2008 journal article
A new branch of endoplasmic reticulum stress signaling and the osmotic signal converge on plant-specific asparagine-rich proteins to promote cell death
JOURNAL OF BIOLOGICAL CHEMISTRY, 283(29), 20209–20219.
www.jbc.org (publisher PDF)
Source: Web Of Science
Added: August 6, 2018
NRPs (N-rich proteins) were identified as targets of a novel adaptive pathway that integrates endoplasmic reticulum (ER) and osmotic stress signals based on coordinate regulation and synergistic up-regulation by tunicamycin and polyethylene glycol treatments. This integrated pathway diverges from the molecular chaperone-inducing branch of the unfolded protein response (UPR) in several ways. While UPR-specific targets were inversely regulated by ER and osmotic stresses, NRPs required both signals for full activation. Furthermore, BiP (binding protein) overexpression in soybean prevented activation of the UPR by ER stress inducers, but did not affect activation of NRPs. We also found that this integrated pathway transduces a PCD signal generated by ER and osmotic stresses that result in the appearance of markers associated with leaf senescence. Overexpression of NRPs in soybean protoplasts induced caspase-3-like activity and promoted extensive DNA fragmentation. Furthermore, transient expression of NRPs in planta caused leaf yellowing, chlorophyll loss, malondialdehyde production, ethylene evolution, and induction of the senescence marker gene CP1. This phenotype was alleviated by the cytokinin zeatin, a potent senescence inhibitor. Collectively, these results indicate that ER stress induces leaf senescence through activation of plant-specific NRPs via a novel branch of the ER stress response. NRPs (N-rich proteins) were identified as targets of a novel adaptive pathway that integrates endoplasmic reticulum (ER) and osmotic stress signals based on coordinate regulation and synergistic up-regulation by tunicamycin and polyethylene glycol treatments. This integrated pathway diverges from the molecular chaperone-inducing branch of the unfolded protein response (UPR) in several ways. While UPR-specific targets were inversely regulated by ER and osmotic stresses, NRPs required both signals for full activation. Furthermore, BiP (binding protein) overexpression in soybean prevented activation of the UPR by ER stress inducers, but did not affect activation of NRPs. We also found that this integrated pathway transduces a PCD signal generated by ER and osmotic stresses that result in the appearance of markers associated with leaf senescence. Overexpression of NRPs in soybean protoplasts induced caspase-3-like activity and promoted extensive DNA fragmentation. Furthermore, transient expression of NRPs in planta caused leaf yellowing, chlorophyll loss, malondialdehyde production, ethylene evolution, and induction of the senescence marker gene CP1. This phenotype was alleviated by the cytokinin zeatin, a potent senescence inhibitor. Collectively, these results indicate that ER stress induces leaf senescence through activation of plant-specific NRPs via a novel branch of the ER stress response. The unfolded protein response (UPR) 5The abbreviations used are: UPR, unfolded protein response; AZC, l-azetidine-2-carboxylic acid; BAP, 6-benzylaminopurine; BiP, binding protein; CNX, calnexin; CRT, calreticulin; DCD, development and cell death; ER, endoplasmic reticulum; MDA, malondialdehyde; NIG, NSP-interacting GTPase; NRPs, N-rich proteins; PCD, programmed cell death; PDI, protein-disulfide isomerase; PEG, polyethylene glycol; SMP, seed maturation protein; MES, 4-morpholineethanesulfonic acid; GFP, green fluorescent protein; TUNEL, terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling; WT, wild type; RACE, rapid amplification