@article{tran_zhang_lackey_maxwell_2005, title={Conserved spacing between the box C/D and C '/D ' RNPs of the archaeal box C/D sRNP complex is required for efficient 2 '-O-methylation of target RNAs}, volume={11}, ISSN={["1469-9001"]}, DOI={10.1261/rna.7223405}, abstractNote={RNA-guided nucleotide modification complexes direct the post-transcriptional nucleotide modification of both archaeal and eukaryotic RNAs. We have previously demonstrated that efficient 2′-O-methylation activity guided by an in vitro reconstituted archaeal box C/D sRNP requires juxtaposed box C/D and C′/D′ RNP complexes. In these experiments, we investigate the importance of spatially positioning the box C/D and C′/D′ RNPs within the sRNP complex for nucleotide modification. Initial sequence analysis of 245 archaeal box C/D sRNAs from both Eukyarchaeota and Crenarchaeota kingdoms revealed highly conserved spacing between the box C/D and C′/D′ RNA motifs. Distances between boxes C to D′ and C′ to D (D′ and D spacers, respectively) exhibit highly constrained lengths of 12 nucleotides (nt). Methanocaldococcus jannaschii sR8 sRNA, a model box C/D sRNA with D and D′ spacers of 12 nt, was mutated to alter the distance between the two RNA motifs. sRNAs with longer or shorter spacer regions could still form sRNPs by associating with box C/D core proteins, L7, Nop56/58, and fibrillarin, comparable to wild-type sR8. However, these reconstituted box C/D sRNP complexes were severely deficient in methylation activity. Alteration of the D and D′ spacer lengths disrupted the guided methylation activity of both the box C/D and C′/D′ RNP complexes. When only one spacer region was altered, methylation activity of the corresponding RNP was lost. Collectively, these results demonstrate the importance of box C/D and C′/D′ RNP positioning for preservation of critical inter-RNP interactions required for efficient box C/D sRNP-guided nucleotide methylation.}, number={3}, journal={RNA}, author={Tran, E and Zhang, XX and Lackey, L and Maxwell, ES}, year={2005}, month={Mar}, pages={285–293} }
 @article{suryadi_tran_maxwell_brown_2005, title={The crystal structure of the Methanocaldococcus jannaschii multifunctional L7Ae RNA-binding protein reveals an induced-fit interaction with the box C/D RNAs}, volume={44}, ISSN={["0006-2960"]}, DOI={10.1021/bi050568q}, abstractNote={Archaeal ribosomal protein L7Ae is a multifunctional RNA-binding protein that recognizes the K-turn motif in ribosomal, box H/ACA, and box C/D sRNAs. The crystal structure of Methanocaldococcus jannaschii L7Ae has been determined to 1.45 A, and L7Ae's amino acid composition, evolutionary conservation, functional characteristics, and structural details have been analyzed. Comparison of the L7Ae structure to those of a number of related proteins with diverse functions has revealed significant structural homology which suggests that this protein fold is an ancient RNA-binding motif. Notably, the free M. jannaschii L7Ae structure is essentially identical to that with RNA bound, suggesting that RNA binding occurs through an induced-fit interaction. Circular dichroism experiments show that box C/D and C'/D' RNA motifs undergo conformational changes when magnesium or the L7Ae protein is added, corroborating the induced-fit model for L7Ae-box C/D RNA interactions.}, number={28}, journal={BIOCHEMISTRY}, author={Suryadi, J and Tran, EJ and Maxwell, ES and Brown, BA}, year={2005}, month={Jul}, pages={9657–9672} }
 @article{tran_brown_maxwell_2004, title={Evolutionary origins of the RNA-guided nucleotide-modification complexes: from the primitive translation apparatus?}, volume={29}, ISSN={0968-0004}, url={http://dx.doi.org/10.1016/j.tibs.2004.05.001}, DOI={10.1016/j.tibs.2004.05.001}, abstractNote={Eukarya and Archaea possess scores of RNA-guided nucleotide-modification complexes that target specific ribonucleotides for 2′-O-methylation or pseudouridylation. Recent characterization of these RNA-modification machines has yielded striking results with implications for their evolutionary origins: the two main classes of nucleotide-modification complex in Archaea share a common ribonucleoprotein (RNP) core element that has evolved from a progenitor RNP. The fact that this common RNP element is also found in ribosomes suggests that the origin of the progenitor RNP lies in the primitive translation apparatus. Thus, the trans-acting, RNA-guided nucleotide-modification complexes of the modern RNP world seem to have evolved from cis-acting RNA or RNP elements contained in the primitive translation apparatus during the transition from the ancient RNA world to the modern RNP world.}, number={7}, journal={Trends in Biochemical Sciences}, publisher={Elsevier BV}, author={Tran, Elizabeth and Brown, James and Maxwell, E.Stuart}, year={2004}, month={Jul}, pages={343–350} }
