@article{sheahan_theriot_cortes_dekaney_2022, title={Prolonged oral antimicrobial administration prevents doxorubicin-induced loss of active intestinal stem cells}, volume={14}, ISSN={["1949-0984"]}, DOI={10.1080/19490976.2021.2018898}, abstractNote={Acute intestinal mucositis is a common off-target effect of chemotherapy, leading to co-morbidities such as vomiting, diarrhea, sepsis, and death. We previously demonstrated that the presence of enteric bacteria modulates the extent of jejunal epithelial damage induced by doxorubicin (DXR) in mice. Despite conventional thinking of the crypt as a sterile environment, recent evidence suggests that bacterial signaling influences aISC function. In this study, we labeled aISCs using transgenic Lgr5-driven fluorescence or with immunostaining for OLFM4. We examined the effect of DXR in both germ free (GF) mice and mice depleted of microbiota using an established antimicrobial treatment protocol (AMBx). We found differences in DXR-induced loss of aISCs between GF mice and mice treated with AMBx. aISCs were decreased after DXR in GF mice, whereas AMBx mice retained aISC expression after DXR. Neither group of mice exhibited an inflammatory response to DXR, suggesting the difference in aISC retention was not due to differences in local tissue inflammation. Therefore, we suspected that there was a protective microbial signal present in the AMBx mice that was not present in the GF mice. 16S rRNA sequencing of jejunal luminal contents demonstrated that AMBx altered the fecal and jejunal microbiota. In the jejunal contents, AMBx mice had increased abundance of Ureaplasma and Burkholderia. These results suggest pro-survival signaling from microbiota in AMBx-treated mice to the aISCs, and that this signaling maintains aISCs in the face of chemotherapeutic injury. Manipulation of the enteric microbiota presents a therapeutic target for reducing the severity of chemotherapy-associated mucositis.}, number={1}, journal={GUT MICROBES}, author={Sheahan, Breanna J. and Theriot, Casey M. and Cortes, Jocsa E. and Dekaney, Christopher M.}, year={2022}, month={Dec} }
 @article{sheahan_freeman_keeley_samuelson_roper_hasapis_lee_dekaney_2021, title={Epithelial Regeneration After Doxorubicin Arises Primarily From Early Progeny of Active Intestinal Stem Cells}, volume={12}, ISSN={["2352-345X"]}, DOI={10.1016/j.jcmgh.2021.01.015}, abstractNote={aISCs (aISCs) are sensitive to acute insults including chemotherapy and irradiation. Regeneration after aISC depletion has primarily been explored in irradiation (IR). However, the cellular origin of epithelial regeneration after doxorubicin (DXR), a common chemotherapeutic, is poorly understood.We monitored DXR's effect on aISCs by enumerating Lgr5-eGFP+ and Olfm4+ crypts, cleaved caspase-3 (CASP3+) immunofluorescence, and time-lapse organoid imaging. Lineage tracing from previously identified regenerative cell populations (Bmi1+, Hopx+, Dll1+, and Defa6+) was performed with DXR damage. Lineage tracing from aISCs was compared with lineage tracing from early progeny cells (transit-amplifying cells arising from aISCs 1 day predamage) in the context of DXR and IR. We compared stem cell and DNA damage response (DDR) transcripts in isolated aISCs and early progeny cells 6 and 24 hours after DXR.Epithelial regeneration after DXR primarily arose from early progeny cells generated by aISCs. Early progeny cells upregulated stem cell gene expression and lacked apoptosis induction (6 hours DXR: 2.5% of CASP3+ cells, p<0.0001). aISCs downregulated stem cell gene expression and underwent rapid apoptosis (6 hours DXR: 63.4% of CASP3+ cells). There was minimal regenerative contribution from Bmi1+, Hopx+, Dll1+, and Defa6+-expressing populations. In homeostasis, 48.4% of early progeny cells were BrdU+, and expressed low levels of DDR transcripts.We show that DXR effectively depleted aISCs in the small intestine and subsequent epithelial regeneration depended on nonquiescent early progeny cells of aISCs. The chemoresistant phenotype of the early progeny cells may rely on a dampened DDR in contrast to aISCs' robust DDR, which facilitates expeditious apoptosis.}, number={1}, journal={CELLULAR AND MOLECULAR GASTROENTEROLOGY AND HEPATOLOGY}, author={Sheahan, Breanna J. and Freeman, Ally N. and Keeley, Theresa M. and Samuelson, Linda C. and Roper, Jatin and Hasapis, Stephanie and Lee, Chang-Lung and Dekaney, Christopher M.}, year={2021}, pages={119–140} }
 @article{dekaney_2021, title={Hyperproliferation of the Intestinal Epithelium}, volume={12}, ISSN={["2352-345X"]}, DOI={10.1016/j.jcmgh.2021.06.010}, number={3}, journal={CELLULAR AND MOLECULAR GASTROENTEROLOGY AND HEPATOLOGY}, author={Dekaney, Christopher M.}, year={2021}, pages={1145–1146} }
 @article{shanahan_kanke_oyesola_hung_koch-laskowski_singh_peck_biraud_sheahan_cortes_et al._2021, title={Multiomic analysis defines the first microRNA atlas across all small intestinal epithelial lineages and reveals novel markers of almost all major cell types}, volume={321}, ISSN={["1522-1547"]}, DOI={10.1152/ajpgi.00222.2021}, abstractNote={MicroRNA-mediated regulation is critical for the proper development and function of the small intestinal (SI) epithelium. However, it is not known which microRNAs are expressed in each of the cell types of the SI epithelium. To bridge this important knowledge gap, we performed comprehensive microRNA profiling in all major cell types of the mouse SI epithelium. We used flow cytometry and fluorescence-activated cell sorting with multiple reporter mouse models to isolate intestinal stem cells, enterocytes, goblet cells, Paneth cells, enteroendocrine cells, tuft cells, and secretory progenitors. We then subjected these cell populations to small RNA-sequencing. The resulting atlas revealed highly enriched microRNA markers for almost every major cell type (https://sethupathy-lab.shinyapps.io/SI_miRNA/). Several of these lineage-enriched microRNAs (LEMs) were observed to be embedded in annotated host genes. We used chromatin-run-on sequencing to determine which of these LEMs are likely cotranscribed with their host genes. We then performed single-cell RNA-sequencing to define the cell type specificity of the host genes and embedded LEMs. We observed that the two most enriched microRNAs in secretory progenitors are miR-1224 and miR-672, the latter of which we found is deleted in hominin species. Finally, using several in vivo models, we established that miR-152 is a Paneth cell-specific microRNA.NEW & NOTEWORTHY In this study, first, microRNA atlas (and searchable web server) across all major small intestinal epithelial cell types is presented. We have demonstrated microRNAs that uniquely mark several lineages, including enteroendocrine and tuft. Identification of a key marker of mouse secretory progenitor cells, miR-672, which we show is deleted in humans. We have used several in vivo models to establish miR-152 as a specific marker of Paneth cells, which are highly understudied in terms of microRNAs.}, number={6}, journal={AMERICAN JOURNAL OF PHYSIOLOGY-GASTROINTESTINAL AND LIVER PHYSIOLOGY}, author={Shanahan, Michael T. and Kanke, Matt and Oyesola, Oyebola O. and Hung, Yu-Han and Koch-Laskowski, Kieran and Singh, Ajeet P. and Peck, Bailey C. E. and Biraud, Mandy and Sheahan, Breanna and Cortes, Josca E. and et al.}, year={2021}, month={Dec}, pages={G668–G681} }
 @misc{cray_sheahan_dekaney_2021, title={Secretory Sorcery: Paneth Cell Control of Intestinal Repair and Homeostasis}, volume={12}, ISSN={["2352-345X"]}, DOI={10.1016/j.jcmgh.2021.06.006}, abstractNote={Paneth cells are professional secretory cells that classically play a role in the innate immune system by secreting antimicrobial factors into the lumen to control enteric bacteria. In this role, Paneth cells are able to sense cues from luminal bacteria and respond by changing production of these factors to protect the epithelial barrier. Paneth cells rely on autophagy to regulate their secretory capability and capacity. Disruption of this pathway through mutation of genes, such as Atg16L1, results in decreased Paneth cell function, dysregulated enteric microbiota, decreased barrier integrity, and increased risk of diseases such as Crohn's disease in humans. Upon differentiation Paneth cells migrate downward and intercalate among active intestinal stem cells at the base of small intestinal crypts. This localization puts them in a unique position to interact with active intestinal stem cells, and recent work shows that Paneth cells play a critical role in influencing the intestinal stem cell niche. This review discusses the numerous ways Paneth cells can influence intestinal stem cells and their niche. We also highlight the ways in which Paneth cells can alter cells and other organ systems.}, number={4}, journal={CELLULAR AND MOLECULAR GASTROENTEROLOGY AND HEPATOLOGY}, author={Cray, Paul and Sheahan, Breanna J. and Dekaney, Christopher M.}, year={2021}, pages={1239–1250} }
 @article{cray_sheahan_cortes_dekaney_2020, title={Doxorubicin increases permeability of murine small intestinal epithelium and cultured T84 monolayers}, volume={10}, ISSN={["2045-2322"]}, DOI={10.1038/s41598-020-78473-1}, abstractNote={Abstract Enteric bacteria and/or their products are necessary for doxorubicin (DXR)-induced small intestine mucosal damage. While DXR does not induce gross loss of epithelium, others have shown elevated serum endotoxin after DXR administration. However, the mechanism of movement is unknown. We hypothesized that DXR treatment resulted in increased paracellular translocation of bacteria or bacterial products through the small intestinal epithelium. We measured permeability after DXR administration using transepithelial resistance and macromolecular flux and assessed tight junctional gene expression and protein localization both in vitro using T84 cells and ex vivo using murine jejunum. DXR treatment increased flux of 4 kDa dextrans in mouse jejenum, but increased flux of 4, 10 and 20 kDa dextrans in T84 cells. Following DXR, we observed increased permeability, both in vitro and ex vivo, independent of bacteria. DXR induced increased expression of Cldn2 and Cldn4 in murine small intestine but increased only CLDN2 expression in T84 cells. DXR treatment induced disorganization of tight junctional proteins. We conclude that DXR increases paracellular transit of small macromolecules, including bacterial products, through the epithelium, by altering expression of tight junctional components and dynamic loosening of cellular tight junctions.}, number={1}, journal={SCIENTIFIC REPORTS}, author={Cray, Paul and Sheahan, Breanna J. and Cortes, Jocsa E. and Dekaney, Christopher M.}, year={2020}, month={Dec} }