of cDNA ends. 5The abbreviations used are: UPR, unfolded protein response; AZC, l-azetidine-2-carboxylic acid; BAP, 6-benzylaminopurine; BiP, binding protein; CNX, calnexin; CRT, calreticulin; DCD, development and cell death; ER, endoplasmic reticulum; MDA, malondialdehyde; NIG, NSP-interacting GTPase; NRPs, N-rich proteins; PCD, programmed cell death; PDI, protein-disulfide isomerase; PEG, polyethylene glycol; SMP, seed maturation protein; MES, 4-morpholineethanesulfonic acid; GFP, green fluorescent protein; TUNEL, terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling; WT, wild type; RACE, rapid amplification of cDNA ends. is activated by stress conditions that disrupt the endoplasmic reticulum (ER) homeostasis and the proper folding and maturation of secretory proteins. This complex signaling cascade is conserved in eukaryotes, although the mechanism of signal transduction differs across species. The central transducer of the UPR is IRE1, a transmembrane kinase that appears to be the only means of signal transduction in yeast, but is part of a tripartite signaling response in animals, which also includes the ER-transmembrane transducers PERK and ATF6 (1Maa Y. Hendershot L.M. J. Chem. Neuroanatomy. 2004; 28: 51-65Crossref PubMed Scopus (313) Google Scholar). In plants, there is compelling evidence that the UPR operates through IRE1 (2Buzeli R.A.A. Cascardo J.C.M. Rodrigues L.A.Z. Andrade M.O. Loureiro M.E. Otoni W.C. Fontes E.P.B. Plant Mol. Biol. 2002; 50: 757-771Crossref PubMed Scopus (37) Google Scholar, 3Denecke J. Carlsson L.E. Vidal S. Hoglund A.-S. Ek B. van Zeiji M.J. Sinjorgo K.M.C. Palva E.T. Plant Cell. 1995; 7: 391-406Crossref PubMed Scopus (184) Google Scholar, 4Irsigler A.S. Costa M.D. Zhang P. Reis P.A.B. Dewey R.E. Boston R.S. Fontes E.P.B. BMC Genomics. 2007; 8: 431Crossref PubMed Scopus (84) Google Scholar, 5Kamauchi S. Nakatani H. Nakano C. Urade R. Febs. J. 2005; 272: 3461-3476Crossref PubMed Scopus (163) Google Scholar, 6Kirst M.E. Meyer D.J. Gibbon B.C. Jung R. Boston R.S. Plant Physiol. 2005; 138: 218-231Crossref PubMed Scopus (52) Google Scholar, 7Martinez I.M. Chrispeels M.J. Plant Cell. 2003; 15: 561-576Crossref PubMed Scopus (331) Google Scholar), but characterization of this cytoprotective signaling pathway is still incipient. The only known components of plant UPR are the putative proximal sensors that include two Arabidopsis Ire1p homologues and two ATF6-related proteins, designated AtbZIP28 and AtbZIP60 (8Koizumi N. Martinez I.M. Kimata Y. Kohno K. Sano H. Chrispeels M.J. Plant Physiol. 2001; 127: 949-962Crossref PubMed Scopus (186) Google Scholar, 9Iwata Y. Koizumi N. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 5280-5285Crossref PubMed Scopus (266) Google Scholar, 10Liu J.-X. Srivastava R. Che P. Howell S.H. Plant Cell. 2007; 19: 4111-4119Crossref PubMed Scopus (323) Google Scholar). Although the N-terminal domain of plant IRE1 homologues can replace functionally the yeast IRE1, downstream components of the IRE1 signaling are yet to be identified (8Koizumi N. Martinez I.M. Kimata Y. Kohno K. Sano H. Chrispeels M.J. Plant Physiol. 2001; 127: 949-962Crossref PubMed Scopus (186) Google Scholar). AtbZIP60 and AtbZIP28 have been described as ER stress-induced leucine zipper (bZIP) transcription factor genes that are anchored to the ER membrane under normal conditions and may serve as ER stress sensors and transducers (9Iwata Y. Koizumi N. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 5280-5285Crossref PubMed Scopus (266) Google Scholar, 10Liu J.-X. Srivastava R. Che P. Howell S.H. Plant Cell. 2007; 19: 4111-4119Crossref PubMed Scopus (323) Google Scholar). Upon sensing the ER stress, AtbZIP28 is proteolytically released from the membrane and translocated to the nucleus by a mechanism that is predicted to be similar to that acting on mammalian ATF6 transducer (10Liu J.