 @article{sanjay_singh_gurha_tran_maxwell_gupta_2004, title={Sequential 2 '-O-methylation of archaeal pre-tRNA(Trp) nucleotides is guided by the intron-encoded but trans-acting box c/D ribonucleoprotein of pre-tRNA}, volume={279}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M408868200}, abstractNote={Haloferax volcanii pre-tRNATrp processing requires box C/D ribonucleoprotein (RNP)-guided 2′-O-methylation of nucleotides C34 and U39 followed by intron excision. Positioning of the box C/D guide RNA within the intron of this pre-tRNA led to the assumption that nucleotide methylation is guided by the cis-positioned box C/D RNPs. We have now investigated the mechanism of 2′-O-methylation for the H. volcanii pre-tRNATrpin vitro by assembling methylation-competent box C/D RNPs on both the pre-tRNA and the excised intron (both linear and circular forms) using Methanocaldococcus jannaschii box C/D RNP core proteins. With both kinetic studies and single nucleotide substitutions of target and guide nucleotides, we now demonstrate that pre-tRNA methylation is guided in trans by the intron-encoded box C/D RNPs positioned in either another pre-tRNATrp or in the excised intron. Methylation by in vitro assembled RNPs prefers but does not absolutely require Watson-Crick pairing between the guide and target nucleotides. We also demonstrate for the first time that methylation of two nucleotides guided by a single box C/D RNA is sequential, that is, box C′/D′ RNP-guided U39 methylation first requires box C/D RNP-guided methylation of C34. Methylation of the two nucleotides of exogenous pre-tRNATrp added to an H. volcanii cell extract also occurs sequentially and is also accomplished in trans using RNPs that pre-exist in the extract. Thus, this trans mechanism is analogous to eukaryal pre-rRNA 2′-O-methylation guided by intron-encoded but trans-acting box C/D small nucleolar RNPs. This trans mechanism could explain the observed accumulation of the excised H. volcanii pre-tRNATrp intron in vivo. A trans mechanism would also eliminate the obligatory refolding of the pre-tRNA that would be required to carry out two cis-methylation reactions before pre-tRNA splicing. Haloferax volcanii pre-tRNATrp processing requires box C/D ribonucleoprotein (RNP)-guided 2′-O-methylation of nucleotides C34 and U39 followed by intron excision. Positioning of the box C/D guide RNA within the intron of this pre-tRNA led to the assumption that nucleotide methylation is guided by the cis-positioned box C/D RNPs. We have now investigated the mechanism of 2′-O-methylation for the H. volcanii pre-tRNATrpin vitro by assembling methylation-competent box C/D RNPs on both the pre-tRNA and the excised intron (both linear and circular forms) using Methanocaldococcus jannaschii box C/D RNP core proteins. With both kinetic studies and single nucleotide substitutions of target and guide nucleotides, we now demonstrate that pre-tRNA methylation is guided in trans by the intron-encoded box C/D RNPs positioned in either another pre-tRNATrp or in the excised intron. Methylation by in vitro assembled RNPs prefers but does not absolutely require Watson-Crick pairing between the guide and target nucleotides. We also demonstrate for the first time that methylation of two nucleotides guided by a single box C/D RNA is sequential, that is, box C′/D′ RNP-guided U39 methylation first requires box C/D RNP-guided methylation of C34. Methylation of the two nucleotides of exogenous pre-tRNATrp added to an H. volcanii cell extract also occurs sequentially and is also accomplished in trans using RNPs that pre-exist in the extract. Thus, this trans mechanism is analogous to eukaryal pre-rRNA 2′-O-methylation guided by intron-encoded but trans-acting box C/D small nucleolar RNPs. This trans mechanism could explain the observed accumulation of the excised H. volcanii pre-tRNATrp intron in vivo. A trans mechanism would also eliminate the obligatory refolding of the pre-tRNA that would be required to carry out two cis-methylation reactions before pre-tRNA splicing. Eukaryotic cells possess numerous small nucleolar RNAs (snoRNAs), 1The abbreviations used are: sno, small nucleolar; sRNA, sno-like RNA; sRNP, sno-like RNP; RNP, ribonucleoprotein; nt, nucleotide; AdoMet, S-adenosylmethionine.1The abbreviations used are: sno, small nucleolar; sRNA, sno-like RNA; sRNP, sno-like RNP; RNP, ribonucleoprotein; nt, nucleotide; AdoMet, S-adenosylmethionine. the primary function of which is to guide the 2′-O-methylation and pseudouridylation of specific nucleotides within pre-rRNA and other target RNAs (1Maxwell E.S. Fournier M.J. Annu. Rev. Biochem. 