooxidans in relation to the microbiological leaching of sulphide ores,” Z. Allg. Mikrobiol., 12, 311 (1972). 98 Schumpe, A., G. Quicker, and W.-D. Deckwer, Gas solubilities in microbial culture media, in Advances in Biochemical Engineering, Volume 24: Reaction Engineering, A. Fiechter, ed., Springer-Verlag, Berlin-Heidelberg (1982). 99 Le Roux, N. W. and V. M. Marshall, Effect of Light on Thiobacilli, presented at Round Table Conf. on Leaching, Braunschweif, Germany, March 27-April 2, 1977. 100 Yunker, S. B. and J. M. Rodavich, “Electrolytically enhanced growth of Thiobacillus ferrooxidans,” presented at Wkshp on Biotech. for the Mining, Metal-Refining, and Fossil Fuel Proc. Industries, Poster #1, Troy, NY, May 28–30 (1985). 101 Kinsel, N. A. and W. W. Umbreit, “Method of electrolysis of culture medium to increase growth of the sulfur-oxidizing iron bacterium Ferrobacillus sulfooxidans,” J. Bacteriol., 94, 1046 (1967). 102 Davidson, M. A. and A. O. Summers, “Wide-range host plasmids function in the genus Thiobacillus,” Appl. Environ. Microbiol., 46, 565 (1983). 103 Brierley, C. L., “Microbiological mining,” Sci. Am., 247, 44 (1982). 104 Beveridge, T. J., “The immobilization of soluble metals by bacterial walls,” Biotechnol. Bioeng., in press. 105 Martin, P. A., P. Dugan, and O. H. Tuovinen, “Plasmid DNA in acidophilic, chemolithotrophic thiobacilli,” Can. J. Microbiol., 27, 850 (1981). 106 Rawlings, D. E., I. M. Pretorius, and D. R. Woods, “Construction of arsenic-resistant Thiobacillus ferrooxidans recombinant plasmids and the expression of autotrophic plasmid genes in a heterotrophic cell-free system,” J. Biotechnol., 1, 129 (1984). 107 Kulpa, C. F., M. T. Roskey, and M. J. Travis, “Transfer of plasmid RPI into chemolithotrophic Thiobacillus neapolitanus,” J. Bacteriol., 156, 434 (1983). 108 Woods, D. and D. Rawlings, “Molecular genetic studies on the thiobacilli and the development of improved biomining bacteria,” BioEssays, 2, 8 (1985). 109 Bosecker, K., A. E. Torma, and J. A. Brierley, “Microbiological leaching of a chalcopyrite concentrate and the influence of hydrostatic pressure on the activity of Thiobacillus ferrooxidans, Eur. J. Appl. Microbiol., 7, 85 (1979). 110 Davidson, M. S., A. E. Torma, J. A. Brierley, and C. L. Brierley, “Effects of elevated pressures on iron- and sulfur-oxidizing bacteria,” Biotechnol. Bioeng., Symp. No. 11, 603 (1981). 111 Davidson, M. S., “The effects of simulated deep simulation mining conditions on the activity of iron and sulfur oxidizing bacteria,” Ph.D. Thesis, New Mexico Inst. of Mining and Technology, Socorro, New Mexico (1982). 112 Sturm, F. J., S. A. Hurwitz, J. W. Deming, and R. M. Kelly, “Growth of the extreme thermophile, Sulfolobus acidocaldarius, in a hyperbaric helium bioreactor,” submitted to Biotechnol. Bioeng. 113 Hurwitz, S. A., “Effect of temperature and pressure on the growth of Sulfolobus acidocaldarus,” Masters Thesis, Dept. of Chem. Eng., The Johns Hopkins Univ. (1985). 114 Deming, J. W., The biotechnological future for newly-described, extremely thermophilic bacteria, in Microbial Ecology, special issue devoted to Biotechnology, R. R. Colwell and A. L. Demain, eds., Springer-Verlag, in press. 115 Hurwitz, S. A., F. J. Sturm, J. W. Deming, and R. M. Kelly, “The effect of temperature and pressure on the growth of extremely thermophilic bacteria,” presented at the 77th Ann. Mtg. of the Am. Inst. Chem. Eng., Chicago, III., November, 1985. Citing Literature Volume2, Issue1March 1986Pages 1-15 ReferencesRelatedInformation}, number={1}, journal={Biotechnology Progress}, publisher={Wiley}, author={Olson, Gregory J. and Kelly, Robert M.}, year={1986}, month={Mar}, pages={1–15} }
 @article{rousseau_ferrell_kelly_1985, title={Conditioning Coal Gas with Refrigerated Methanol in a System of Packed Columns}, volume={34}, ISSN={0098-6445 1563-5201}, url={http://dx.doi.org/10.1080/00986448508911184}, DOI={10.1080/00986448508911184}, abstractNote={Experience with the operation of a pilot-scale unit is used to outline potential difficulties in the operation of acid gas removal systems on gases produced from coal. The pilot plant has been used to condition gases produced from subbituminous coal, devolatilized char, peat and lignite. The solvent used in the acid gas removal system has been refrigerated methyl alcohol. Data from this study document accumulation of hydrocarbons, sulfur and nitrogen compounds, and mercury in the circulating solvent.}, number={1-6}, journal={Chemical Engineering Communications}, publisher={Informa UK Limited}, author={Rousseau, Ronald W. and Ferrell, James K. and Kelly, Robert M.}, year={1985}, month={Mar}, pages={27–35} }