-X. Srivastava R. Che P. Howell S.H. Plant Cell. 2007; 19: 4111-4119Crossref PubMed Scopus (323) Google Scholar). Expression of a truncated form of either AtbZIP28 or AtbZIP60, harboring the bZIP domain, up-regulates UPR target genes under normal conditions (9Iwata Y. Koizumi N. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 5280-5285Crossref PubMed Scopus (266) Google Scholar, 10Liu J.-X. Srivastava R. Che P. Howell S.H. Plant Cell. 2007; 19: 4111-4119Crossref PubMed Scopus (323) Google Scholar). The UPR up-regulated chaperone BiP (binding protein) is central to this cytoprotective response as the indirect sensor of alterations in the ER environment. In addition to this role as molecular chaperone, in mammalian cells, BiP has been shown to regulate the UPR by controlling the activation status of the three transducers, IRE1, PERK, and ATF6 (11Malhotra J.D. Kaufman R.J. Semin. Cell Dev. Biol. 2007; 18: 716-731Crossref PubMed Scopus (759) Google Scholar). Under normal conditions, the luminal domains of these sensors are occupied with BiP, which is recruited by unfolded proteins upon ER stress. The dissociation of BiP promotes oligomerization and phosphorylation of IRE1 and PERK, as well as relocalization of ATF6 to the Golgi where its transcriptional domain is proteolytically released from the membrane into the nucleus. Although the UPR has not been extensively characterized in plants, conserved aspects between mammalian and plant UPR include its negative regulation by BiP, possibly through interaction with the putative proximal sensors, and the BiP cytoprotective role (12Leborgne-Castel N. Jelitto-Van Dooren E. Crofts A.J. Denecke J. Plant Cell. 1999; 11: 459-469Crossref PubMed Scopus (152) Google Scholar). In fact, we have previously demonstrated that BiP confers tolerance to water deficit in transgenic plants (13Alvim F.C. Carolino S.M.B. Cascardo J.C.M. Nunes C.C. Martinez C.A. Otoni W.C. Fontes E.P.B. Plant Physiol. 2001; 126: 1042-1054Crossref PubMed Scopus (185) Google Scholar). Constant challenges by adverse conditions and environmental stresses pose major constraints for development, growth, and productivity of plants. Our knowledge about stress-specific adaptive responses and cross-talk between signaling cascades has advanced considerably with genome-wide analyses and expression-profiling studies in different plant species under different stress conditions (14Denekamp M. Smeekens S.C. Plant Physiol. 2003; 132: 1415-1423Crossref PubMed Scopus (158) Google Scholar, 15Kreps J.A. Wu Y.J. Chang H.S. Zhu T. Wang X. Harper J.F. Plant Physiol. 2002; 130: 2129-2141Crossref PubMed Scopus (1190) Google Scholar, 16Seki M. Narusaka M. Ishida J. Nanjo T. Fujita M. Oono Y. Kamiya A. Nakajima M. Enju A. Sakurai T. Satou M. Akiyama K. Taji T. Yamaguchi-Shinozaki K. Carninci P. Kawai J. Hayashizaki Y. Shinozaki K. Plant J. 2002; 31: 279-292Crossref PubMed Scopus (1613) Google Scholar). A common theme that has emerged is that plants transduce environmental signals through integrated networks between different stress-induced adaptive responses. Despite the potential of ER stress response to accommodate adaptive pathways, its integration with environmental-induced responses is poorly understood in plants. Recently, we performed global expression profiling on soybean leaves exposed to polyethylene glycol (PEG) treatment or to UPR inducers to identify integrated networks between osmotic and ER stress-induced adaptive responses (4Irsigler A.S. Costa M.D. Zhang P. Reis P.A.B. Dewey R.E. Boston R.S. Fontes E.P.B. BMC Genomics. 