1995; 64: 897-934Crossref PubMed Scopus (536) Google Scholar, 2Weinstein L.B. Steitz J.A. Curr. Opin. Cell Biol. 1999; 11: 378-384Crossref PubMed Scopus (249) Google Scholar, 3Kiss T. Cell. 2002; 109: 145-148Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar, 4Filipowicz W. Pogacic V. Curr. Opin. Cell Biol. 2002; 14: 319-327Crossref PubMed Scopus (320) Google Scholar, 5Terns M.P. Terns R.M. Gene Expr. 2002; 10: 17-39PubMed Google Scholar, 6Bachellerie J.P. Cavaille J. Huttenhofer A. Biochimie (Paris). 2002; 84: 775-790Crossref PubMed Scopus (507) Google Scholar, 7Decatur W.A. Fournier M.J. J. Biol. Chem. 2003; 278: 695-698Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). The box C/D snoRNAs direct 2′-O-methylation of specific nucleotides within target RNAs. Members of this snoRNA family are defined by conserved box C (RUGAUGA) and D (CUGA) consensus sequences located in the 5′ and 3′ termini, respectively, of the snoRNA. Often, imperfect copies called C′ and D′ boxes are found internally. Regions of 10–21 nucleotides located upstream of boxes D and D′ function as guide sequences, pairing with those regions in rRNA containing the nucleotide to be modified. The nucleotide sugar to be methylated resides within the snoRNA-rRNA duplex and is located 5 nucleotides upstream of box D or D′.Box C/D RNAs are also found in Archaea, in which they are designated snoRNA-like RNAs or sRNAs (8Omer A.D. Lowe T.M. Russell A.G. Ebhardt H. Eddy S.R. Dennis P.P. Science. 2000; 288: 517-522Crossref PubMed Scopus (275) Google Scholar, 9Gaspin C. Cavaille J. Erauso G. Bachellerie J.P. J. Mol. Biol. 2000; 297: 895-906Crossref PubMed Scopus (151) Google Scholar, 10Dennis P.P. Omer A. Lowe T. Mol. Microbiol. 2001; 40: 509-519Crossref PubMed Scopus (112) Google Scholar, 11Tang T.H. Bachellerie J.P. Rozhdestvensky T. Bortolin M.L. Huber H. Drungowski M. Elge T. Brosius J. Huttenhofer A. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 7536-7541Crossref PubMed Scopus (290) Google Scholar). Archaeal sRNAs are generally smaller than the eukaryal snoRNAs and typically possess C′ and D′ boxes that vary little from the terminal box C and D sequences. The primary function of the archaeal box C/D sRNAs also is to guide the 2′-O-methylation of targeted nucleotides, and their mechanism of nucleotide modification is analogous to the eukaryal snoRNAs.Both the eukaryal and archaeal box C/D RNAs are bound to core proteins to establish snoRNP and sRNP complexes, respectively. Four snoRNP core proteins are bound to the box C/D snoRNAs: fibrillarin (Nop1p), Nop56p, Nop58p (Nop5p), and the 15.5-kDa (Snu13p) protein (4Filipowicz W. Pogacic V. Curr. Opin. Cell Biol. 2002; 14: 319-327Crossref PubMed Scopus (320) Google Scholar, 5Terns M.P. Terns R.M. Gene Expr. 2002; 10: 17-39PubMed Google Scholar, 6Bachellerie J.P. Cavaille J. Huttenhofer A. Biochimie (Paris). 2002; 84: 775-790Crossref PubMed Scopus (507) Google Scholar, 7Decatur W.A. Fournier M.J. J. Biol. Chem. 2003; 278: 695-698Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). The methylation activity resides in the proteins of the snoRNP, with fibrillarin functioning as the methyltransferase. The differential distribution of the 15.5-kDa Nop56 and Nop58 proteins on the box C/D and C′/D′ motifs establishes an asymmetric snoRNP complex (12Cahill N.M. Friend K. Speckmann W. Li Z.H. Terns R.M. Terns M.P. Steitz J.A. EMBO J. 2002; 21: 3816-3828Crossref PubMed Scopus (94) Google Scholar, 13Szewczak L.B. DeGregorio S.J. Strobel S.A. Steitz J.A. Chem. Biol. 2002; 9: 1095-1107Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). The archaeal box C/D sRNP complex possesses three core proteins. Ribosomal protein L7Ae (the archaeal homolog of the eukaryal 15.5-kDa protein), afibrillarin, and aNop5p (a single homolog of eukaryal Nop56p and Nop58p) bind both the terminal C/D and internal C′/D′ RNA motifs to establish a symmetrical RNP complex (4Filipowicz W. Pogacic V. Curr. Opin. Cell Biol. 2002; 14: 319-327Crossref PubMed Scopus (320) Google Scholar, 5Terns M.P. Terns R.M. Gene Expr. 2002; 10: 17-39PubMed Google Scholar, 14Newman D.R. Kuhn J.F. Shanab G.M. Maxwell E.S. RNA (N. Y.). 2000; 6: 861-879Crossref PubMed Scopus (111) Google Scholar, 15King T.H. Decatur W.A. Bertrand E. Maxwell E.S. Fournier M.J. Mol. Cell. Biol. 2001; 21: 7731-7746Crossref PubMed Scopus (98) Google Scholar, 16Omer A.D. Ziesche S. Ebhardt H. Dennis P.P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5289-5294Crossref PubMed Scopus (158) Google Scholar, 17Omer A.D. Ziesche S. Decatur W.A. Fournier M.J. Dennis P.P. Mol. Microbiol. 