@article{gagnon_maxwell_2015, title={Assessing Intermolecular RNA:RNA Interactions Within a Ribonucleoprotein Complex Using Heavy Metal Cleavage Mapping}, volume={1240}, ISBN={["978-1-4939-1895-9"]}, ISSN={["1064-3745"]}, DOI={10.1007/978-1-4939-1896-6_9}, journal={RNA-RNA INTERACTIONS: METHODS AND PROTOCOLS}, author={Gagnon, Keith T. and Maxwell, E. Stuart}, year={2015}, pages={125–134} }
 @article{gagnon_biswas_zhang_brown_wollenzien_mattos_maxwell_2012, title={Structurally Conserved Nop56/58 N-terminal Domain Facilitates Archaeal Box C/D Ribonucleoprotein-guided Methyltransferase Activity}, volume={287}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.m111.323253}, abstractNote={Box C/D RNA-protein complexes (RNPs) guide the 2'-O-methylation of nucleotides in both archaeal and eukaryotic ribosomal RNAs. The archaeal box C/D and C'/D' RNP subcomplexes are each assembled with three sRNP core proteins. The archaeal Nop56/58 core protein mediates crucial protein-protein interactions required for both sRNP assembly and the methyltransferase reaction by bridging the L7Ae and fibrillarin core proteins. The interaction of Methanocaldococcus jannaschii (Mj) Nop56/58 with the methyltransferase fibrillarin has been investigated using site-directed mutagenesis of specific amino acids in the N-terminal domain of Nop56/58 that interacts with fibrillarin. Extensive mutagenesis revealed an unusually strong Nop56/58-fibrillarin interaction. Only deletion of the NTD itself prevented dimerization with fibrillarin. The extreme stability of the Nop56/58-fibrillarin heterodimer was confirmed in both chemical and thermal denaturation analyses. However, mutations that did not affect Nop56/58 binding to fibrillarin or sRNP assembly nevertheless disrupted sRNP-guided nucleotide modification, revealing a role for Nop56/58 in methyltransferase activity. This conclusion was supported with the cross-linking of Nop56/58 to the target RNA substrate. The Mj Nop56/58 NTD was further characterized by solving its three-dimensional crystal structure to a resolution of 1.7 Å. Despite low primary sequence conservation among the archaeal Nop56/58 homologs, the overall structure of the archaeal NTD domain is very well conserved. In conclusion, the archaeal Nop56/58 NTD exhibits a conserved domain structure whose exceptionally stable interaction with fibrillarin plays a role in both RNP assembly and methyltransferase activity.}, number={23}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Gagnon, Keith T. and Biswas, Shyamasri and Zhang, Xinxin and Brown, Bernard A., II and Wollenzien, Paul and Mattos, Carla and Maxwell, E. Stuart}, year={2012}, month={Jun}, pages={19418–19428} }
 @article{biswas_buhrman_gagnon_mattos_brown_maxwell_2011, title={Comparative Analysis of the 15.5kD Box C/D snoRNP Core Protein in the Primitive Eukaryote Giardia lamblia Reveals Unique Structural and Functional Features}, volume={50}, ISSN={["0006-2960"]}, DOI={10.1021/bi1020474}, abstractNote={Box C/D ribonucleoproteins (RNP) guide the 2′-O-methylation of targeted nucleotides in archaeal and eukaryotic rRNAs. The archaeal L7Ae and eukaryotic 15.5kD box C/D RNP core protein homologues initiate RNP assembly by recognizing kink-turn (K-turn) motifs. The crystal structure of the 15.5kD core protein from the primitive eukaryote Giardia lamblia is described here to a resolution of 1.8 Å. The Giardia 15.5kD protein exhibits the typical α−β−α sandwich fold exhibited by both archaeal L7Ae and eukaryotic 15.5kD proteins. Characteristic of eukaryotic homologues, the Giardia 15.5kD protein binds the K-turn motif but not the variant K-loop motif. The highly conserved residues of loop 9, critical for RNA binding, also exhibit conformations similar to those of the human 15.5kD protein when bound to the K-turn motif. However, comparative sequence analysis indicated a distinct evolutionary position between Archaea and Eukarya. Indeed, assessment of the Giardia 15.5kD protein in denaturing experiments demonstrated an intermediate stability in protein structure when compared with that of the eukaryotic mouse 15.5kD and archaeal Methanocaldococcus jannaschii L7Ae proteins. Most notable was the ability of the Giardia 15.5kD protein to assemble in vitro a catalytically active chimeric box C/D RNP utilizing the archaeal M. jannaschii Nop56/58 and fibrillarin core proteins. In contrast, a catalytically competent chimeric RNP could not be assembled using the mouse 15.5kD protein. Collectively, these analyses suggest that the G. lamblia 15.5kD protein occupies a unique position in the evolution of this box C/D RNP core protein retaining structural and functional features characteristic of both archaeal L7Ae and higher eukaryotic 15.5kD homologues.