 @article{singh_hung_shanahan_kanke_bonfini_dame_biraud_peck_oyesola_freund_et al._2020, title={Enteroendocrine Progenitor Cell-Enriched mir-7 Regulates Intestinal Epithelial Proliferation in an Xiap-Dependent Manner}, volume={9}, ISSN={["2352-345X"]}, DOI={10.1016/j.jcmgh.2019.11.001}, abstractNote={Background & Aims The enteroendocrine cell (EEC) lineage is important for intestinal homeostasis. It was recently shown that EEC progenitors contribute to intestinal epithelial growth and renewal, but the underlying mechanisms remain poorly understood. MicroRNAs are under-explored along the entire EEC lineage trajectory, and comparatively little is known about their contributions to intestinal homeostasis. Methods We leverage unbiased sequencing and eight different mouse models and sorting methods to identify microRNAs enriched along the EEC lineage trajectory. We further characterize the functional role of EEC progenitor-enriched miRNA, miR-7, by in vivo dietary study as well as ex vivo enteroid in mice. Results First, we demonstrate that miR-7 is highly enriched across the entire EEC lineage trajectory and is the most enriched miRNA in EEC progenitors relative to Lgr5+ intestinal stem cells. Next, we show in vivo that in EEC progenitors miR-7 is dramatically suppressed under dietary conditions that favor crypt division and suppress EEC abundance. We then demonstrate by functional assays in mouse enteroids that miR-7 exerts robust control of growth, as determined by budding (proxy for crypt division), EdU and PH3 staining, and likely regulates EEC abundance also. Finally, we show by single-cell RNA sequencing analysis that miR-7 regulates Xiap in progenitor/stem cells and we demonstrate in enteroids that the effects of miR-7 on mouse enteroid growth depend in part on Xiap and Egfr signaling. Conclusions This study demonstrates for the first time that EEC progenitor cell-enriched miR-7 is altered by dietary perturbations and that it regulates growth in enteroids via intact Xiap and Egfr signaling.}, number={3}, journal={CELLULAR AND MOLECULAR GASTROENTEROLOGY AND HEPATOLOGY}, author={Singh, Ajeet P. and Hung, Yu-Han and Shanahan, Michael T. and Kanke, Matt and Bonfini, Alessandro and Dame, Michael K. and Biraud, Mandy and Peck, Bailey C. E. and Oyesola, Oyebola O. and Freund, John M. and et al.}, year={2020}, pages={447–464} }
 @article{jones_brindley_elder_myers_rajala_dekaney_mcnamee_frey_shroyer_dempsey_2019, title={Cellular Plasticity of Defa4(Cre)-Expressing Paneth Cells in Response to Notch Activation and Intestinal Injury}, volume={7}, ISSN={["2352-345X"]}, DOI={10.1016/j.jcmgh.2018.11.004}, abstractNote={Loss of leucine-rich repeat-containing G-protein-coupled receptor 5-positive crypt base columnar cells provides permissive conditions for different facultative stem cell populations to dedifferentiate and repopulate the stem cell compartment. In this study, we used a defensin α4-Cre recombinase (Defa4Cre) line to define the potential of Paneth cells to dedifferentiate and contribute to intestinal stem cell (ISC) maintenance during normal homeostasis and after intestinal injury.Small intestine and enteroids from Defa4Cre;Rosa26 tandem dimer Tomato (tdTomato), a red fluoresent protein, (or Rosa26 Enhanced Yellow Fluorescent Protein (EYFP)) reporter, Notch gain-of-function (Defa4Cre;Rosa26 Notch Intracellular Domain (NICD)-ires-nuclear Green Fluorescent Protein (nGFP) and Defa4Cre;Rosa26reverse tetracycline transactivator-ires Enhanced Green Fluorescent Protein (EGFP);TetONICD), A Disintegrin and Metalloproteinase domain-containing protein 10 (ADAM10) loss-of-function (Defa4Cre;ADAM10flox/flox), and Adenomatous polyposis coli (APC) inactivation (Defa4Cre;APCflox/flox) mice were analyzed. Doxorubicin treatment was used as an acute intestinal injury model. Lineage tracing, proliferation, and differentiation were assessed in vitro and in vivo.Defa4Cre-expressing cells are fated to become mature Paneth cells and do not contribute to ISC maintenance during normal homeostasis in vivo. However, spontaneous lineage tracing was observed in enteroids, and fluorescent-activated cell sorter-sorted Defa4Cre-marked cells showed clonogenic enteroid growth. Notch activation in Defa4Cre-expressing cells caused dedifferentiation to multipotent ISCs in vivo and was required for adenoma formation. ADAM10 deletion had no significant effect on crypt homeostasis. However, after acute doxorubicin-induced injury, Defa4Cre-expressing cells contributed to regeneration in an ADAM10-Notch-dependent manner.Our studies have shown that Defa4Cre-expressing Paneth cells possess cellular plasticity, can dedifferentiate into multipotent stem cells upon Notch activation, and can contribute to intestinal regeneration in an acute injury model.}, number={3}, journal={CELLULAR AND MOLECULAR GASTROENTEROLOGY AND HEPATOLOGY}, author={Jones, Jennifer C. and Brindley, Constance D. and Elder, Nicholas H. and Myers, Martin G., Jr. and Rajala, Michael W. and Dekaney, Christopher M. and McNamee, Eoin N. and Frey, Mark R. and Shroyer, Noah F. and Dempsey, Peter J.}, year={2019}, pages={533–554} }
 @article{dekaney_king_sheahan_cortes_2019, title={Mist1 Expression Is Required for Paneth Cell Maturation}, volume={8}, ISSN={["2352-345X"]}, DOI={10.1016/j.jcmgh.2019.07.003}, abstractNote={Paneth cells are professional secretory cells found within the small intestinal crypt epithelium. Although their role as part of the innate immune complex providing antimicrobial secretory products is well-known, the mechanisms that control secretory capacity are not well-understood. MIST1 is a scaling factor that is thought to control secretory capacity of exocrine cells.Mist1+/+ and Mist1-/- mice were used to evaluate the function of MIST1 in small intestinal Paneth cells. We used histologic and immunofluorescence staining to evaluate small intestinal tissue for proliferation and lineage allocation. Total RNA was isolated to evaluate gene expression. Enteroid culture was used to evaluate the impact of the absence of MIST1 expression on intestinal stem cell function.Absence of MIST1 resulted in increased numbers of Paneth cells exhibiting an intermediate cell phenotype but otherwise did not alter overall epithelial cell lineage allocation. Muc2 and lysozyme staining confirmed the presence of intermediate cells at the crypt base of Mist1-/- mice. These changes were not associated with changes in mRNA expression of transcription factors associated with lineage allocation, and they were not abrogated by inhibition of Notch signaling. However, the absence of MIST1 expression was associated with alterations in Paneth cell morphology including decreased granule size and distended rough endoplasmic reticulum. Absence of MIST1 was associated with increased budding of enteroid cultures; however, there was no evidence of increased intestinal stem cell numbers in vivo.MIST1 plays an important role in organization of the Paneth cell secretory apparatus and managing endoplasmic reticulum stress. This role occurs downstream of Paneth cell lineage allocation.}, number={4}, journal={CELLULAR AND MOLECULAR GASTROENTEROLOGY AND HEPATOLOGY}, author={Dekaney, Christopher M. and King, Stephanie and Sheahan, Breanna and Cortes, Jocsa E.}, year={2019}, pages={549–560} }
 @article{sheahan_dekaney_2018, title={Decrypting the Crypt: Novel Monoclonal Antibodies to Identify Intestinal Stem Cell Populations}, volume={6}, ISSN={["2352-345X"]}, DOI={10.1016/j.jcmgh.2018.04.006}, number={1}, journal={CELLULAR AND MOLECULAR GASTROENTEROLOGY AND HEPATOLOGY}, author={Sheahan, Breanna and Dekaney, Christopher M.}, year={2018}, pages={121–122} }
 @article{rigby_carr_orgel_king_lund_dekaney_2016, title={Intestinal bacteria are necessary for doxorubicin-induced intestinal damage but not for doxorubicin-induced apoptosis}, volume={7}, ISSN={1949-0976 1949-0984}, url={http://dx.doi.org/10.1080/19490976.2016.1215806}, DOI={10.1080/19490976.2016.1215806}, abstractNote={Doxorubicin (DOXO) induces significant, but transient, increases in apoptosis in the stem cell zone of the jejunum, followed by mucosal damage involving a decrease in crypt proliferation, crypt number, and villus height. The gastrointestinal tract is home to a vast population of commensal bacteria and numerous studies have demonstrated a symbiotic relationship between intestinal bacteria and intestinal epithelial cells (IEC) in maintaining homeostatic functions of the intestine. However, whether enteric bacteria play a role in DOXO-induced damage is not well understood. We hypothesized that enteric bacteria are necessary for induction of apoptosis and damage associated with DOXO treatment. Conventionally raised (CONV) and germ free (GF) mice were given a single injection of DOXO, and intestinal tissue was collected at 6, 72, and 120 h after treatment and from no treatment (0 h) controls. Histology and morphometric analyses quantified apoptosis, mitosis, crypt depth, villus height, and crypt density. Immunostaining for muc2 and lysozyme evaluated Paneth cells, goblet cells or dual stained intermediate cells. DOXO administration induced significant increases in apoptosis in jejunal epithelium regardless of the presence of enteric bacteria; however, the resulting injury, as demonstrated by statistically significant changes in crypt depth, crypt number, and proliferative cell number, was dependent upon the presence of enteric bacteria. Furthermore, we observed expansion of Paneth and goblet cells and presence of intermediate cells only in CONV and not GF mice. These findings provide evidence that manipulation and/or depletion of the enteric microbiota may have clinical significance in limiting chemotherapy-induced mucositis.}, number={5}, journal={Gut Microbes}, publisher={Informa UK Limited}, author={Rigby, Rachael J. and Carr, Jacquelyn and Orgel, Kelly and King, Stephanie L. and Lund, P. Kay and Dekaney, Christopher M.}, year={2016}, month={Jul}, pages={414–423} }
 @article{carr_king_dekaney_2015, title={1009 Depletion of Enteric Microbiota Protects from Chemotherapy-Induced Damage in the Murine Small Intestine}, volume={148}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(15)33862-2}, DOI={10.1016/S0016-5085(15)33862-2}, number={4}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Carr, Jacquelyn and King, Stephanie L and Dekaney, Christopher M.}, year={2015}, month={Apr}, pages={S-1132} }
 @article{king_carr_dekaney_2015, title={798 Mist1 Is Necessary for Paneth Cell Maturation}, volume={148}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(15)30527-8}, DOI={10.1016/S0016-5085(15)30527-8}, number={4}, journal={Gastroenterology}, publisher={Elsevier BV}, author={King, Stephanie L. and Carr, Jacquelyn and Dekaney, Christopher M.}, year={2015}, month={Apr}, pages={S-156-S-157} }