 @article{kelly_rousseau_ferrell_1984, title={Design of packed, adiabatic absorbers: physical absorption of acid gases in methanol}, volume={23}, ISSN={0196-4305 1541-5716}, url={http://dx.doi.org/10.1021/i200024a017}, DOI={10.1021/i200024a017}, abstractNote={ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTDesign of packed, adiabatic absorbers: physical absorption of acid gases in methanolRobert M. Kelly, Ronald W. Rousseau, and James K. FerrellCite this: Ind. Eng. Chem. Process Des. Dev. 1984, 23, 1, 102–109Publication Date (Print):January 1, 1984Publication History Published online1 May 2002Published inissue 1 January 1984https://doi.org/10.1021/i200024a017RIGHTS & PERMISSIONSArticle Views594Altmetric-Citations15LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (947 KB) Get e-Alerts}, number={1}, journal={Industrial & Engineering Chemistry Process Design and Development}, publisher={American Chemical Society (ACS)}, author={Kelly, Robert M. and Rousseau, Ronald W. and Ferrell, James K.}, year={1984}, month={Jan}, pages={102–109} }
 @book{kelly_rousseau_ferrell_1983, place={Washington, D.C.}, title={Coal Gasification/Gas Cleanup Test Facility. Volume 4. A Mathematical Model of the Packed Column Acid Gas Absorber}, number={EPA/600/7-83/053}, institution={U.S. Environmental Protection Agency}, author={Kelly, R.M. and Rousseau, R.W. and Ferrell, J.K.}, year={1983} }
 @book{ferrell_felder_rousseau_ganesan_kelly_mccue_purdy_1982, place={Washington, D.C.}, title={Coal Gasification/Gas Cleanup Test Facility, Vol III: Environmental Assessment of Operation with New Mexico Subbituminous Coal and Chilled Methanol}, number={EPA-600/7-82-054}, institution={U.S. Environmental Protection Agency}, author={Ferrell, J.K. and Felder, R.M. and Rousseau, R.W. and Ganesan, S. and Kelly, R.M. and McCue, J.C. and Purdy, M.J.}, year={1982} }
 @book{ferrell_felder_rousseau_ganesan_kelly_mccue_purdy_1982, place={Washington, D.C.}, title={Coal Gasification/Gas Cleanup Test Facility: Vol II: Environmental Assessment of Operation with Devolatilized Bituminous Coal and Chilled Methanol}, number={EPA-600/7-82-023}, institution={U.S. Environmental Protection Agency}, author={Ferrell, J.K. and Felder, R.M. and Rousseau, R.W. and Ganesan, S. and Kelly, R.M. and McCue, J.C. and Purdy, M.J.}, year={1982} }
 @article{kelly_rousseau_ferrell_1981, title={Physical Absorption of CO2and Sulfur Gases from Coal Gasification: Simulation and Experimental Results}, volume={16}, ISSN={0149-6395 1520-5754}, url={http://dx.doi.org/10.1080/01496398108058308}, DOI={10.1080/01496398108058308}, abstractNote={Abstract High partial pressures of CO2, H2S and certain other constituents produced in coal gasification tend to make the use of physical solvents in associated acid gas removal systems more attractive than the use of chemical solvents. In the research program described in this paper operating data obtained on a pilot plant system employing refrigerated methanol as a solvent will be presented. A mathematical model of the packed absorber used in the process was developed. Predictions of system performance for a feed gas consisting of CO2 and nitrogen compared favorably to experimental data obtained on the system. In addition, there was very good agreement between predicted and observed distributions of nine of the major components in a feed gas synthesized in a coal gasification reactor. The results show the validity of the modeling procedure and may be used in understanding the general characterists of packed absorbers and strippers.}, number={10}, journal={Separation Science and Technology}, publisher={Informa UK Limited}, author={Kelly, R. M. and Rousseau, R. W. and Ferrell, J. K.}, year={1981}, month={Dec}, pages={1389–1414} }
 @book{ferrell_felder_rousseau_kelly_mccue_willis_1980, place={Washington, D.C.}, title={Coal Gasification/Gas Cleanup Test Facility: Vol I: Description and Operations}, number={EPA-600/7-80-046a}, institution={U.S. Environmental Protection Agency}, author={Ferrell, J.K. and Felder, R.M. and Rousseau, R.W. and Kelly, R.M. and McCue, J.C. and Willis, W.E.}, year={1980} }