2007; 8: 431Crossref PubMed Scopus (84) Google Scholar). In addition to uncovering specific responses to ER stress and osmotically regulated changes, a small proportion (5.5%) of the up-regulated genes represented a shared response that seemed to integrate the two signaling pathways. These co-regulated genes had similar induction kinetics and a synergistic response to the combination of osmotic- and ER stress-inducing treatments. Thus, they were considered to be downstream targets of the integrating pathway. Two ESTs (N-richI and N-richII), which showed the strongest synergistic induction, were homologous to genes encoding asparagine-rich proteins that have a plant-specific development and cell death (DCD) domain. Here we investigated the possibility that the integrated pathway might transduce a programmed cell death (PCD) signal generated by ER and osmotic stress. We demonstrated that induction of target genes, such as N-richI and N-richII ESTs, by ER stress-inducing agents occurs via a pathway distinct from the UPR. We also found that the N-rich proteins are critical mediators of osmotic- and ER stress-induced cell death in plants. Plant Growth, Soybean Suspension Cells, and Stress Treatments—Soybean (Glycine max) seeds (cultivar Conquista) were germinated in soil and grown under greenhouse conditions (avg: 21 °C, max: 31 °C, min: 15 °C) under natural conditions of light, 70% relative humidity, and approximately equal day and night length. Two weeks after germination, the seedlings were transferred to a 2-ml 10 μg/ml tunicamycin (Sigma) solution (DMSO, as control). After 12 and 24 h of treatment, the leaves were harvested, immediately frozen in liquid N2, and stored at -80 °C until use. Alternatively, the aerial portions of 3-week-old plants were excised below the cotyledons and directly placed into 15 ml of 10% (w/v) polyethylene glycol (PEG; MW 8000, Sigma), 10 μg/ml tunicamycin (Sigma), or 50 mm l-azetidine-2-carboxylic acid (AZC, Sigma) solutions. The first trifoliate leaves were harvested after 4, 10, or 16 h of PEG and tunicamycin treatments, then immediately frozen in liquid N2, and stored at -80 °C until use. Each stress treatment and RNA extraction were replicated in three independent experiments. Cotyledons cells from the soybean variety Conquista were cultured as described previously (17Cascardo J.C.M. Almeida R.S. Buzeli R.A.A. Carolino S.M.B. Otoni W.C. Fontes E.P.B. J. Biol. Chem. 2000; 275: 14494-14500Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). Cells were subcultured every 10 days by diluting the culture 1:10 in fresh MS medium. All treatments were performed on 5-day-old subcultures. Tunicamycin was added to cultures by dilution of a 5 mg/ml stock in DMSO into normal growth medium to 10 μg/ml and incubated for the intervals indicated in the figure legends. For PEG-induced dehydration, the cells were washed and then cultured with normal growth medium containing 10% (w/v) PEG-8000 for the indicated intervals. Suspension cells were directly treated with 0.5 μg/ml cycloheximide, 10 μm BAP (6-benzylaminopurine), and 10 μm zeatin for the intervals indicated in the figure legends. After treatments, the cells were filtrated under vacuum, washed with 0.25 m NaCl, and immediately frozen in liquid N2. Rapid Amplification of 3′-cDNA Ends (3′-RACE) and NRP-B cDNA Cloning—3′-RACE was performed using the GeneRacer kit (Invitrogen). Total RNA isolated from PEG-treated soybean leaves was used for reverse transcription, and an N-richI EST-specific primer (FwNRich1, TACAGGCATCCAATTTGGCGAACC) and oligo dT primer from the kit were used in the polymerase chain reaction. The amplified fragment was cloned in pCR4 to generate pCR4-NRPB, which harbors the full-length NRP-B cDNA. Plasmid Construction—For transient expression in protoplasts, NRP-B and NRP-A (gi:57898928) cDNAs were amplified