 @article{seiler_schenhals_von furstenberg_allena_smith_scaria_bresler_dekaney_henning_2015, title={Tissue underlying the intestinal epithelium elicits proliferation of intestinal stem cells following cytotoxic damage}, volume={361}, ISSN={0302-766X 1432-0878}, url={http://dx.doi.org/10.1007/s00441-015-2111-1}, DOI={10.1007/s00441-015-2111-1}, abstractNote={The goals of this study were to document the proliferative response of intestinal stem cells (ISCs) during regeneration after damage from doxorubicin (DXR), and to characterize the signals responsible for ISC activation. To this end, jejuni from DXR-treated mice were harvested for histology, assessment of ISC numbers and proliferation by flow cytometry, crypt culture, and RNA analyses. Histology showed that crypt depth and width were increased 4 days after DXR. At this time point, flow cytometry on tissue collected 1 h after EdU administration revealed increased numbers of CD24(lo)UEA(-) ISCs and increased percentage of ISCs cycling. In culture, crypts harvested from DXR-treated mice were equally proliferative as those of control mice. Addition of subepithelial intestinal tissue (SET) collected 4 days after DXR elicited increased budding (1.4 ± 0.3 vs. 5.1 ± 1.0 buds per enteroid). Microarray analysis of SET collected 4 days after DXR revealed 1030 differentially expressed transcripts. Cross-comparison of Gene Ontology terms considered relevant to ISC activation pointed to 10 candidate genes. Of these, the epidermal growth factor (EGF) family member amphiregulin and the BMP antagonist chordin-like 2 were chosen for further study. In crypt culture, amphiregulin alone did not elicit significant budding, but amphiregulin in combination with BMP antagonism showed marked synergism (yielding 6.3 ± 0.5 buds per enteroid). These data suggest a critical role for underlying tissue in regulating ISC behavior after damage, and point to synergism between amphiregulin and chordin-like 2 as factors which may account for activation of ISCs in the regenerative phase.}, number={2}, journal={Cell and Tissue Research}, publisher={Springer Science and Business Media LLC}, author={Seiler, Kristen M and Schenhals, Erica L and von Furstenberg, Richard J and Allena, Bhavya K and Smith, Brian J and Scaria, Denny and Bresler, Michele N and Dekaney, Christopher M and Henning, Susan J}, year={2015}, month={Feb}, pages={427–438} }
 @article{gewain_king_dekaney_2013, title={Mo1824 Jejunal and Ileal Epithelium Demonstrate Differing Damage Responses to Doxorubicin Treatment}, volume={144}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(13)62492-0}, DOI={10.1016/S0016-5085(13)62492-0}, number={5}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Gewain, Kelly and King, Stephanie L. and Dekaney, Christopher M.}, year={2013}, month={May}, pages={S-672} }
 @article{king_mohiuddin_dekaney_2013, title={Paneth cells expand from newly created and preexisting cells during repair after doxorubicin-induced damage}, volume={305}, ISSN={0193-1857 1522-1547}, url={http://dx.doi.org/10.1152/ajpgi.00441.2012}, DOI={10.1152/ajpgi.00441.2012}, abstractNote={Paneth cell numbers increase following intestinal damage, but mechanisms driving this process are not understood. We hypothesized that the increase in Paneth cell numbers is due to recruitment of cells from a preexisting pool of secretory progenitors. Mice were given a single injection of doxorubicin (Dox), and intestinal tissue was collected 0-168 h after treatment. Paneth, goblet, and intermediate cells were counted and evaluated for cell morphology. Quantitative RT-PCR was used to measure expression of various genes associated with Paneth cell allocation and maturation. Paneth cells were birth dated using incorporation of thymidine analogs given before or after Dox. Staining revealed "intermediate" cells, which were rarely observed in control crypts but increased significantly in number 96 and 120 h after Dox treatment. Birth dating of intermediate cells 5 days after Dox treatment revealed that 24% of these cells took up thymidine analog given prior to Dox treatment and 36% took up thymidine analog given after Dox treatment. Quantitative RT-PCR demonstrated a significant increase in Spdef, Atoh1, Sox9, EphB3, Mist, Wnt5a, FGF-9, and FGF-18 mRNAs and a significant decrease in Indian hedgehog mRNA. Expansion of the Paneth cell compartment after Dox treatment is due to generation of new cells and recruitment of cells from an existing pool. These cells express Paneth and goblet biomarkers and are found only during repair. Expansion of these cells correlates temporally with reduced Indian hedgehog and increased FGF and Wnt mRNA. These findings are significant, as they provide a first step in understanding mechanisms of Paneth cell expansion during mucosal repair.}, number={2}, journal={American Journal of Physiology-Gastrointestinal and Liver Physiology}, publisher={American Physiological Society}, author={King, Stephanie L. and Mohiuddin, Jahan J. and Dekaney, Christopher M.}, year={2013}, month={Jul}, pages={G151–G162} }
 @article{king_dekaney_2013, title={Small Intestinal Stem Cells}, volume={29}, journal={Current Opinion in Gastroenterology}, author={King, S.L. and Dekaney, C.M.}, year={2013}, pages={140–145} }
 @article{packey_gewain_sartor_dekaney_2013, title={Tu2027 The Chemotherapeutic Agent Doxorubicin Induces Contrasting Microbial Responses in the Jejunum and Distal Ileum That May Contribute to Differential Injury Patterns}, volume={144}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(13)63383-1}, DOI={10.1016/S0016-5085(13)63383-1}, number={5}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Packey, Christopher D. and Gewain, Kelly and Sartor, Ryan B. and Dekaney, Christopher M.}, year={2013}, month={May}, pages={S-907-S-908} }
 @article{dehmer_garrison_speck_dekaney_henning_helmrath_2011, title={Characterization Of Intestinal Stem Cells During Development: The Role Of Lgr5}, volume={165}, ISSN={0022-4804}, url={http://dx.doi.org/10.1016/j.jss.2010.11.142}, DOI={10.1016/j.jss.2010.11.142}, number={2}, journal={Journal of Surgical Research}, publisher={Elsevier BV}, author={Dehmer, J.J. and Garrison, A.P. and Speck, K.E. and Dekaney, C.M. and Henning, S.J. and Helmrath, M.A.}, year={2011}, month={Feb}, pages={339} }
 @article{dehmer_garrison_speck_dekaney_van landeghem_sun_henning_helmrath_2011, title={Expansion of Intestinal Epithelial Stem Cells during Murine Development}, volume={6}, ISSN={1932-6203}, url={http://dx.doi.org/10.1371/journal.pone.0027070}, DOI={10.1371/journal.pone.0027070}, abstractNote={Murine small intestinal crypt development is initiated during the first postnatal week. Soon after formation, overall increases in the number of crypts occurs through a bifurcating process called crypt fission, which is believed to be driven by developmental increases in the number of intestinal stem cells (ISCs). Recent evidence suggests that a heterogeneous population of ISCs exists within the adult intestine. Actively cycling ISCs are labeled by Lgr5, Ascl2 and Olfm4; whereas slowly cycling or quiescent ISC are marked by Bmi1 and mTert. The goal of this study was to correlate the expression of these markers with indirect measures of ISC expansion during development, including quantification of crypt fission and side population (SP) sorting. Significant changes were observed in the percent of crypt fission and SP cells consistent with ISC expansion between postnatal day 14 and 21. Quantitative real-time polymerase chain reaction (RT-PCR) for the various ISC marker mRNAs demonstrated divergent patterns of expression. mTert surged earliest, during the first week of life as crypts are initially being formed, whereas Lgr5 and Bmi1 peaked on day 14. Olfm4 and Ascl2 had variable expression patterns. To assess the number and location of Lgr5-expressing cells during this period, histologic sections from intestines of Lgr5-EGFP mice were subjected to quantitative analysis. There was attenuated Lgr5-EGFP expression at birth and through the first week of life. Once crypts were formed, the overall number and percent of Lgr5-EGFP positive cells per crypt remain stable throughout development and into adulthood. These data were supported by Lgr5 in situ hybridization in wild-type mice. We conclude that heterogeneous populations of ISCs are expanding as measured by SP sorting and mRNA expression at distinct developmental time points.}, number={11}, journal={PLoS ONE}, publisher={Public Library of Science (PLoS)}, author={Dehmer, Jeffrey J. and Garrison, Aaron P. and Speck, Karen E. and Dekaney, Christopher M. and Van Landeghem, Laurianne and Sun, Xiaofei and Henning, Susan J. and Helmrath, Michael A.}, editor={Rota, MarcelloEditor}, year={2011}, month={Nov}, pages={e27070} }
 @article{rigby_lund_dekaney_2010, title={750 Germ Free Mice Show Apoptosis but Dramatically Reduced Overt Mucosal Damage After Doxorubicin}, volume={138}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(10)60471-4}, DOI={10.1016/S0016-5085(10)60471-4}, number={5}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Rigby, Rachael J. and Lund, Pauline K. and Dekaney, Christopher M.}, year={2010}, month={May}, pages={S-103} }
 @article{dekaney_2010, title={T1727 Paneth Cells Expand From a Pre-Existing Pool During Repair After Doxorubicin-Induced Damage}, volume={138}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(10)62605-4}, DOI={10.1016/S0016-5085(10)62605-4}, number={5}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Dekaney, Christopher M.}, year={2010}, month={May}, pages={S-566} }
 @article{dekaney_gulati_helmrath_henning_2009, title={488 Regeneration of Intestinal Stem Cells Following Doxorubicin Treatment of Mice}, volume={136}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(09)60354-1}, DOI={10.1016/S0016-5085(09)60354-1}, number={5}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Dekaney, Christopher M. and Gulati, Ajay S. and Helmrath, Michael A. and Henning, Susan J.}, year={2009}, month={May}, pages={A-79} }
 @article{garrison_dekaney_von allmen_lund_henning_helmrath_2009, title={Early but not late administration of glucagon-like peptide-2 following ileo-cecal resection augments putative intestinal stem cell expansion}, volume={296}, ISSN={0193-1857 1522-1547}, url={http://dx.doi.org/10.1152/ajpgi.90588.2008}, DOI={10.1152/ajpgi.90588.2008}, abstractNote={Expansion of intestinal progenitors and putative stem cells (pISC) occurs early and transiently following ileo-cecal resection (ICR). The mechanism controlling this process is not defined. We hypothesized that glucagon-like peptide-2 (GLP-2) would augment jejunal pISC expansion only when administered to mice immediately after ICR. Since recent reports demonstrated increases in intestinal insulin-like growth factor (IGF)-I following GLP-2 administration, we further hypothesized that increased intestinal IGF-I expression would correlate with pISC expansion following ICR. To assess this, GLP-2 or vehicle was administered to mice either immediately after resection (early) or before tissue harvest 6 wk following ICR (late). Histological analysis quantified proliferation and intestinal morphometrics. Serum levels of GLP-2 were measured by ELISA and jejunal IGF-I mRNA by qRT-PCR. Expansion of jejunal pISC was assessed by fluorescent-activated cell sorting of side population cells, immunohistochemistry for phosphorylated beta-catenin at serine 552 (a pISC marker), percent of crypt fission, and total numbers of crypts per jejunal circumference. We found that early but not late GLP-2 treatment after ICR significantly augmented pISC expansion. Increases in jejunal IGF-I mRNA correlated temporally with early pISC expansion and effects of GLP-2. Early GLP-2 increased crypt fission and accelerated adaptive increases in crypt number and intestinal caliber. GLP-2 increased proliferation and intestinal morphometrics in all groups. This study shows that, in mice, GLP-2 promotes jejunal pISC expansion only in the period immediately following ICR. This is associated with increased IGF-I and accelerated adaptive increases in mucosal mass. These data provide clinical rationale relevant to the optimal timing of GLP-2 in patients with intestinal failure.}, number={3}, journal={American Journal of Physiology-Gastrointestinal and Liver Physiology}, publisher={American Physiological Society}, author={Garrison, Aaron P. and Dekaney, Christopher M. and von Allmen, Douglas C. and Lund, P. Kay and Henning, Susan J. and Helmrath, Michael A.}, year={2009}, month={Mar}, pages={G643–G650} }