2003; 48: 617-629Crossref PubMed Scopus (79) Google Scholar, 18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar, 19Kuhn J.F. Tran E.J. Maxwell E.S. Nucleic Acids Res. 2002; 30: 931-941Crossref PubMed Scopus (129) Google Scholar). In vitro assembly systems using purified archaeal sRNAs and recombinant core proteins have reconstituted enzymatically active box C/D sRNPs (16Omer A.D. Ziesche S. Ebhardt H. Dennis P.P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5289-5294Crossref PubMed Scopus (158) Google Scholar, 18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar, 20Rashid R. Aittaleb M. Chen Q. Spiegel K. Demeler B. Li H. J. Mol. Biol. 2003; 333: 295-306Crossref PubMed Scopus (58) Google Scholar, 21Bortolin M.L. Bachellerie J.P. Clouet-d'Orval B. Nucleic Acids Res. 2003; 31: 6524-6535Crossref PubMed Scopus (42) Google Scholar). Core protein binding follows an order of assembly in which L7Ae binds first followed by aNop5p and then afibrillarin. Efficient catalysis requires that the box C/D and C′/D′ RNPs be juxtaposed within the full-length sRNA (18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar).The tRNATrp of Haloferax volcanii is derived from an intron-containing pre-tRNA (22Daniels C.J. Gupta R. Doolittle W.F. J. Biol. Chem. 1985; 260: 3132-3134Abstract Full Text PDF PubMed Google Scholar) and possesses 2′-O-methylated nucleotides at positions 34 (Cm) and 39 (Um) (where “m” is 2′-O-methylation of the residue) (23Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). Analysis of the pre-tRNATrp structure (see Fig. 1, upper left) revealed that the intron contains box C/D and C′/D′ motifs with guide sequences complementary to the pre-tRNA regions encompassing modified nucleotides Cm34 and Um39, respectively (8Omer A.D. Lowe T.M. Russell A.G. Ebhardt H. Eddy S.R. Dennis P.P. Science. 2000; 288: 517-522Crossref PubMed Scopus (275) Google Scholar, 10Dennis P.P. Omer A. Lowe T. Mol. Microbiol. 2001; 40: 509-519Crossref PubMed Scopus (112) Google Scholar, 24Clouet d'Orval B. Bortolin M.L. Gaspin C. Bachellerie J.P. Nucleic Acids Res. 2001; 29: 4518-4529Crossref PubMed Scopus (122) Google Scholar). Subsequent investigations that involved deleting regions of the pre-tRNA intron and then examining nucleotide methylation in vitro led to the conclusion that these intron-encoded box C/D motifs are indeed responsible for guiding the methylation of pre-tRNATrp nucleotides C34 and U39 (21Bortolin M.L. Bachellerie J.P. Clouet-d'Orval B. Nucleic Acids Res. 2003; 31: 6524-6535Crossref PubMed Scopus (42) Google Scholar, 24Clouet d'Orval B. Bortolin M.L. Gaspin C. Bachellerie J.P. Nucleic Acids Res. 2001; 29: 4518-4529Crossref PubMed Scopus (122) Google Scholar). These investigations also led to the proposal that the box C/D RNPs of the unspliced intron are responsible for guiding in cis the methylation of the pre-tRNATrp nucleotides (21Bortolin M.L. Bachellerie J.P. Clouet-d'Orval B. Nucleic Acids Res. 2003; 31: 6524-6535Crossref PubMed Scopus (42) Google Scholar, 24Clouet d'Orval B. Bortolin M.L. Gaspin C. Bachellerie J.P. Nucleic Acids Res. 2001; 29: 4518-4529Crossref PubMed Scopus (122) Google Scholar). The presence of a cis mechanism for intramolecular methylation would be unique and provide a stark contrast from the box C/D RNP-guided trans-methylation in eukaryal and other archaeal systems. Although box C/D snoRNAs are frequently found in the introns of eukaryal pre-messenger RNAs, they are excised from the host pre-mRNA as snoRNPs before they guide the 2′-O-methylation of target nucleotides.In this investigation, we have assembled in vitro a box C/D sRNP using recombinant Methanocaldococcus jannaschii core proteins L7Ae, aNop5p, and afibrillarin and H. volcanii pre-tRNATrp. This complex is enzymatically active and methylates tRNATrp nucleotides C34 and U39. However, the experiments demonstrated that modification of the pre-tRNA target nucleotides was accomplished in trans using box C/D RNPs assembled in another unspliced pre-tRNA or in the excised intron (both linear and circular). Certain non-Watson-Crick pairings between target and guide nucleotides permitted 2′-O-methylations, although less efficiently. Nucleotide modification was also sequential, that is, modification of U39 guided by the C′/D′ RNP first required methylation of C34 guided by the box C/D RNP. Pre-tRNATrp methylation carried out in an H. volcanii cell extract confirmed the sequential methylation of these two nucleotides guided by trans-acting box C/D RNP complexes already present in the extract. Collectively, these observations indicate that the sequential methylation of the H. volcanii pre-tRNATrp nucleotides guided by the intron-encoded box C/D RNP occurs via an intermolecular or trans mechanism rather than an intramolecular or cis mechanism as previously assumed. This trans mechanism could explain the accumulation of the excised introns of this pre-tRNA in vivo (25Salgia S.R. Singh S.K. Gurha P. Gupta R. RNA (N. Y.). 