and inserted into the BglII and EcoRI sites of pMON921 (18Fontes E.P.B. Eagle P.A. Sipe P.S. Luckow V.A. Hanley-Bowdoin L. J. Biol. Chem. 1994; 269: 8459-8465Abstract Full Text PDF PubMed Google Scholar). The resulting clones pUFV967 and pUFV849 contain NRP-B or NRP-A cDNAs, respectively, under the control of the cauliflower mosaic virus 35S promoter and the 3′-end of the pea E9 rbcS gene. For agroinfiltration in tobacco leaves, NRP-A and NRP-B cDNAs were amplified by PCR and introduced by recombination into the entry vector pCR8/GW/TOPO (Invitrogen) to generate pUFV908 and pUFV874, respectively. NRP-A and NRP-B cDNAs were then transferred by recombination to the plant transformation binary vector 35S-YFP-cassetteA-Nos-pCAMBIA1300 yielding pUFV937 (35S:NRP-B) and pUFV938 (35S:NRP-A), which contain NRP-B or NRP-A cDNA, respectively, under the control of the 35S promoter and 3′-ends of nos. For subcellular localization, NRP-A and NRP-B cDNAs were amplified by PCR with appropriate extensions and introduced by recombination into the entry vector pDONR201 (Invitrogen) and then transferred to the binary vector pK7FWG2 to generate pK7F-NRP-B and pK7F-NRP-A, which contain the GFP gene fused in-frame after the last codon of the respective cDNAs. The U16322 plasmid harboring a full-length NIG (NSP-interacting GTPase, Ref. 19Carvalho, C. M., Fontenelle, M. R., Florentino, L. H., Santos, A. A., Zerbini, F. M., and Fontes, E. P. B. (2008) Plant J., in pressGoogle Scholar). cDNA was obtained from the Arabidopsis Biological Resource Center (ABRC) and used as a control. For this purpose, the full-length NIG cDNA was amplified by PCR from U16322 cDNA, cloned into pDONR201 and then transferred to the binary vector pK7WG2 to obtain pK7-NIG, which contains NIG cDNA under the control of the CaMV 35S promoter. Real-time RT-PCR Analysis—For quantitative RT-PCR, total RNA was extracted from frozen leaves or cells with TRIzol (Invitrogen) according to the instructions from the manufacturer. The RNA was treated with 2 units of RNase-free DNase (Promega) and further purified through RNeasy Mini kit (Qiagen) columns. First-strand cDNA was synthesized from 4 μg of total RNA using oligo-dT(18) and Transcriptase Reversa M-MLV (Invitrogen), according to the manufacturer's instructions. Real-time RT-PCR reactions were performed on an ABI7500 instrument (Applied Biosystems), using SYBR® Green PCR Master Mix (Applied Biosystems). The amplification reactions were performed as follows: 2 min at 50 °C, 10 min at 95 °C, and 40 cycles of 94 °C for 15 s and 60 °C for 1 min. To confirm quality and primer specificity, we verified the size of amplification products after electrophoresis through a 1.5% agarose gel, and analyzed the Tm (melting temperature) of amplification products in a dissociation curve, performed by the ABI7500 instrument. The primers used are listed in supplemental Table S1. For quantitation of gene expression in soybean protoplasts and seedlings, we used RNA helicase (4Irsigler A.S. Costa M.D. Zhang P. Reis P.A.B. Dewey R.E. Boston R.S. Fontes E.P.B. BMC Genomics. 2007; 8: 431Crossref PubMed Scopus (84) Google Scholar) as the endogenous control gene for data normalization in real-time RT-PCR analysis. For quantitation of gene expression in tobacco leaves, we used actin as a control gene. Fold variation, which is based on the comparison of the target gene expression (normalized to the endogenous control) between experimental and control samples, was quantified using the comparative Ct method: 2−^ - (ΔCtTreatment - ΔCtControl). The absolute gene expression was quantified using the 2-ΔCT method, and values were normalized to the endogenous control. Soybean Transformation—A plant expression cassette containing the BiPD gene was