 @article{felder_kelly_ferrell_rousseau_1980, title={How clean gas is made from coal}, volume={14}, ISSN={0013-936X 1520-5851}, url={http://dx.doi.org/10.1021/es60166a004}, DOI={10.1021/es60166a004}, abstractNote={ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTHow clean gas is made from coalR. M. Felder, R. M. Kelly, J. K. Ferrell, and R. W. RousseauCite this: Environ. Sci. Technol. 1980, 14, 6, 658–666Publication Date (Print):June 1, 1980Publication History Published online1 May 2002Published inissue 1 June 1980https://doi.org/10.1021/es60166a004RIGHTS & PERMISSIONSArticle Views94Altmetric-Citations5LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (831 KB) Get e-Alerts Get e-Alerts}, number={6}, journal={Environmental Science & Technology}, publisher={American Chemical Society (ACS)}, author={Felder, R. M. and Kelly, R. M. and Ferrell, J. K. and Rousseau, R. W.}, year={1980}, month={Jun}, pages={658–666} }
 @article{kelly_kirwan_1977, title={Electrochemical regeneration of NAD+on carbon electrodes}, volume={19}, ISSN={0006-3592 1097-0290}, url={http://dx.doi.org/10.1002/bit.260190811}, DOI={10.1002/bit.260190811}, number={8}, journal={Biotechnology and Bioengineering}, publisher={Wiley}, author={Kelly, R. M. and Kirwan, D. J.}, year={1977}, month={Aug}, pages={1215–1218} }
 @article{gainer_gainer_kelly_1976, title={Steroids and oxygen solubility}, volume={28}, ISSN={0039-128X}, url={http://dx.doi.org/10.1016/0039-128x(76)90041-6}, DOI={10.1016/0039-128x(76)90041-6}, abstractNote={Determinations of oxygen solubility in serum were made utilizing various concentrations of corticosteroids in the serum. Within a certain concentration range dexamethasone and betamethasone caused an increase in oxygen solubility. None of the other steroids tested demonstrated this property.}, number={3}, journal={Steroids}, publisher={Elsevier BV}, author={Gainer, James V., Jr. and Gainer, John L. and Kelly, Robert}, year={1976}, month={Sep}, pages={307–310} }
 @article{kataeva_foston_yang_pattathil_biswal_poole_basen_rhaesa_thomas_azadi_et al., title={Carbohydrate and lignin are simultaneously solubilized from unpretreated switchgrass by microbial action at high temperature}, volume={6}, number={7}, journal={Energy & Environmental Science}, author={Kataeva, I. and Foston, M. B. and Yang, S. J. and Pattathil, S. and Biswal, A. K. and Poole, F. L. and Basen, M. and Rhaesa, A. M. and Thomas, T. P. and Azadi, P. and et al.}, pages={2186–2195} }
 @article{mccutchen_duffaud_leduc_petersen_tayal_khan_kelly, title={Characterization of extremely thermostable enzymatic breakers (alpha-1,6-galactosidase and beta-1,4-mannanase) from the hyperthermophilic bacterium Thermotoga neapolitana 5068 for hydrolysis of guar gum}, volume={52}, number={2}, journal={Biotechnology and Bioengineering}, author={McCutchen, C.M. and Duffaud, G.D. and Leduc, P. and Petersen, A.R.H. and Tayal, A. and Khan, S.A. and Kelly, R.M.}, pages={332–339} }
 @article{blumer-schuette_ozdemir_mistry_lucas_lapidus_cheng_goodwin_pitluck_land_hauser_et al., title={Complete genome sequences for the anaerobic, extremely thermophilic plant biomass-degrading bacteria caldicellulosiruptor hydrothermalis, caldicellulosiruptor kristjanssonii, caldicellulosiruptor kronotskyensis, caldicellulosiruptor owensensis, and caldic}, volume={193}, number={6}, journal={Journal of Bacteriology}, author={Blumer-Schuette, S. E. and Ozdemir, I. and Mistry, D. and Lucas, S. and Lapidus, A. and Cheng, J. F. and Goodwin, L. A. and Pitluck, S. and Land, M. L. and Hauser, L. J. and et al.}, pages={1483–1484} }
 @article{conway_zurawski_lee_blumer-schuette_kelly, title={Lignocellulosic biomass deconstruction by the extremely thermophilic genus caldicellulosiruptor}, journal={Thermophilic Microorganisms}, author={Conway, J. M. and Zurawski, J. V. and Lee, L. L. and Blumer-Schuette, S. E. and Kelly, R. M.}, pages={91–119} }
 @article{tayal_kelly_khan, title={Viscosity reduction of hydraulic fracturing fluids through enzymatic hydrolysis}, volume={2}, number={2}, journal={Society of Petroleum Engineers Journal}, author={Tayal, A. and Kelly, R.M. and Khan, S.A.}, pages={204–212} }