2003; 9: 319-330Crossref PubMed Scopus (69) Google Scholar).EXPERIMENTAL PROCEDURESDNA Template Construction and Site-directed Mutagenesis—The following DNA oligonucleotide primers were used in PCR-amplification of plasmid pVT9P11 (25Salgia S.R. Singh S.K. Gurha P. Gupta R. RNA (N. Y.). 2003; 9: 319-330Crossref PubMed Scopus (69) Google Scholar) to produce DNA templates for in vitro transcription: 1) TAATACGACTCACTATAGGGGCTGTGGCCAAGC; 2) TGGGGCCGGAGGGATTTGAAC; 3) TCAGTATATCAGCTGGAGTGT; 4) TAATACGACTCACTATAGGCTTGGCGCCCGGGA; and 5) ATCTCCGGTGGGCACCT. Primer pairs 1 and 2, 1 and 3, and 4 and 5 were used to prepare full-length H. volcanii pre-tRNATrp (177 nt), 5′-half pre-tRNA (78 nt), and intron RNA (102 nt), respectively. Specific nucleotide mutations at pre-tRNA target or guide positions C34G (C at position 34 mutated to G), C34U, C34A, G117C, G117A, G117U, U39A, and A70U were introduced into the pVT9P11 templates using the QuikChange site-directed mutagenesis kit (Stratagene) and appropriate DNA oligonucleotides. These residues correspond to target or guide nucleotides of the box C/D and C′/D′ motifs contained within the H. volcanii pre-tRNATrp.In Vitro RNA Synthesis—Generally, in vitro transcription was carried out in 20-μl reactions at 37 °C for 2–3 h in buffer containing 40 mm Tris-Cl, pH 7.9, 6 mm MgCl2, 10mm dithiothreitol, 2 mm spermidine, 10 μCi of [α-32P]ATP (specific activity, 3000 Ci/mmol) (MP Biomedicals), 0.6 mm unlabeled ATP, and unlabeled GTP, CTP, and UTP each at 1.0 mm, PCR-amplified DNA, and 50 units of T7 RNA polymerase (New England Biolabs). Radiolabeled RNA transcripts were purified by denaturing PAGE, and amounts were approximated by Cerenkov counting. High specific activity transcripts were prepared similarly except that unlabeled ATP was omitted.RNP Assembly and Electrophoretic Mobility Shift Assay—Recombinant M. jannaschii L7Ae, aNop5p, and afibrillarin proteins were prepared, and RNP complexes were assembled as described previously (18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar). Briefly, ∼0.2 pmol of radiolabeled RNA was incubated at 70 °C with 10 pmol of L7Ae in 20-μl reactions (20 mm HEPES, pH 7.0, 150 mm NaCl, 0.75 mm dithiothreitol, 1.5 mm MgCl2, 0.1 mm EDTA, 10% glycerol) for 10 min. Assembly of higher order RNP complexes was accomplished by incubating 10 pmol of L7Ae, 32 pmol of aNop5p, and 33 pmol of afibrillarin with radiolabeled RNA transcripts in the presence of 10 μg of Escherichia coli tRNA. Assembled RNP complexes were resolved by electrophoretic mobility shift assay using 4% polyacrylamide gels containing 25 mm potassium phosphate, pH 7.0, and 2% glycerol as described previously (18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar). Resolved RNPs were visualized by phosphorimaging using a Packard Cyclone system.In Vitro RNP-directed Nucleotide 2′-O-Methylation and Thin Layer Chromatography Analysis of Modified Nucleotides—Generally, RNP complexes were assembled in the presence of 0.05 mmS-adenosylmethionine (AdoMet) using recombinant core proteins and 0.2 pmol of [α-32P]ATP-labeled RNAs as described above. After incubation at 70 °C for 2 h, radiolabeled RNA was purified by phenol/chloroform extraction and ethanol precipitation. In cases in which two different transcripts were included in the reaction, the amount of each transcript was 0.1 pmol. RNA samples were digested with RNase T2, and the digestion products were resolved on cellulose plates (EM Science) using two-dimensional TLC. The solvents for TLC were isobutyric acid, 0.5 n NH4OH (5:3, v/v) for the first dimension and isopropanol/HCl/H2O (70:15:15, v/v/v) for the second dimension (23Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). Radiolabeled nucleotides resolved by TLC analysis were visualized and quantified by phosphorimaging. The identity of dinucleotides was established based on our previous study (23Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). A small aliquot of RNA was obtained before the RNase T2 digestion and saved. These RNAs were checked by denaturing PAGE for RNA stability and integrity, especially for those cases in which methylation was not observed. Target nucleotide 2′-O-methylation was calculated by dividing the amount of radioactivity in the corresponding dinucleotide spot on the TLC plate by 33 (number of A residues in the pre-tRNA) of the sum of the total radioactivity in all spots and expressed as the percentage of modification.The amount of radiolabeled wild type pre-tRNA transcript used in the reactions and their incubation times varied (up to 2 h) for the kinetic study experiments (see Fig. 2D). Incubation at 70 °C beyond this time leads to RNA degradation. In some reactions, small