constructed by insertion of the 2.0-kb XbaI cDNA insert of pUFV24 (17Cascardo J.C.M. Almeida R.S. Buzeli R.A.A. Carolino S.M.B. Otoni W.C. Fontes E.P.B. J. Biol. Chem. 2000; 275: 14494-14500Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) into the pBS35SdAMVNOS2 vector. The resulting clone pBS35SdAMVNOS2-BiP contains the BiP cDNA under control of a duplicated cauliflower mosaic virus 35S promoter with an enhancer region from the alfalfa mosaic virus and the polyadenylation signal of the nos gene. The Arabidopsis thaliana ahas gene (that confers tolerance to the herbicide imazapyr) was removed from the vector pAC321 (20Aragão F.J.L. Sarokin L. Vianna G.R. Rech E.L. Theor. Appl. Genet. 2000; 101: 1-6Crossref Scopus (111) Google Scholar) with XbaI and inserted into the vector pFACM1 to generate pFACMahas. The BiPD expression cassette was released with SalI and NotI from pBS35SdAMVNOS2-BiP and cloned into the vector pFACMahasm to yield pahasBip. The vector pahasBip was used to transform soybean (cv. Conquista) as previously described (20Aragão F.J.L. Sarokin L. Vianna G.R. Rech E.L. Theor. Appl. Genet. 2000; 101: 1-6Crossref Scopus (111) Google Scholar). Primary transformants were selected by PCR using the primers bipsoy235 (5′-GAGAGACTAATTGGAGAGGCTG-3′) and bipsoy645c (5′-ATAGGCAATGGCAGCAGCAGTG-3′), which amplify a 410-bp sequence from the BiPD gene coding region and cover an intron region from the genomic BiPD sequence. Segregation analyses of independently transformed soybean lines were performed by PCR, and accumulation of BiP was monitored in each subsequent generation by immunoblotting. RNA Gel Blotting—Total RNA was extracted from frozen leaves of control and tunicamycin-treated wild type and soybean transgenic seedlings, which were treated with tunicamycin or control DMSO for 24 h, with TRIzol (Invitrogen) according to the instructions from the manufacturer. Equal amounts of total RNA were denatured by formamide/formaldehyde and resolved on 1% agarose gels containing formaldehyde. The RNA was transferred to a nylon membrane by capillary transfer and immobilized by UV cross-linking (Stratalinker, Stratagene). The membrane was hybridized at high stringency conditions using the soyBiPD cDNA (17Cascardo J.C.M. Almeida R.S. Buzeli R.A.A. Carolino S.M.B. Otoni W.C. Fontes E.P.B. J. Biol. Chem. 2000; 275: 14494-14500Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) as probe. The hybridization probe was radiolabeled with [α-32P]dCTP by random primed labeling (Amersham Biosciences). Autoradiography was performed at -80 °C using a Lightning-Plus intensifying screen. The amount of RNA and the integrity of ribosomal RNA were monitored by rehybridizing the membranes with an 18 S rDNA probe. Immunoblot Analysis—Total protein was extracted from control and tunicamycin-treated leaves of wild-type and soybean transgenic seedlings as previously described (17Cascardo J.C.M. Almeida R.S. Buzeli R.A.A. Carolino S.M.B. Otoni W.C. Fontes E.P.B. J. Biol. Chem. 2000; 275: 14494-14500Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). SDS-PAGE was carried out, and the proteins were transferred from 10% SDS-polyacrylamide gels to nitrocellulose membranes by electroblotting. Immunoblot analyses were performed using polyclonal anti-BiP-carboxyl antibodies (2Buzeli R.A.A. Cascardo J.C.M. Rodrigues L.A.Z. Andrade M.O. Loureiro M.E. Otoni W.C. Fontes E.P.B. Plant Mol. Biol. 2002; 50: 757-771Crossref PubMed Scopus (37) Google Scholar), an anti-calreticulin serum (21Pagny S. Cabanes-Macheteau M. Gillikin J. Leborgne-Castel N. Lerouge P. Boston R.S. Faye L. Gomord V. Plant Cell. 2000; 12: 739-755Crossref PubMed Scopus (96) Google Scholar) or an anti-GmSBP2 serum (22Delú-Filho N. Pirovani C.P. Pedra J.H.F. Matrangolo F.S.V. Macêdo J.N.A. Otoni W.C. Fontes E.P.B. Plant Physiol. Biochem. 