 @article{dekaney_gulati_garrison_helmrath_henning_2009, title={Regeneration of intestinal stem/progenitor cells following doxorubicin treatment of mice}, volume={297}, ISSN={0193-1857 1522-1547}, url={http://dx.doi.org/10.1152/ajpgi.90446.2008}, DOI={10.1152/ajpgi.90446.2008}, abstractNote={The intestinal epithelium is in a constant state of renewal. The rapid turnover of cells is fed by a hierarchy of transit amplifying and stem/progenitor cells destined to give rise to the four differentiated epithelial lineages of the small intestine. Doxorubicin (Dox) is a commonly used chemotherapeutic agent that preferentially induces apoptosis in the intestinal stem cell zone (SCZ). We hypothesized that Dox treatment would initially decrease “+4” intestinal stem cell numbers with a subsequent expansion during mucosal repair. Temporal assessment following Dox treatment demonstrated rapid induction of apoptosis in the SCZ leading to a decrease in the number of intestinal stem/progenitor cells as determined by flow cytometry for CD45(−) SP cells, and immunohistochemistry of cells positive for putative +4 stem cell markers β-cat Ser552 and DCAMKL1. Between 96 and 168 h postinjection, overall proliferation in the crypts increased concomitant with increases in both absolute and relative numbers of goblet, Paneth, and enteroendocrine cells. This regeneration phase was also associated with increases of CD45(−) SP cells, β-cat Ser552 -positive cells, crypt fission, and crypt number. We used Lgr5-lacZ mice to assess behavior of Lgr5-positive stem cells following Dox and found no change in this cell population. Lgr5 mRNA level was also measured and showed no change immediately after Dox but decreased during the regeneration phase. Together these data suggest that, following Dox-induced injury, expansion of intestinal stem cells occurs during mucosal repair. On the basis of available markers this expansion appears to be predominantly the +4 stem cell population rather than those of the crypt base.}, number={3}, journal={American Journal of Physiology-Gastrointestinal and Liver Physiology}, publisher={American Physiological Society}, author={Dekaney, Christopher M. and Gulati, Ajay S. and Garrison, Aaron P. and Helmrath, Michael A. and Henning, Susan J.}, year={2009}, month={Sep}, pages={G461–G470} }
 @article{garrison_dekaney_von allmen_henning_helmrath_2008, title={163. Timing of Glucagon-Like Peptide-2 (GLP-2) Required for Augmented Expansion of Intestinal Stem Cells Following Ileo-Cecal Resection (ICR) in Mice}, volume={144}, ISSN={0022-4804}, url={http://dx.doi.org/10.1016/j.jss.2007.12.186}, DOI={10.1016/j.jss.2007.12.186}, number={2}, journal={Journal of Surgical Research}, publisher={Elsevier BV}, author={Garrison, Aaron P. and Dekaney, Christopher M. and von Allmen, Douglas C. and Henning, Susan J. and Helmrath, Michael A.}, year={2008}, month={Feb}, pages={249–250} }
 @article{dekaney_von allmen_garrison_rigby_lund_henning_helmrath_2008, title={29. Bacterial Dependent up Regulation of Ileal Bile Acid Binding Protein and Bile Acid Transporters Is FXR-Mediated Following Ileo-Cecal Resection (ICR)}, volume={144}, ISSN={0022-4804}, url={http://dx.doi.org/10.1016/j.jss.2007.12.034}, DOI={10.1016/j.jss.2007.12.034}, abstractNote={Enteric microbiota may exacerbate chronic inflammation in patients with Crohn’s disease. In these patients, recurrent disease often results in surgical resection of the terminal ileum, disrupting the normal enterohepatic circulation of bile acids. The ability of the colon to up regulate the molecular mechanisms required for bile acid reclamation following ICR helps prevent colonic mucosa from chronic injury due to increased luminal bile acid content. In this study, we hypothesized that enteric microbiota are required for luminal bile salts to up regulate FXR-mediated bile acid transport in the colon. Methods: To test our hypothesis, conventional (WT), conventional FXR knockout (FXR −/−) and germ free (GF) mice maintained throughout the study in a gnotobiotic facility were randomized to undergo either ICR or sham operation (n = 3-6/group). On postoperative day 7 the ascending colon was harvested for luminal contents, histology, immunohistochemistry and isolation of total RNA and protein. Real time RT-PCR was performed to evaluate changes in bile acid homeostatic gene expression of IBABP (ileal bile acid binding protein), Asbt (apical bile acid transporter), Ostβ (organic solute transporter) and FGF 15 (regulates liver bile homeostasis) in the colon. Means were compared using ANOVA and Fisher’s pairwise comparison. Results: The lack of microbiota in GF mice resulted in significant increases in colonic crypt depth following ICR compared to sham operated animals, whereas no differences were noted in WT mice. Increases in the expression of genes regulating bile acid transporters were observed for IBABP (12 fold), Asbt (5.6 fold), Ostβ (1.6 fold) and FGF 15 (5.9 fold) only in WT mice following ICR. Increased expression of IBABP was confirmed by immunohistochemistry. FXR (−/−) mice demonstrated similar histological changes as occurred in GF mice. Consistent with this observation was the lack of up regulation of IBABP and FGF 15 following ICR, whereas similar increases in Asbt (3 fold) and Ostβ (2 fold) occurred as in WT mice. Please see Table 1 where “a” denotes differences between sham and ICR of a given mouse type, and “b” denotes differences between either FXR(−/−) or GF mice and WT mice for a given surgery. Conclusion: Bacterial dependent up regulation of IBABP is FXR mediated in the colon following ICR. Mice lacking microbiota (GF) or FXR are unable to increase the expression of IBABP or FGF 15, resulting in colonic crypt depth in response to increased luminal bile acids. Increases in Asbt and Ostβ require luminal bacteria, but do not appear to be FXR mediated. Further insight into colonic adaptation to increased bile acids may prove beneficial to managing Crohn’s patients following surgical loss of the ileum. Tabled 1 Mouse Type Surgery Colonic Crypt Depth Relative Gene Expression IBABP FGF 15 Asbt Ost β WT Sham 94.3 ± 5.8 4.8 ± 1.6 0.4 ± 0.3 0.2 ± 0.05 1.2 ± 0.2 WT ICR 104.9 ± 2.6 57.8 ± 15.1a 2.4 ± 0.9 0.8 ± 0.4 1.9 ± 0.5 FXR −/− Sham 93.7 ± 1.9 0.6 ± 0.1 0.002 ± 0.001 0.7 ± 0.1 1.6 ± 0.1 FXR −/− ICR 116.3 ± 2.6a 0.3 ± 0.03b 0.05 ± 0.03 2.2 ± 0.1a,b 2.3 ± 0.1 GF Sham 92.5 ± 3.1 9.1 ± 8.2 13.5 ± 7.7a 0.8 ± 0.5 0.3 ± 0.04 GF ICR 145.5 ± 12.3a,b 1.6 ± 0.2b 3.5 ± 1.7 0.1 ± 0.02 0.3 ± 0.07b Open table in a new tab}, number={2}, journal={Journal of Surgical Research}, publisher={Elsevier BV}, author={Dekaney, Chrisopher M. and von Allmen, Doug C. and Garrison, Aaron P. and Rigby, Rachael J. and Lund, P. Kay and Henning, Susan J. and Helmrath, Michael A.}, year={2008}, month={Feb}, pages={188–189} }
 @article{dekaney_von allmen_garrison_rigby_lund_henning_helmrath_2008, title={Bacterial-dependent up-regulation of intestinal bile acid binding protein and transport is FXR-mediated following ileo-cecal resection}, volume={144}, ISSN={0039-6060}, url={http://dx.doi.org/10.1016/j.surg.2008.03.035}, DOI={10.1016/j.surg.2008.03.035}, abstractNote={Background Bile acid (BA) reclamation following ileo-cecal resection (ICR) may prevent colonic mucosa from chronic injury. In this study, we hypothesized that in a murine model of ICR the remnant colon would upregulate the cellular machinery necessary for BA reclamation and would do so in an FXR- and bacteria-dependent manner. Methods Conventional (WT), conventional FXR knockout (FXR null) and germ-free (GF) mice were randomized to undergo either ICR or sham operation. The ascending colon was harvested for histology and immunohistochemistry and changes in bile acid homeostatic gene expression determined by real-time polymerase chain reaction (RT-PCR) 7 days following surgery. Results Following ICR WT mice showed significant increases in the expression of genes regulating bile acid transport including IBABP, Asbt, Ostβ and FGF 15. Increased expression of IBABP and Asbt was confirmed by immunohistochemistry. Induction of bile acid transport genes was absent or attenuated in FXR null and GF mice. Conclusion Bacterial dependent up regulation of IBABP is FXR mediated in the colon following ICR. Mice lacking microbiota (GF) or FXR are unable to increase the expression of IBABP or FGF 15. Bile acid (BA) reclamation following ileo-cecal resection (ICR) may prevent colonic mucosa from chronic injury. In this study, we hypothesized that in a murine model of ICR the remnant colon would upregulate the cellular machinery necessary for BA reclamation and would do so in an FXR- and bacteria-dependent manner. Conventional (WT), conventional FXR knockout (FXR null) and germ-free (GF) mice were randomized to undergo either ICR or sham operation. The ascending colon was harvested for histology and immunohistochemistry and changes in bile acid homeostatic gene expression determined by real-time polymerase chain reaction (RT-PCR) 7 days following surgery. Following ICR WT mice showed significant increases in the expression of genes regulating bile acid transport including IBABP, Asbt, Ostβ and FGF 15. Increased expression of IBABP and Asbt was confirmed by immunohistochemistry. Induction of bile acid transport genes was absent or attenuated in FXR null and GF mice. Bacterial dependent up regulation of IBABP is FXR mediated in the colon following ICR. Mice lacking microbiota (GF) or FXR are unable to increase the expression of IBABP or FGF 15.}, number={2}, journal={Surgery}, publisher={Elsevier BV}, author={Dekaney, Christopher M. and von Allmen, Douglas C. and Garrison, Aaron P. and Rigby, Rachael J. and Lund, P. Kay and Henning, Susan J. and Helmrath, Michael A.}, year={2008}, month={Aug}, pages={174–181} }
 @article{garrison_dekaney_von allmen_henning_helmrath_2008, title={Developmental insight into intestinal adaptation: characterization of intestinal stem cell (ISC) expansion and glucagon-like peptide-2 (GLP-2) actions during murine intestinal development}, volume={207}, ISSN={1072-7515}, url={http://dx.doi.org/10.1016/j.jamcollsurg.2008.06.120}, DOI={10.1016/j.jamcollsurg.2008.06.120}, abstractNote={Garrison, Aaron P. MD; Dekaney, Christopher M. PhD; von Allmen, Douglas C. BS; Henning, Susan J. PhD; Helmrath, Michael A. MD Author Information}, number={3}, journal={Journal of the American College of Surgeons}, publisher={Elsevier BV}, author={Garrison, Aaron P. and Dekaney, Christopher M. and von Allmen, Douglas C. and Henning, Susan J. and Helmrath, Michael A.}, year={2008}, month={Sep}, pages={S55–S56} }