amounts (<0.08 fmol) of high specific activity transcript were included as tracers to quantify the minimal levels of detectable modification. Two specific and more sensitive experiments using the G117C mutant pre-tRNA were carried out. In one experiment, instead of the typical 0.2 pmol, 2 pmol of pre-tRNA was used for the standard 2-h reaction. For wild type pre-tRNA, more than 80 and 40% of C34 and U39, respectively, were methylated under these conditions (see Fig. 2D). In another experiment, 0.2 pmol of normally radiolabeled and 2.25 fmol of high specific activity tracer transcript (in place of the typical <0.08 fmol transcript) were used in the reaction. We are able to detect methylation of a given residue as low as 2.5% under these conditions.Fig. 2The kinetics of H. volcanii pre-tRNATrp methylation indicate that nucleotides C34 and U39 are modified sequentially by trans-acting box C/D RNPs. Radiolabeled pre-tRNATrp transcripts (0.2 pmol) were incubated with recombinant M. jannaschii sRNP core proteins in the presence of AdoMet for 0 min (A) and 15 min (B). TLC analysis of RNase T2-digested pre-tRNA revealed C34 and U39 methylation with the appearance of dinucleotides CmCp and UmCp, respectively. C, methylation reaction was identical to B except that the pre-tRNA concentration was 2.0 pmol. D, the time course of nucleotide C34 and U39 methylation at different pre-tRNA concentrations is shown. Dinucleotides CmCp and UmCp produced at different time points were quantified by phosphorimaging analysis and plotted with respect to reaction time. Each curve, except for the U39 methylation curves at the two lowest pre-tRNA concentrations, was fitted as a single exponent. E, reaction rates (kapp) were calculated from each fitted C34 methylation curve and plotted versus pre-tRNA substrate concentration (pmol).View Large Image Figure ViewerDownload (PPT)Pre-tRNA Methylation in Cell Extracts—Some in vitro methylation reactions were carried out in cell extracts. Extracts were prepared by growing H. volcanii cells to an A550 density of 0.5–0.6 as described previously (23Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). Pelleted cells were resuspended in three volumes (w/v) of solution D (3.4 m KCl, 0.1 m MgOAc, 10 mm Tris-Cl, pH 7.6) and lysed by three passages through a French pressure cell at 20,000 psi. The lysate was cleared by centrifugation at 10,000 × g for 10 min followed by two additional centrifugations each at 32,000 × g for 30 min. Glycerol was added to a final concentration of 20%, and the cell extract was stored at –70 °C. Approximately 0.4 pmol of radiolabeled RNA was incubated at 37 °C for 1 h in a 35-μl reaction containing 30 μl of cell extract and 0.05 mm AdoMet. Purification of the RNA, RNase T2 digestion, and TLC analysis of digested nucleotides was performed as described above.Pre-tRNA Splicing Reactions—Splicing endonuclease and ligase reactions to produce linear and circular forms of H. volcanii pre-tRNATrp introns were carried out as described previously (25Salgia S.R. Singh S.K. Gurha P. Gupta R. RNA (N. Y.). 2003; 9: 319-330Crossref PubMed Scopus (69) Google Scholar, 26Zofallova L. Guo Y. Gupta R. RNA (N. Y.). 2000; 6: 1019-1030Crossref PubMed Scopus (31) Google Scholar). RNA products were separated by denaturing PAGE, and specific introns were eluted from the gels.RESULTSM. jannaschii sRNP Core Proteins Bind the H. volcanii Pre-tRNATrp and Its Derivative Introns in Vitro to Assemble Box C/D RNP—The folded H. volcanii pre-tRNATrp transcript shown in Fig. 1 (upper left) contains the bulge-helix-bulge motif recognized by the archaeal splicing endonuclease and possesses intron-encoded boxes C/D and C′/D′ in their characteristic conformation. Pre-tRNA is spliced after nucleotide methylation because the two exon-intron junctions are located within the target sequences of the box C/D RNPs. Both the linear intron formed after endonuclease cleavage of the pre-tRNA and the circular intron formed after ligation of the excised intron (25Salgia S.R. Singh S.K. Gurha P. Gupta R. RNA (N. Y.). 