2000; 38 (353): 353Crossref Scopus (20) Google Scholar) at a 1:1000 dilution and a goat anti-rabbit IgG alkaline phosphatase conjugate (Sigma) at a 1:5000 dilution. Alkaline phosphatase activity was assayed using 5-bromo-4-chloro-3-indolyl phosphate (Sigma) and p-nitro blue tetrazolium (Sigma). Transient Expression in Soybean Protoplasts—Protoplasts were prepared from soybean suspension cells as essentially described by Fontes et al. (18Fontes E.P.B. Eagle P.A. Sipe P.S. Luckow V.A. Hanley-Bowdoin L. J. Biol. Chem. 1994; 269: 8459-8465Abstract Full Text PDF PubMed Google Scholar). The protoplasts were isolated 5 days after subculture by digestion for 3 h, under agitation at 40 rpm, with 0.5% cellulase, 0,5% macerozyme R-10, 0.1% pectolyase Y23, 0.6 m mannitol, 20 mm MES, pH 5.5. The extent of digestion was monitored by examining the cells microscopically at each 30-min interval. After filtration through nylon mesh of 65 μm, protoplasts were recovered by centrifugation, resuspended in 2 ml of 0.6 m mannitol, 20 mm MES, pH 5.5, separated by centrifugation in a sucrose gradient (20% (w/v) sucrose, 0.6 m mannitol, 20 mm MES, pH 5.5), and diluted into 2 ml of electroporation buffer (25 mm Hepes-KOH, pH 7.2, 10 mm KCl, 15 mm MgCl2, 0.6 m mannitol). Transient expression assays were performed by electroporation (250 V, 250 μF) of 10 μg of expression cassette DNA, and 30 μg of sheared salmon sperm DNA into 2 × 105 - 5 × 106 protoplasts in a final volume of 0.8 ml. Protoplasts were diluted into 8 ml of MS medium supplemented with 0.2 mg/ml 2,4-dichlorophenoxyacetic acid and 0.6 m mannitol, pH 5.5. After 36 h of incubation in the dark, the protoplasts were washed with 0.6 m mannitol, 20 mm MES, pH 5.5, and frozen in liquid N2 until use. Caspase-3-like Activity and in Situ Labeling of DNA Fragmentation (TUNEL)—Total protein was extracted from soybean cells 36-h post-electroporation. Caspase-3-like activity was determined using the ApoAlert® Caspase-3 Colorimetric Assay kit (Clontech) according to the manufacturer's instructions. The substrate was DEVD-pNA, and the inhibitor of caspase-3 activity was the synthetic tetrapeptide DEVD-fmk supplied by the kit. Free 3′-OH in the DNA was labeled by the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay using the ApoAlert DNA Fragmentation Assay kit (Clontech) as instructed by the manufacturer. Samples were observed with a Zeiss LSM 410 inverted confocal laser scanning microscope fitted with the configuration: excitation at 488 nm and emission at 515 nm. As a positive control, samples were treated with DNase1. Transient Overexpression in Nicotiana tabacum by Agrobacterium Infiltration—N. tabacum plants were grown in a greenhouse with natural day length illumination. Three weeks after germination, the plants were transferred to a growth chamber at 21 °C with a 16-hour light and 8-hour dark cycle. Agrobacterium infiltration was performed in the leaves of N. tabacum with Agrobacterium strain GV3101 carrying pUFV937 (35S: NRP-B) or pUFV938 (35S:NRP-A), NIG (35S:NIG), rpl10 (35S: rpL10) as previously described (23Batoko H. Zheng H.Q. Hawes C. Moore I. Plant Cell. 2000; 12: 2201-2218Crossref PubMed Scopus (462) Google Scholar). Subcellular Localization of Proteins—For subcellular localization of proteins, N. tabacun leaves were agroinoculated with pK7F-NRP-B and pK7F-NRP-A. About 72-h post-agroinfiltration, 1-cm2 leaf explants were excised incubated with 0.6 m mannitol for 10 min, and GFP fluorescence patterns were examined in epidermal cells with ×40 oil immersion objective and a Zeiss LSM510 META inverted laser scanning microscope equipped with an argon laser as excitation source. For imaging GFP, the 455-nm excitation line and the 500–530-nm band pass filter were used. The pinhole was usually set to give a 1–1.5-μm optical slice. Post-acquisition image processing was done using the LSM 5 Browser software (Carl-Zeiss) and Adobe Photoshop (Adobe Systems). Microsomal fractions were prepared from agroinoculated leaves, as described (24Pirovani C.P. Macêdo J.N.A. Contim L.A.S. Matrangolo F.S.V. Loureiro M.E. Fontes E.P.B. Eur. J. Biochem. 