 @article{dekaney_wu_yin_jaeger_2008, title={Regulation of ornithine aminotransferase gene expression and activity by all-transretinoic acid in Caco-2 intestinal epithelial cells}, volume={19}, ISSN={0955-2863}, url={http://dx.doi.org/10.1016/j.jnutbio.2007.09.002}, DOI={10.1016/j.jnutbio.2007.09.002}, abstractNote={Ornithine aminotransferase (OAT) is a crucial enzyme in the synthesis of citrulline and arginine from glutamine/glutamate and proline by enterocytes of the small intestine. However, a role for OAT in intestinal polyamine synthesis and cell growth is not known. All-transretinoic acid (RA), an active metabolite of vitamin A, regulates the activity of several metabolic enzymes related to OAT, including ornithine decarboxylase and arginase, which may influence the function of OAT through effects on substrate (ornithine) availability. The objective of the present study was to test the hypothesis that RA regulates OAT mRNA expression and enzymatic activity in intestinal epithelial cells. Caco-2 cells were cultured for 12–72 h in the presence of 0, 0.01 and 1 μM RA and then used for measurements of OAT mRNA levels and enzyme activity as well as ornithine and polyamines. Treatment with RA induced increases in OAT gene expression and enzymatic activity, which resulted in decreased intracellular concentrations of ornithine and polyamines (putrescine, spermidine and spermine) in a dose-dependent manner. These changes occurred concomitantly with a decrease in the total number of cells, and the increase in OAT activity was due to increased OAT mRNA expression. In cells treated with 1 μM RA, addition of 10 μM putrescine to culture medium restored both cellular levels of polyamines and cell numbers to the values for the control group (without addition of RA). We conclude that exposure of Caco-2 cells to RA induces OAT expression for increasing ornithine catabolism. This leads to a reduced availability of intracellular ornithine for polyamine synthesis, thereby decreasing cell proliferation. These novel findings indicate a functional role for OAT in regulating intestinal polyamine synthesis and growth.}, number={10}, journal={The Journal of Nutritional Biochemistry}, publisher={Elsevier BV}, author={Dekaney, Christopher M. and Wu, Guoyao and Yin, Yu-Long and Jaeger, Laurie A.}, year={2008}, month={Oct}, pages={674–681} }
 @article{garrison_dekaney_von allmen_lund_henning_helmrath_2008, title={T1818 Early Administration of Glucagon-Like Peptide-2 (GLP-2) Following Ileocecal Resection Augments Insulin-Like Growth Factor-I (IGF-I) Signaling During Intestinal Stem Cell Expansion}, volume={134}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(08)62659-1}, DOI={10.1016/S0016-5085(08)62659-1}, number={4}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Garrison, Aaron P. and Dekaney, Christopher M. and von Allmen, Doug C. and Lund, P. Kay and Henning, Susan J. and Helmrath, Michael A.}, year={2008}, month={Apr}, pages={A-569-A-570} }
 @article{dekaney_fong_rigby_lund_henning_helmrath_2007, title={Expansion of intestinal stem cells associated with long-term adaptation following ileocecal resection in mice}, volume={293}, ISSN={0193-1857 1522-1547}, url={http://dx.doi.org/10.1152/ajpgi.00218.2007}, DOI={10.1152/ajpgi.00218.2007}, abstractNote={Sustained increases in mucosal surface area occur in remaining bowel following massive intestinal loss. The mechanisms responsible for expanding and perpetuating this response are not presently understood. We hypothesized that an increase in the number of intestinal stem cells (ISC) occurs following intestinal resection and is an important component of the adaptive response in mice. This was assessed in the jejunum of mice 2–3 days, 4–5 days, 6–7 days, 2 wk, 6 wk, and 16 wk following ileocecal resection (ICR) or sham operation. Changes in ISC following ICR compared with sham resulted in increased crypt fission and were assayed by 1) putative ISC population (SP) by flow cytometry, 2) Musashi-1 immunohistochemistry, and 3) bromodeoxyuridine (BrdU) label retention. Observed early increases in crypt depth and villus height were not sustained 16 wk following operation. In contrast, long-term increases in intestinal caliber and overall number of crypts per circumference appear to account for the enhanced mucosal surface area following ICR. Flow cytometry demonstrated that significant increases in SP cells occur within 2–3 days following resection. By 7 days, ICR resulted in marked increases in crypt fission and Musashi-1 immunohistochemistry staining. Separate label-retention studies confirmed a 20-fold increase in BrdU incorporation 6 wk following ICR, confirming an overall increase in the number of ISC. These studies support that expansion of ISC occurs following ICR, leading to an overall increase number of crypts through a process of fission and intestinal dilation. Understanding the mechanism expanding ISCs may provide important insight into management of intestinal failure.}, number={5}, journal={American Journal of Physiology-Gastrointestinal and Liver Physiology}, publisher={American Physiological Society}, author={Dekaney, Christopher M. and Fong, Jerry J. and Rigby, Rachael J. and Lund, P. Kay and Henning, Susan J. and Helmrath, Michael A.}, year={2007}, month={Nov}, pages={G1013–G1022} }
 @article{helmrath_fong_dekaney_henning_2007, title={Rapid expansion of intestinal secretory lineages following a massive small bowel resection in mice}, volume={292}, ISSN={0193-1857 1522-1547}, url={http://dx.doi.org/10.1152/ajpgi.00188.2006}, DOI={10.1152/ajpgi.00188.2006}, abstractNote={Following massive small bowel resection (SBR) in mice, there are sustained increases in crypt depth and villus height, resulting in enhanced mucosal surface area. The early mechanisms responsible for resetting and sustaining this increase are presently not understood. We hypothesized that expansion of secretory lineages is an early and sustained component of the adaptive response. This was assessed in the ileum by quantitative morphometry at 12 h, 36 h, 7 days, and 28 days and by quantitative RT-PCR of marker mRNAs for proliferation and differentiated goblet, Paneth cell, and enterocyte genes at 12 h after 50% SBR or sham operation. As predicted, SBR elicited increases of both crypt and villus epithelial cells, which were sustained though the 28 days of the experiment. Significant increases in the overall number and percentage of both Paneth and goblet cells within intestinal epithelium occurred by 12 h and were sustained up to 28 days after SBR. The increases of goblet cells after SBR were initially observed within villi at 12 h, with marked increases occurring in crypts at 36 h and 7 days. Consistent with this finding, qRT-PCR demonstrated significant increases in the expression of mRNAs associated with proliferation (c-myc) and differentiated goblet cells (Tff3, Muc2) and Paneth cells (lysozyme), whereas mRNA associated with differentiated enterocytes (sucrase-isomaltase) remained unchanged. From these data, we speculate that early expansion of intestinal secretory lineages within the epithelium of the ileum occurs following SBR, possibly serving to amplify the signal responsible for initiating and sustaining intestinal adaptation.}, number={1}, journal={American Journal of Physiology-Gastrointestinal and Liver Physiology}, publisher={American Physiological Society}, author={Helmrath, Michael A. and Fong, Jerry J. and Dekaney, Christopher M. and Henning, Susan J.}, year={2007}, month={Jan}, pages={G215–G222} }
 @article{dekaney_fong_rodriguez_henning_helmrath_2006, title={Massive small bowel resection results in sustained increases in intestinal stem cell number}, volume={130}, ISSN={0022-4804}, url={http://dx.doi.org/10.1016/j.jss.2005.11.262}, DOI={10.1016/j.jss.2005.11.262}, number={2}, journal={Journal of Surgical Research}, publisher={Elsevier BV}, author={Dekaney, C.M. and Fong, J. and Rodriguez, J.M. and Henning, S.J. and Helmrath, M.A.}, year={2006}, month={Feb}, pages={253} }
 @article{dekaney_rodriguez_graul_henning_2006, title={Reply}, volume={130}, ISSN={0016-5085}, url={http://dx.doi.org/10.1053/J.GASTRO.2006.01.076}, DOI={10.1053/J.GASTRO.2006.01.076}, abstractNote={We thank Alison et al for their comments, which have given us the opportunity to discuss some important issues related to our paper. First, we would like to emphasize that in all tissues the study of stem cells has been greatly facilitated by the development of methods for sorting viable cells. Thus, the fact that bone marrow hematopoietic stem cells are by far the best characterized stem cell population reflects the ease of obtaining single cell suspensions from bone marrow. For the small intestinal epithelium our paper is, to our knowledge, the first published description of methods for generating viable single cell suspensions suitable for cell sorting and the first reported isolation of a viable subpopulation enriched for putative intestinal epithelial stem cells. At first glance the paper by Asakura and Rudnicki1Asakura A. Rudnicki M.A. Side population cells from diverse adult tissues are capable of in vitro hematopoietic differentiation.Exp Hematol. 2002; 30: 1339-1345Abstract Full Text Full Text PDF PubMed Scopus (291) Google Scholar may appear to be a precedent; however, the key issue is that the purpose of that study was to isolate CD45-positive SP cells from various tissues and to test their hematopoietic potential. Although these authors reported in Table 3 that 77% of the intestinal SP was CD45-negative, they made no further investigation of, nor comment on, these cells. Based on our experience we believe that the digestion conditions used would have released epithelial cells as sheets rather than single cells. Thus, these CD45-negative intestinal SP cells were most probably derived from the lamina propria rather than the epithelium and are not equivalent to those reported in our paper. Alison et al had 3 concerns regarding our conclusion that our CD45-negative SP preparations are enriched for epithelial stem cells. Their first concern related to markers. The critical issue here is that, at the time this manuscript was submitted, Musashi-1 was the best candidate marker for intestinal epithelial stem cells. Based on the fact that Musashi-1 mRNA was enriched in the CD45-negative SP fraction (Figure 8) and not in any other fraction (data not shown), we still believe it is reasonable to conclude that the cells expressing Musashi-1 are captured in the SP. In view of the presence of lineage markers, we recognized that the preparations are “not by any means pure” and that the EDTA/SP almost certainly includes “significant numbers of transit amplifying cells” (Discussion p. 1578). This is tantamount to saying that the preparation is enriched in crypt-base cells as Alison et al suggest. Based on the known expression of several ABC transporters (including ABCG2 which is also known as Bcrp1) on the brush border of villus epithelial cells, we, like Alison et al were initially concerned that these cells would efflux Hoechst and thus fractionate into the SP. On closer examination of the literature, however, we discovered that expression of ABCG2 is not sufficient to cause cells to sort into the SP. Thus for example, Zhou et al2Zhou S. Schuetz J.D. Bunting K.D. Colapietro A.M. Sampath J. Morris J.J. Lagutina I. Grosveld G.C. Osawa M. Nakauchi H. Sorrentino B.P. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype.Nat Med. 2001; 7: 1028-1034Crossref PubMed Scopus (1992) Google Scholar found that murine ES cells displayed equivalent expression of ABCG2 in SP and non-SP fraction and concluded that “the SP phenotype requires additional cellular characteristics aside from Bcrp1 expression.” In our study, if ABCG2 on villus epithelial cells caused them to sort into the SP, the proportion of cells found in this fraction would have been very much higher than the 1%–2% we reported. The final point is that we purposefully called these cells “putative intestinal stem cells” (PISC), in the title and throughout the paper, in acknowledgment of the fact that, as yet, we have no functional evidence that they are indeed stem cells. It is our belief that “definitive proof” related to this or any other preparation of PISC, will require the efforts of many laboratories and that our report should be viewed merely as a “valuable first step” (Discussion p. 1578). For the small intestine, lack of methods for even generating viable single cell suspensions has been a major impediment to the study of epithelial stem cells. In publishing our paper we had hoped to stimulate the field by enabling other investigators to explore alternate sorting strategies and to develop much-needed functional assays. We ourselves are further characterizing the CD45-negative SP by microarray analysis, at the same time as exploring both in vivo and in vitro conditions which will allow assessment of “stemness.” Isolation of Gut SP Cells Does Not Automatically Enrich for Stem CellsGastroenterologyVol. 130Issue 3PreviewWe read with great interest the article by Dekaney et al1 describing the survivability (for 2 weeks in culture) of an SP fraction isolated from normal and neonatal mouse jejunum. This achievement confirms earlier but uncited data of Asakura and Rudnicki2 who established that there was a substantial verapamil-sensitive Hoechst 33342 side population (∼8%) in cells dissociated from adult mouse small intestine; they further tested their hematopoietic potential in culture and reported that three quarters of the SP was CD45-negative. Full-Text PDF}, number={3}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Dekaney, Christopher M. and Rodriguez, Jose M. and Graul, M. Colleen and Henning, Susan J.}, year={2006}, month={Mar}, pages={1013–1014} }
 @article{dekaney_rodriguez_graul_henning_2005, title={Isolation and Characterization of a Putative Intestinal Stem Cell Fraction From Mouse Jejunum}, volume={129}, ISSN={0016-5085}, url={http://dx.doi.org/10.1053/j.gastro.2005.08.011}, DOI={10.1053/j.gastro.2005.08.011}, abstractNote={Background & Aims: Although there have been many recent advances regarding the biology of intestinal stem cells, the field has been hampered significantly by the lack of a method to isolate these cells. Therefore, the aim of this study was to explore the hypothesis that viable intestinal stem cells can be isolated as a side population (SP) by fluorescence-activated cell sorting after staining with the DNA-binding dye Hoechst 33342. Methods: Preparations of individual cells from either whole mucosa or epithelium of mouse jejunum were stained with Hoechst 33342 and propidium iodide and then sorted using fluorescence-activated cell sorting. Cells were characterized using fluorochrome-labeled antibodies to surface markers, intracellular markers, and annexin V to detect early apoptosis. Total RNA was isolated from sorted fractions and used for quantitative real-time reverse-transcription polymerase chain reaction to evaluate the expression of cell lineage markers and the intestinal stem-cell marker, Musashi-1. Results: Adult and neonatal jejunum contain a viable population of cells that shows the SP phenotype and is sensitive to verapamil. This population of cells (from both mucosal and epithelial preparations) includes a CD45-negative fraction corresponding to nonhematopoietic cells, which shows minimal expression of surface markers typically found on stem cells from other tissues and of intracellular markers found in mesenchymal cells. Additionally, these cells were enriched for Musashi-1 and β1-integrin, were cytokeratin positive, and survived in culture for up to 14 days. Conclusions: The CD45-negative SP fraction, although not pure, represents the successful isolation of a viable population significantly enriched in small intestinal epithelial stem cells. Background & Aims: Although there have been many recent advances regarding the biology of intestinal stem cells, the field has been hampered significantly by the lack of a method to isolate these cells. Therefore, the aim of this study was to explore the hypothesis that viable intestinal stem cells can be isolated as a side population (SP) by fluorescence-activated cell sorting after staining with the DNA-binding dye Hoechst 33342. Methods: Preparations of individual cells from either whole mucosa or epithelium of mouse jejunum were stained with Hoechst 33342 and propidium iodide and then sorted using fluorescence-activated cell sorting. Cells were characterized using fluorochrome-labeled antibodies to surface markers, intracellular markers, and annexin V to detect early apoptosis. Total RNA was isolated from sorted fractions and used for quantitative real-time reverse-transcription polymerase chain reaction to evaluate the expression of cell lineage markers and the intestinal stem-cell marker, Musashi-1. Results: Adult and neonatal jejunum contain a viable population of cells that shows the SP phenotype and is sensitive to verapamil. This population of cells (from both mucosal and epithelial preparations) includes a CD45-negative fraction corresponding to nonhematopoietic cells, which shows minimal expression of surface markers typically found on stem cells from other tissues and of intracellular markers found in mesenchymal cells. Additionally, these cells were enriched for Musashi-1 and β1-integrin, were cytokeratin positive, and survived in culture for up to 14 days. Conclusions: The CD45-negative SP fraction, although not pure, represents the successful isolation of a viable population significantly enriched in small intestinal epithelial stem cells. Among the mammalian tissues that show continuous renewal (bone marrow, skin, and gastrointestinal epithelium), the epithelium of the small intestine has by far the highest rate of turnover. In both rodents and humans, the majority of cells within the epithelium are replaced every 3–4 days.1Lipkin M. Growth and development of gastrointestinal cells.Annu Rev Physiol. 1985; 47: 175-197Crossref PubMed Google Scholar Three principal cell lineages are found on the villi, namely: (1) absorptive cells (also called enterocytes), which are by far the dominant lineage, making up more than 90% of total cells; (2) goblet cells (also called mucus cells), comprising 8%–10% of the villus population; and (3) enteroendocrine cells (a diverse group), comprising approximately 1% of the epithelium.2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1093) Google Scholar, 3Wright N.A. Epithelial stem cell repertoire in the gut clues to the origin of cell lineages, proliferative units and cancer.Int J Exp Pathol. 2000; 81: 117-143Crossref PubMed Scopus (134) Google Scholar A fourth lineage, namely the Paneth cells, arise from downward migration and are found at the very base of the crypts.2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1093) Google Scholar, 3Wright N.A. Epithelial stem cell repertoire in the gut clues to the origin of cell lineages, proliferative units and cancer.Int J Exp Pathol. 2000; 81: 117-143Crossref PubMed Scopus (134) Google Scholar Pioneering studies by Cheng and Leblond2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1093) Google Scholar in the early 1970s suggested that undifferentiated cells (which they called crypt-base columnar cells) located in the intestinal crypts just above the Paneth cells may serve as multipotent stem cells responsible for the generation of all 4 lineages of the small intestinal epithelium. These studies relied on the observation that at early times after administration of 3H-thymidine, cells damaged by the local radiation were phagocytosed only by the crypt-base columnar cells. Subsequently, phagocytic fragments could be detected in cells of all 4 lineages.2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1093) Google Scholar Although there has been some debate as to the alternate origin of enteroendocrine cells,3Wright N.A. Epithelial stem cell repertoire in the gut clues to the origin of cell lineages, proliferative units and cancer.Int J Exp Pathol. 2000; 81: 117-143Crossref PubMed Scopus (134) Google Scholar the Unitarian Hypothesis, as it was called,2Cheng H. Leblond C.P. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine V. Unitarian theory of the origin of the four epithelial cell types.Am J Anat. 1974; 141: 537-562Crossref PubMed Scopus (1093) Google Scholar has stood the test of time. As reviewed in detail by Gordon et al,4Gordon J.I. Schmidt G.H. Roth K.A. Studies of intestinal stem cells using normal, chimeric, and transgenic mice.FASEB J. 1992; 6: 3039-3050Crossref PubMed Scopus (132) Google Scholar in the mid-1980s supporting evidence came from studies of mice chimeras in which the parental origin of intestinal epithelial cells could be identified by lectin staining. More recently, unequivocal confirmation of the hypothesis has been forthcoming from studies in which adult mice with intestinal epithelium that normally stains negative for the lectin Dolichos biflorus agglutinin are subjected to mutagenesis.5Bjerknes M. Cheng H. Clonal analysis of mouse intestinal epithelial progenitors.Gastroenterology. 1999; 116: 7-14Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar This leads to the appearance of lectin-positive ribbons of cells, some of which persist for very long periods of time (>150 days) and thus presumably reflect mutagenesis of a crypt stem cell. The lectin-positive ribbons were found to include all 4 lineages, thus showing conclusively that all arise from a common stem cell.5Bjerknes M. Cheng H. Clonal analysis of mouse intestinal epithelial progenitors.Gastroenterology. 1999; 116: 7-14Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar Understanding the biology of these stem cells is central to the development of effective rejuvenative therapies for intestinal failure and short-gut syndrome. Moreover, in situations in which the stem cells themselves are damaged, transplantation of healthy stem cells may afford a novel and effective therapy. A critical issue in the study of intestinal epithelial stem cells has been the lack of markers for these cells. Numerous genes are expressed in the crypt compartment but not in the villus6Olsen L. Hansen M. Ekstrom C.T. Troelsen J.T. Olsen J. CVD the intestinal crypt/villus in situ hybridization database.Bioinformatics. 2004; 20: 1327-1328Crossref PubMed Scopus (11) Google Scholar and some, such as EphB2,7Batlle E. Henderson J.T. Beghtel H. van den Born M.M. Sancho E. Huls G. Meeldijk J. Robertson J. van de W.M. Pawson T. Clevers H. Beta-catenin and TCF mediate cell positioning in the intestinal epithelium by controlling the expression of EphB/ephrinB.Cell. 2002; 111: 251-263Abstract Full Text Full Text PDF PubMed Scopus (920) Google Scholar CD44,8Wielenga V.J. Smits R. Korinek V. Smit L. Kielman M. Fodde R. Clevers H. Pals S.T. Expression of CD44 in Apc and Tcf mutant mice implies regulation by the WNT pathway.Am J Pathol. 