2003; 9: 319-330Crossref PubMed Scopus (69) Google Scholar) retain the essential features of the box C/D sRNA motifs (Fig. 1, upper middle and right); thus, both forms of the intron have the potential to guide the intermolecular, trans-2′-O-methylation of other pre-tRNATrp molecules.H. volcanii pre-tRNATrp as well as the linear and circular forms of its spliced intron can bind recombinant M. jannaschii box C/D sRNP core proteins in vitro to assemble sRNP complexes (Fig. 1, lower panels). Consistent with previous investigations (16Omer A.D. Ziesche S. Ebhardt H. Dennis P.P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5289-5294Crossref PubMed Scopus (158) Google Scholar, 18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar, 20Rashid R. Aittaleb M. Chen Q. Spiegel K. Demeler B. Li H. J. Mol. Biol. 2003; 333: 295-306Crossref PubMed Scopus (58) Google Scholar, 21Bortolin M.L. Bachellerie J.P. Clouet-d'Orval B. Nucleic Acids Res. 2003; 31: 6524-6535Crossref PubMed Scopus (42) Google Scholar), electrophoretic mobility shift assay also demonstrated that core protein binding is ordered, with L7Ae binding first followed by aNop5p and then afibrillarin (data not shown). The mouse U14 box C/D core motif (19Kuhn J.F. Tran E.J. Maxwell E.S. Nucleic Acids Res. 2002; 30: 931-941Crossref PubMed Scopus (129) Google Scholar) is an effective competitor for protein binding (data not shown), indicating that core protein binding is specific for the box C/D motif. When the RNA products of a pre-tRNATrp splicing reaction were incubated with L7Ae, only the introns (both linear and circular forms) bound this core protein (data not shown). Thus, box C/D RNP assembly requires the box C/D and C′/D′ RNA motifs contained within the intron of this pre-tRNA.In Vitro Assembled Box C/D RNPs Guide the 2′-O-methylation of Target Nucleotides in Pre-tRNATrp—Box C/D RNPs assembled on the H. volcanii pre-tRNATrp with the three recombinant M. jannaschii sRNP core proteins guided the AdoMet-dependent, 2′-O-methylation of C34 and U39 target nucleotides in the tRNATrp precursor. Following RNP assembly and incubation in the presence of AdoMet, TLC of the nucleotides generated by RNase T2 digestion of the [α-32P]ATP-labeled pre-tRNATrp transcript revealed radiolabeled residues corresponding to the dinucleotides CmCp and UmCp (where “p” is 3′-phosphate of the residue) (Figs. 2, B and C, and 3A). (RNase T2 cleaves after every ribonucleotide to produce ribonucleoside 3′-monophosphate (Np), except when nucleotides are methylated at the 2′ position of the sugar.) Dinucleotides CmCp and UmCp are derived from 2′-O-methylation of residues C34 and U39, respectively. Specificity of methylation for these two nucleotides has been confirmed by dNTP concentration-dependent, primer extension (27Maden B.E. Methods. 2001; 25: 374-382Crossref PubMed Scopus (83) Google Scholar) analysis (data not shown) as well as by mutation studies described later. Nucleotide methylation required box C/D RNP assembly because neither dinucleotide was observed when any one of the three sRNP core proteins was omitted from the reaction (data not shown). These studies therefore demonstrate that the in vitro assembled box C/D RNPs function to guide the 2′-O-methylation of pre-tRNATrp nucleotides C34 and U39. The amount of the CmCp dinucleotide was always greater than the UmCp dinucleotide (Fig. 2, B and C, and Fig. 3A), suggesting that modification of U39 follows that of C34 and/or occurs at a significantly slower rate.Fig. 32′-O-Methylation of pre-tRNATrp nucleotides C34 and U39 is sequential; pre-tRNATrp nucleotide methylation in an H. volcanii cell extract is also sequential but utilizes pre-existing box C/D RNPs. Radiolabeled wild type and mutant pre-tRNATrp transcripts possessing altered guide and/or target nucleotides were incubated for 2 h with recombinant M. jannaschii sRNP core proteins in the methylation reactions. A–G, TLC analyses of RNase T2-digested pre-tRNAs are shown. The pre-tRNAs used in each reaction are indicated in the individual panels. Pre-tRNAs with wild type and mutant guide and/or target nucleotides are illustrated at the side (mutated nucleotides are designated by asterisks). Target (uppercase) and guide (lowercase) nucleotides are shown with target:guide nucleotide pairs for the box C/D motif and C′/D′ motif indicated in black squares and black circles, respectively. AA–GG, radiolabeled wild type and mutant pre-tRNATrp transcripts possessing altered guide and/or target nucleotides were incubated in an H. volcanii cell extract, and nucleotide methylation was assessed with the TLC analysis of RNase T2-digested pre-tRNAs. Pre-tRNAs for each reaction are indicated in the individual panels and illustrated at the side (mutated nucleotides are designated by asterisks).View Large Image Figure ViewerDownload (PPT)The Kinetics of C34 and U39 Methylation Indicate That These Modifications Occur Sequentially and Are Guided via a trans Mechanism—A time course study of C34 and U39 nucleotide methylation was carried out in which the concentration of the pre-tRNA substrate was increased while the amount of core proteins was held constant. The initial rates and the extent (total percentage) of methylation for both nucleotides increased as pre-tRNA concentrations increased (Fig. 2D). Reaction rates for C34 methylation (kapp) were calculated and then plotted versus pre-tRNA substrate concentration (Fig. 2E). Consistent