2002; 269: 3998-4008Crossref PubMed Scopus (16) Google Scholar), and immunoblotted with an anti-GFP serum. Determination of Chlorophyll Content and Lipid Peroxidation—Total chlorophyll content was determined spectrophotometrically at 663 and 646 nm after quantitative extraction from individual leaves with 80% (v/v) acetone in the presence of ∼1 mg of Na2CO3 (25Lichtenthaler H.K. Methods Enzymol. 1987; 148: 350-382Crossref Scopus (8704) Google Scholar). The extent of lipid peroxidation in leaves was estimated by measuring the amount of MDA (malondialdehyde, a decomposition product of the oxidation of polyunsaturated fatty acids). MDA content was determined by the reaction of thiobarbituric acid (TBA) as described by Cakmak and Horst (26Cakmak I. Horst W.J. Physiol. Plantarum. 1991; 83: 463-468Crossref Scopus (1301) Google Scholar). Ethylene Determination—For ethylene measurements as a function of NRP-A and NRP-B expression, whole leaves of 3-week-old tobacco plants were agroinoculated with pK7-NRP-A, pK7-NRP-B, or control binary vector. Agroinfiltrated tobacco plants were placed in 25-ml flasks containing a Petri dish with 3 ml of 1 m HgClO4·4H2O and sealed with rubber serum caps. After 5 days, the solution was collected into a sealed assay tube, and ethylene was released with the injection of 1 ml of 1 m KCl. 1 ml of gas was collected with a syringe, and ethylene was measured on a model 5840A gas chromatography system (Hewlett-Packard Canada Ltda) equipped with a flame ionization detector. A Porapak N (80–100 mesh, 100 cm × 6 mm) column was used at 60 °C. The injection port and detector temperatures were 100 and 150 °C, respectively. The flow of nitrogen, air, and hydrogen was at 30, 130, and 20 ml min-1, respectively. N-richI and N-richII ESTs Are Both Encoded by the NRP-B Gene—The N-richI and N-richII ESTs correspond to different regions of a contiguous soybean genomic sequence (scaffold_78:2951370.2949024). To determine if both ESTs corresponded to the same mRNAs, we obtained the full sequences of N-richI and N-richII cDNAs through RACE. A comparison of the cDNA sequences revealed that these ESTs represented the same gene which we designated NRP-B (N-rich protein B; supplemental Fig. S1A). The deduced NRP-B protein has an estimated Mr of 37092 and pI 7.05 and is most closely related to the previously identified NRP from soybean (27Ludwig A.A. Tenhaken R. Eur. J. Plant Pathol. 2001; 107: 323-336Crossref Scopus (24) Google Scholar), here designated NRP-A. The two NRPs share a highly conserved C-terminal DCD domain in addition to a high content of asparagine residues at their more divergent N termini. This structural organization places NRP-A and NRP-B in the subgroup I of plant-specific DCD-containing proteins (28Tenhaken R. Doerks T. Bork P. BMC Bioinformatics. 2005; 6: 169Crossref PubMed Scopus (33) Google Scholar). Analysis of several subgroup I DCD domain-containing proteins by ClustalW showed that NRP-A and NRP-B form a subgroup with the Arabidopsis protein of unknown function encoded by At5g42050 (gi 231 18422167, supplemental Fig. S1B). An examination of available microarray data indicated that the At5g42050 locus is induced by cycloheximide, osmotic stress, salt stress, and during senescence (GeneInvestigator). Integration of ER Stress and Osmotic Signals Leads to Maximal Express