1999; 154: 515-523Abstract Full Text Full Text PDF PubMed Scopus (427) Google Scholar and Hes1,9Kayahara T. Sawada M. Takaishi S. Fukui H. Seno H. Fukuzawa H. Suzuki K. Hiai H. Kageyama R. Okano H. Chiba T. Candidate markers for stem and early progenitor cells, Musashi-1 and Hes1, are expressed in crypt base columnar cells of mouse small intestine.FEBS Lett. 2003; 535: 131-135Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar display a gradient of increased expression toward the stem-cell zone. However, until very recently, no protein or messenger RNA (mRNA) had been observed to be expressed exclusively in intestinal epithelial stem cells. Although gene expression profiling by microarray analysis, as reported by Stappenbeck et al,10Stappenbeck T.S. Mills J.C. Gordon J.I. Molecular features of adult mouse small intestinal epithelial progenitors.Proc Natl Acad Sci U S A. 2003; 100: 1004-1009Crossref PubMed Scopus (122) Google Scholar provides a promising approach, to date a definitive stem-cell marker has not emerged from these studies. Others have used a candidate gene approach and in early 2003 this proved very fruitful with simultaneous publications by Kayahara et al9Kayahara T. Sawada M. Takaishi S. Fukui H. Seno H. Fukuzawa H. Suzuki K. Hiai H. Kageyama R. Okano H. Chiba T. Candidate markers for stem and early progenitor cells, Musashi-1 and Hes1, are expressed in crypt base columnar cells of mouse small intestine.FEBS Lett. 2003; 535: 131-135Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar and Potten et al.11Potten C.S. Booth C. Tudor G.L. Booth D. Brady G. Hurley P. Ashton G. Clarke R. Sakakibara S. Okano H. Identification of a putative intestinal stem cell and early lineage marker; musashi-1.Differentiation. 2003; 71: 28-41Crossref PubMed Scopus (410) Google Scholar These groups reported, by immunohistochemistry and in situ hybridization, that expression of the RNA-binding protein Musashi-1 (Msi-1) is confined to the stem-cell zone of the intestinal epithelium.9Kayahara T. Sawada M. Takaishi S. Fukui H. Seno H. Fukuzawa H. Suzuki K. Hiai H. Kageyama R. Okano H. Chiba T. Candidate markers for stem and early progenitor cells, Musashi-1 and Hes1, are expressed in crypt base columnar cells of mouse small intestine.FEBS Lett. 2003; 535: 131-135Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 11Potten C.S. Booth C. Tudor G.L. Booth D. Brady G. Hurley P. Ashton G. Clarke R. Sakakibara S. Okano H. Identification of a putative intestinal stem cell and early lineage marker; musashi-1.Differentiation. 2003; 71: 28-41Crossref PubMed Scopus (410) Google Scholar This protein, which is known to play a key role in asymmetric cell division by neural stem cells,12Sakakibara S. Imai T. Hamaguchi K. Okabe M. Aruga J. Nakajima K. Yasutomi D. Nagata T. Kurihara Y. Uesugi S. Miyata T. Ogawa M. Mikoshiba K. Okano H. Mouse-Musashi-1, a neural RNA-binding protein highly enriched in the mammalian CNS stem cell.Dev Biol. 1996; 176: 230-242Crossref PubMed Scopus (459) Google Scholar thus has become a marker for intestinal epithelial stem cells. More recent studies have shown that within the murine intestine members of the BMP and Wnt signaling pathways, phospho-PTEN and phosphor-AKT, also localize to intestinal stem cells.13He X.C. Zhang J. Tong W.G. Tawfik O. Ross J. Scoville D.H. Tian Q. Zeng X. He X. Wiedemann L.M. Mishina Y. Li L. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-beta-catenin signaling.Nat Genet. 2004; 36: 1117-1121Crossref PubMed Scopus (840) Google Scholar, 14Tian Q. Feetham M.C. Tao W.A. He X.C. Li L. Aebersold R. Hood L. Proteomic analysis identifies that 14-3-3zeta interacts with beta-catenin and facilitates its activation by Akt.Proc Natl Acad Sci U S A. 2004; 101: 15370-15375Crossref PubMed Scopus (122) Google Scholar These findings represent significant advances in the understanding of intestinal stem-cell biology. Unfortunately, because of the nature of these proteins, they are of limited use for identifying isolated intestinal stem cells. Despite extensive studies on the kinetics of intestinal epithelial stem cells, in both physiologic and pathologic states, efforts to isolate these cells have met with little success. For the colonic epithelium, fluorescence-activated cell sorting (FACS) based on expression of β1-integrin yields a viable population but affords only 3-fold enrichment of clonogenic activity over unsorted cells.15Fujimoto K. Beauchamp R.D. Whitehead R.H. Identification and isolation of candidate human colonic clonogenic cells based on cell surface integrin expression.Gastroenterology. 2002; 123: 1941-1948Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 16Whitehead R.H. Demmler K. Rockman S.P. Watson N.K. Clonogenic growth of epithelial cells from normal colonic mucosa from both mice and humans.Gastroenterology. 1999; 117: 858-865Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar Although a combination of surface markers is likely to be more effective, as is the case with bone marrow stem cells,17Spangrude G.J. Smith L. Uchida N. Ikuta K. Heimfeld S. Friedman J. Weissman I.L. Mouse hematopoietic stem cells.Blood. 1991; 78: 1395-1402PubMed Google Scholar to date the lack of identification of an appropriate set of such markers has hindered this classic cell-sorting approach. Thus, we chose to explore an alternate method based on recent studies that have shown that stem cells from bone marrow18Goodell M.A. Brose K. Paradis G. Conner A.S. Mulligan R.C. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo.J Exp Med. 1996; 183: 1797-1806Crossref PubMed Scopus (2454) Google Scholar and other various tissues can be isolated as a side population (SP) by FACS after staining with the DNA-binding dye Hoechst 33342.19Alvi A.J. Clayton H. Joshi C. Enver T. Ashworth A. Vivanco M.M. Dale T.C. Smalley M.J. Functional and molecular characterisation of mammary side population cells.Breast Cancer Res. 2003; 5: R1-R8Crossref PubMed Scopus (3) Google Scholar, 20Shimano K. Satake M. Okaya A. Kitanaka J. Kitanaka N. Takemura M. Sakagami M. Terada N. Tsujimura T. Hepatic oval cells have the side population phenotype defined by expression of ATP-binding cassette transporter ABCG2/BCRP1.Am J Pathol. 2003; 163: 3-9Abstract Full Text Full Text PDF PubMed Scopus (183) Google Scholar, 21Oh H. Bradfute S.B. Gallardo T.D. Nakamura T. Gaussin V. Mishina Y. Pocius J. Michael L.H. Behringer R.R. Garry D.J. Entman M.L. Schneider M.D. Cardiac progenitor cells from adult myocardium homing, differentiation, and fusion after infarction.Proc Natl Acad Sci U S A. 2003; 100: 12313-12318Crossref PubMed Scopus (1491) Google Scholar, 22Wulf G.G. Luo K.L. Jackson K.A. Brenner M.K. Goodell M.A. Cells of the hepatic side population contribute to liver regeneration and can be replenished with bone marrow stem cells.Haematologica. 2003; 88: 368-378PubMed Google Scholar, 23Welm B.E. Tepera S.B. Venezia T. Graubert T.A. Rosen J.M. Goodell M.A. Sca-1(pos) cells in the mouse mammary gland represent an enriched progenitor cell population.Dev Biol. 2002; 245: 42-56Crossref PubMed Scopus (449) Google Scholar, 24Asakura A. Seale P. Girgis-Gabardo A. Rudnicki M.A. Myogenic specification of side population cells in skeletal muscle.J Cell Biol. 2002; 159: 123-134Crossref PubMed Scopus (566) Google Scholar, 25Oyama K. Nakagawa H. Harada H. Andl C. Takaoka M. Rustgi A.K. Murine oral-epithelial cells have a subpopulation of potential stem cells.Gastroenterology. 2003; 124: A-457Abstract Full Text PDF Google Scholar By using this technique, we identified mouse intestinal SP cells and showed that these cells are distinct from hematopoietic stem cells and their progeny based on the absence of surface markers for CD45, c-kit, and CD34. Moreover, RNA prepared from CD45-negative intestinal SP cells was found to be enriched for Msi-1, leading us to conclude that the cells of this fraction are putative intestinal stem cells (PISCs). All mice were housed in our animal facility under a 12-hour light/dark cycle and were allowed unlimited access to rodent Lab Chow #5001 (PMI Nutrition International, Brentwood, MO) and acidified tap water. Experimental procedures were approved by the Institutional Animal Care and Use Committee of Baylor College of Medicine. Mucosal cells were prepared from jejunum of adult male and neonatal (postnatal days 7–14) C57Bl/6J mice by a modification of the protocol outlined by Evans et al.26Evans G.S. Flint N. Somers A.S. Eyden B. Potten C.S. The development of a method for the preparation of rat intestinal epithelial cell primary cultures.J Cell Sci. 1992; 101: 219-231Crossref PubMed Google Scholar Briefly, jejunum was removed and flushed with Hank’s buffered saline solution (HBSS) and split open lengthwise. The jejunum then was cut into pieces approximately 3 mm in length and washed 6 times on an orbital shaker in 20 mL of HBSS (80 rpm). Next, the pieces were cut into 1-mm pieces and shaken (80 rpm) in HBSS containing 15 U/mL type III collagenase (Sigma, St. Louis, MO) and 0.3 U/mL dispase (Invitrogen, Carlsbad, CA) at room temperature for 1 hour. The digested tissue was pipetted up and down for 15 minutes and transferred to a conical tube, after which fetal bovine serum (FBS) was added to 5% to inhibit collagenase/dispase activity. The dissociated tissue was allowed to sediment under gravity for 1 minute and then the supernatant was removed into a new tube and sedimentation was repeated twice. The resulting supernatant was centrifuged at 300 rpm for 3 minutes and the pellet was collected. This was repeated once. The cell pellets were combined in HBSS containing 5% FBS and passed through a 70-μm filter. This method is not specific for the epithelium, but rather digests both the epithelium and some of the underlying stromal tissue (but not muscle layers). Thus, throughout the text we refer to these digests as mucosal preparations. Intestinal epithelial cells were prepared from jejunum of adult male C57Bl/6J mice by a modification of the protocol outlined by Bjerknes and Cheng.27Bjerknes M. Cheng H. Methods for the isolation of intact epithelium from the mouse intestine.Anat Rec. 1981; 199: 565-574Crossref PubMed Scopus (157) Google Scholar Briefly, jejunum was removed, flushed with phosphate buffered saline, and everted on a glass rod. The glass rod was immersed and vibrated in Ca2+/Mg2+-free phosphate-buffered saline containing 30 mmol/L ethylenediaminetetraacetic acid (EDTA) for 20–25 minutes to yield individual crypts and villi. These were pelleted at 500 rpm for 5 minutes. The pellet was resuspended in HBSS containing 0.3 U/mL dispase to digest the epithelium into individual cells and incubated at 37°C for 10 minutes, after which FBS was added to the final concentration of 5% to inhibit dispase activity. The cells then were passed through a 70-μm filter. FACS was performed using the Hoechst 33342 staining method outlined by Goodell et al.18Goodell M.A. Brose K. Paradis G. Conner A.S. Mulligan R.C. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo.J Exp Med. 1996; 183: 1797-1806Crossref PubMed Scopus (2454) Google Scholar Preliminary experiments using 5, 6, 7, or 8 μg/mL Hoechst 33342 (Sigma) showed that the higher concentrations resulted in reduced cellular viability with minimal changes in the SP staining pattern. Therefore, isolated intestinal mucosal or epithelial cells were suspended routinely at 106 cells/mL in HBSS containing 2% FBS and 5 μg/mL Hoechst 33342. After incubation at 37°C for 90 minutes, cells were centrifuged at 700 rpm for 5 minutes at 4°C and resuspended in cold HBSS containing 2% FBS to a concentration of 106 cells/100 μL. Next, cells were incubated with fluorescein isothiocyanate (FITC)-labeled anti-CD45 antibody (BD Pharmingen, San Diego, CA) at a 1:100 dilution on ice for 10 minutes. After washing, cells were resuspended in cold HBSS containing 2 μg/mL propidium iodide (PI) to exclude dead cells, and kept at 4°C until sorting. A 350-nm argon laser was used to excite Hoechst 33342 and PI. Analysis was performed on a triple-laser MoFlow instrument (DakoCytomation, Inc., Fort Collins, CO) at 405/30 (Hoechst blue) and 670/30 nm (Hoechst red), as described previously.18Goodell M.A. Brose K. Paradis G. Conner A.S. Mulligan R.C. Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo.J Exp Med. 1996; 183: 1797-1806Crossref PubMed Scopus (2454) Google Scholar A second argon laser, tuned to 488-mm emission, excited FITC. The CD45-positive fraction was sorted and eliminated. Simultaneously, the SP was identified and selected by gating on the characteristic emission fluorescence profile of SP cells. Sorted cell populations were recovered in HBSS with 10% fetal calf serum and pelleted for RNA isolation or cytospun onto coated slides for histology and immunocytochemistry. Jejunal tissue from before and after EDTA epithelial isolation was fixed overnight in 10% normal buffered formalin and embedded in paraffin. Sections were cut, and along with cytospun CD45-negative SP cells, were stained by routine H&E. Slides of cytospun CD45-negative SP cells also were used to determine the expression of cytokeratins and α-smooth muscle actin by immunocytochemistry. Briefly, cells were fixed and permeabilized using the Intrastain Kit (DakoCytomation, Carpinteria, CA) according to the manufacturer’s directions and cytospun to plus-coated slides. Next, slides were quenched in sodium borohydride (0.01 g/mL) for 30 minutes at room temperature, blocked in phosphate-buffered saline/1% normal goat serum for 30 minutes at room temperature, and then incubated with a monoclonal anti-pan cytokeratin-FITC (clone C-11; Sigma) or a monoclonal anti–α-smooth muscle actin-FITC (clone 1A4; Sigma) at 1:50 dilutions and 1 hour and 30 minutes, respectively. Slides were coverslipped using Vectashield mounting medium with DAPI (Vector Labs, Burlingame, CA) and sealed. Slides were evaluated using an Olympus 1X71 inverted microscope (Melville, NY) and processed with DeltaVision deconvolution (Applied Precision, Issaquah, WA). To characterize the intestinal SP, we analyzed it by FACS for the presence of hematopoietic stem-cell markers including sca-1, c-kit, Thy-1.2, and CD34 and for the epithelial stem cell marker β1-integrin. After staining with Hoechst 33342, aliquots of cells were labeled with CD45 (FITC or phycoerythrin [PE] conjugated) antibody in combination with either Sca-1–PE, c-kit-allophycocyanin (APC), Thy-1.2-PE, CD34-biotin, or β1-integrin-FITC antibodies. Biotinylated antibodies were detected with streptavidin APC. Cells were incubated for 15 minutes at 4°C. Cells then were centrifuged at 1000 × g for 5 minutes at 4°C, and the pellet was resuspended in cold HBSS containing 2 μg/mL PI to exclude dead cells, and kept at 4°C until sorting. The activities of the antibodies against hematopoietic stem-cell markers were verified by analogous FACS of murine bone marrow (data not shown). To determine the percentage of CD45-negative SP cells that were in the early stages of apoptosis, we used the Annexin V Apoptosis Detection Kit (CalBiochem, San Diego, CA) according to the manufacturer’s directions. Briefly, mucosal cells isolated as outlined earlier were resuspended in HBSS/5% FBS to a concentration of 106 cells/mL and stained with Hoechst 33342 as described earlier. Annexin V–FITC and anti-CD45–PE were added simultaneously to the cell suspension at 1:400 and 1:100 dilutions, respectively. Cells were incubated for 15 minutes at 4°C. Cells then were centrifuged at 1000 × g for 5 minutes at 4°C and the pellet was resuspended in cold HBSS containing 2 μg/mL PI to exclude dead cells and kept at 4°C until sorting. Jejunal tissue from 2 adult C57Bl/6J mice was pooled for digestion, staining, and FACS as described earlier. Cells were collected from the CD45-negative SP and non-SP fractions. The experiment was repeated twice, giving n = 3 for the number of RNA samples, representing 6 mice in all. Total RNA was extracted from all fractions using RNAqueous-Micro Kit (Ambion, Inc., Austin, TX) according to the manufacturer’s directions and treated with DNase I. The concentration of isolated total RNA was calculated from the absorbance at 260 nm obtained using a NanoDrop 1000 spectrophotometer (NanoDrop Technologies, Inc., Rockland, DE). Real-time reverse-transcription polymerase chain reaction was performed using an Applied Biosystems 7700 sequence detector on 1 ng of RNA using the Taqman One-step reverse-transcription polymerase chain reaction Master Mix Reagents Kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. Primer and probe sets were generated from the following sources: Musashi-111Potten C.S. Booth C. Tudor G.L. Booth D. Brady G. Hurley P. Ashton G. Clarke R. Sakakibara S. Okano H. Identification of a putative intestinal stem cell and early lineage marker; musashi-1.Differentiation. 2003; 71: 28-41Crossref PubMed Scopus (410) Google Scholar, 18S ribosomal RNA, β-actin, nuclear fragile X interacting protein, lysozyme (Assay-on-Demand; Applied Biosystems), collagen IV, sucrase–isomaltase, and intestinal trefoil factor 3 (sequences shown in Table 1). For each probe the reporter dye was 6-FAM and the quenching dye was TAMRA. Data were analyzed using the ΔΔCt method28ABI PRISM 7700 sequence detection system.User bulletin #2. PE Applied Biosystems, Foster City, CA2001Google Scholar, 29Schmittgen T.D. Zakrajsek B.A. Mills A.G. Gorn V. Singer M.J. Reed M.W. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay comparison of endpoint and real-time methods.Anal Biochem. 2000; 285: 194-204Crossref PubMed Scopus (838) Google Scholar with 18S ribosomal RNA or β-actin mRNA as the constitutive marker. Pooled RNA from intact jejunums of 6 adult C57Bl/6J mice was used as the reference.Table 1Sequences of Custom-Made Primers and Probes for Quantitative Reverse-Transcription Polymerase Chain ReactionGeneAccession no.PrimerSequenceCollagenX04647FCCAGGAATATTTGGCTTGCAAIVRCAGAGCTCCCCTCATCTCCTTPACCACCTGGGCCAAACGCACTTCSucrase–isomaltaseXM_143332FTTCAAGAAATCACAACATTCAATTTACTAGRCTAAAACTTTCTTTGACATTTGAGCAAPAGTTTCATTCCAGGAAACAGGATCTTGCCTTFF3BC011042FTTGCTGGGTCCTCTGGGATARGCCGGCACCATACATTGGPCTGCAGATTACGTTGGCCTGTCTCCAANOTE. F, R, and P denote forward primer, reverse primer, and probe, respectively. Open table in a new tab NOTE. F, R, and P denote forward primer, reverse primer, and probe, respectively. Collected CD45-negative SP cells were plated in 24-well Primaria plates (BD Biosciences, San Jose, CA) at a density of 30,000 cells/well. The cells were cultured in high-glucose Dulbecco’s modified Eagle medium supplemented with 10% FBS, 10 μg/mL insulin, 2 mmol/L glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin and maintained in a humidified 37°C incubator in an atmosphere of 95% air/5% CO2. Cells were cultured for a minimum of 14 days and remained unattached to the culture dish for that entire culture time. For assay of viability, aliquots of cells at 0, 7, and 14 days of culture were removed, added to an equal volume of Trypan blue (0.4%), and counted in a hemocytometer. Both mincing and digesting of intact jejunum with collagenase/dispase (mucosal preparation) and stripping of epithelium by EDTA (epithelial preparation) followed by dispase dissociation yielded mucus-free suspensions of individual cells suitable for FACS. The cell suspensions were stained with Hoechst 33342 and costained with both FITC-labeled anti-CD45 to eliminate cells of hematopoietic origin and PI to identify dead cells. Typical results of dual-wavelength FACS of viable cells based on the Hoechst fluorescence are shown in Figure 1. As can be seen in Figure 1 (top panel), a distinct SP was present with both whole mucosal preparations (Figure 1A) and epithelial preparations (Figure 1B). The use of antibodies to the pan leukocyte surface marker}, number={5}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Dekaney, Christopher M. and Rodriguez, Jose M. and Graul, M. Colleen and Henning, Susan J.}, year={2005}, month={Nov}, pages={1567–1580} }
 @article{helmrath_fong_dekaney_henning_2004, title={Early activation of Wnt β-catenin system following a massive small bowel resection in mice}, volume={121}, ISSN={0022-4804}, url={http://dx.doi.org/10.1016/j.jss.2004.07.140}, DOI={10.1016/j.jss.2004.07.140}, abstractNote={<h2>Abstract</h2> <b>Introduction.</b> Recent evidence supports a role for the Wnt β-catenin system in the regulation of intestinal proliferation, migration, and differentiation towards secretory lineages in mature epithelium. The observation that early increased allocation of secretory lineages (Paneth, goblet, and enteroendocrine cells) within intestinal epithelium occurs following a massive small bowel resection (SBR) suggest activation of the Wnt β-catenin system may initiate the adaptive response following resection. The purpose of this study was to determine early changes in gene expression of the soluble intestinal Wnts and their downstream targets responsible for proliferation (<i>c-myc</i>), migration (EphrinB1 and B2), and Paneth cell differentiation (EphB3). <b>Methods.</b> Male mice (C57/BL6J, 22–25 g) were randomized to either a sham operation (transection and reanastomosis) or 50% SBR (mid-jejunum to proximal ileum). All animals (<i>n</i> = 5–8 per group) were maintained on liquid diet 12 h following surgery. Terminal ileum was harvested at 6 h, 12 h, 36 h, 3 days, and 7 days following surgery and RNA was isolated. Quantitative real-time RT-PCR was utilized to determine the expression of Wnt4, Wnt6, <i>c-myc</i>, EphB3, EphrinB1, and EphrinB2 mRNAs. Fold change between SBR and sham was determined at each time point. Statistical analysis utilized one-way ANOVA (<i>P</i> < 0.05). <b>Results.</b> SBR resulted in early increased expression of Wnt4 (1.6-fold) by 12 h, which returned to baseline by 3 days. Significantly increased expression of <i>c-myc</i> occurred at 36 h (1.9-fold), peaked at 3 days (3.2-fold), and returned to baseline by 7 days. EphB3 (14.3-fold), a marker of Paneth cells, and Ephrin B2 (4.9-fold), peaked at 3 days and returned to baseline by 7 days. <b>Conclusion.</b> Massive intestinal resection results in early increased expression of Wnts, followed by increases in their downstream targets regulating proliferation (c-myc) and differentiation (EphB3) and cell migration (Ephrin B2). Early activation of the Wnt β-catenin pathway may be responsible for initiating intestinal adaptation.}, number={2}, journal={Journal of Surgical Research}, publisher={Elsevier BV}, author={Helmrath, M.A. and Fong, J.J. and Dekaney, C.M. and Henning, H.S.}, year={2004}, month={Oct}, pages={309–310} }