with a trans reaction, kapp increased as pre-tRNA substrate concentration increased. Lower reaction rates for U39 methylation, particularly at low substrate concentrations, caused a similar plot of the methylation rate of this nucleotide to be more problematic. However, visual inspection of the initial reaction rate for U39 at substrate concentrations of 0.2 and 2 pmol (Fig. 2D) clearly revealed increasing rates with respect to increasing pre-tRNA concentration. Indeed, the kapp rates at these two concentrations revealed values of 0.041 (0.2 pmol) and 0.059 (2 pmol). The fact that these rates are significantly less than C34 methylation rates at these same pre-tRNA substrate concentrations is consistent with the sequential methylation of these two target nucleotides (see below). Collectively, these kinetics are consistent with an intermolecular or trans reaction mechanism, thus suggesting that C34 and U39 nucleotide methylation do not occur via an intramolecular or cis mechanism as assumed previously (see below). Interestingly, inspection of the C34 methylation rate at higher substrate concentrations revealed the deviation of this curve from linearity (Fig. 2E). This suggests th}, number={46}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Sanjay, KS and Singh, SK and Gurha, P and Tran, EJ and Maxwell, ES and Gupta, R}, year={2004}, month={Nov}, pages={47661–47671} }
 @article{tran_zhang_maxwell_2003, title={Efficient RNA 2 '-O-methylation requires juxtaposed and symmetrically assembled archaeal box C/D and C '/D ' RNPs}, volume={22}, ISSN={["0261-4189"]}, DOI={10.1093/emboj/cdg368}, abstractNote={Box C/D ribonucleoprotein (RNP) complexes direct the nucleotide-specific 2'-O-methylation of ribonucleotide sugars in target RNAs. In vitro assembly of an archaeal box C/D sRNP using recombinant core proteins L7, Nop56/58 and fibrillarin has yielded an RNA:protein enzyme that guides methylation from both the terminal box C/D core and internal C'/D' RNP complexes. Reconstitution of sRNP complexes containing only box C/D or C'/D' motifs has demonstrated that the terminal box C/D RNP is the minimal methylation-competent particle. However, efficient ribonucleotide 2'-O-methylation requires that both the box C/D and C'/D' RNPs function within the full-length sRNA molecule. In contrast to the eukaryotic snoRNP complex, where the core proteins are distributed asymmetrically on the box C/D and C'/D' motifs, all three archaeal core proteins bind both motifs symmetrically. This difference in core protein distribution is a result of altered RNA-binding capabilities of the archaeal and eukaryotic core protein homologs. Thus, evolution of the box C/D nucleotide modification complex has resulted in structurally distinct archaeal and eukaryotic RNP particles.}, number={15}, journal={EMBO JOURNAL}, author={Tran, EJ and Zhang, XX and Maxwell, ES}, year={2003}, month={Aug}, pages={3930–3940} }
 @article{kuhn_tran_maxwell_2002, title={Archaeal ribosomal protein L7 is a functional homolog of the eukaryotic 15.5kD/Snu13p snoRNP core protein}, volume={30}, DOI={10.1093/nar/30.4.931}, abstractNote={Recent investigations have identified homologs of eukaryotic box C/D small nucleolar RNAs (snoRNAs) in Archaea termed sRNAs. Archaeal homologs of the box C/D snoRNP core proteins fibrillarin and Nop56/58 have also been identified but a homolog for the eukaryotic 15.5kD snoRNP protein has not been described. Our sequence analysis of archaeal genomes reveals that the highly conserved ribosomal protein L7 exhibits extensive homology with the eukaryotic 15.5kD protein. Protein binding studies demonstrate that recombinant Methanoccocus jannaschii L7 protein binds the box C/D snoRNA core motif with the same specificity and affinity as the eukaryotic 15.5kD protein. Identical to the eukaryotic 15.5kD core protein, archaeal L7 requires a correctly folded box C/D core motif and intact boxes C and D. Mutational analysis demonstrates that critical features of the box C/D core motif essential for 15.5kD binding are also required for L7 interaction. These include stem I which juxtaposes boxes C and D, as well as the sheared G:A pairs and protruded pyrimidine nucleotide of the asymmetric bulge region. The demonstrated presence of L7Ae in the Haloarcula marismortui 50S ribosomal subunit, taken with our demonstration of the ability of L7 to bind to the box C/D snoRNA core motif, indicates that this protein serves a dual role in Archaea. L7 functioning as both an sRNP core protein and a ribosomal protein could potentially regulate and coordinate sRNP assembly with ribosome biogenesis.}, number={4}, journal={Nucleic Acids Research}, author={Kuhn, J. F. and Tran, E. J. and Maxwell, E. S.}, year={2002}, pages={931–941} }