}, number={14}, journal={BIOCHEMISTRY}, author={Biswas, Shyamasri and Buhrman, Greg and Gagnon, Keith and Mattos, Carla and Brown, Bernard A., II and Maxwell, E. Stuart}, year={2011}, month={Apr}, pages={2907–2918} }
 @article{qu_nues_watkins_maxwell_2011, title={The Spatial-Functional Coupling of Box C/D and C '/D ' RNPs Is an Evolutionarily Conserved Feature of the Eukaryotic Box C/D snoRNP Nucleotide Modification Complex}, volume={31}, ISSN={["1098-5549"]}, DOI={10.1128/mcb.00918-10}, abstractNote={Box C/D ribonucleoprotein particles guide the 2'-O-ribose methylation of target nucleotides in both archaeal and eukaryotic RNAs. These complexes contain two functional centers, assembled around the C/D and C'/D' motifs in the box C/D RNA. The C/D and C'/D' RNPs of the archaeal snoRNA-like RNP (sRNP) are spatially and functionally coupled. Here, we show that similar coupling also occurs in eukaryotic box C/D snoRNPs. The C/D RNP guided 2'-O-methylation when the C'/D' motif was either mutated or ablated. In contrast, the C'/D' RNP was inactive as an independent complex. Additional experiments demonstrated that the internal C'/D' RNP is spatially coupled to the terminal box C/D complex. Pulldown experiments also indicated that all four core proteins are independently recruited to the box C/D and C'/D' motifs. Therefore, the spatial-functional coupling of box C/D and C'/D' RNPs is an evolutionarily conserved feature of both archaeal and eukaryotic box C/D RNP complexes.}, number={2}, journal={MOLECULAR AND CELLULAR BIOLOGY}, author={Qu, Guosheng and Nues, Rob W. and Watkins, Nicholas J. and Maxwell, E. Stuart}, year={2011}, month={Jan}, pages={365–374} }
 @article{gagnon_zhang_qu_biswas_suryadi_brown_maxwell_2010, title={Signature amino acids enable the archaeal L7Ae box C/D RNP core protein to recognize and bind the K-loop RNA motif}, volume={16}, ISSN={["1469-9001"]}, DOI={10.1261/rna.1692310}, abstractNote={The archaeal L7Ae and eukaryotic 15.5kD protein homologs are members of the L7Ae/15.5kD protein family that characteristically recognize K-turn motifs found in both archaeal and eukaryotic RNAs. In Archaea, the L7Ae protein uniquely binds the K-loop motif found in box C/D and H/ACA sRNAs, whereas the eukaryotic 15.5kD homolog is unable to recognize this variant K-turn RNA. Comparative sequence and structural analyses, coupled with amino acid replacement experiments, have demonstrated that five amino acids enable the archaeal L7Ae core protein to recognize and bind the K-loop motif. These signature residues are highly conserved in the archaeal L7Ae and eukaryotic 15.5kD homologs, but differ between the two domains of life. Interestingly, loss of K-loop binding by archaeal L7Ae does not disrupt C′/D′ RNP formation or RNA-guided nucleotide modification. L7Ae is still incorporated into the C′/D′ RNP despite its inability to bind the K-loop, thus indicating the importance of protein–protein interactions for RNP assembly and function. Finally, these five signature amino acids are distinct for each of the L7Ae/L30 family members, suggesting an evolutionary continuum of these RNA-binding proteins for recognition of the various K-turn motifs contained in their cognate RNAs.}, number={1}, journal={RNA}, author={Gagnon, Keith T. and Zhang, Xinxin and Qu, Guosheng and Biswas, Shyamasri and Suryadi, Jimmy and Brown, Bernard A., II and Maxwell, E. Stuart}, year={2010}, month={Jan}, pages={79–90} }
 @article{xue_wang_yang_terns_terns_zhang_maxwel_li_2010, title={Structural Basis for Substrate Placement by an Archaeal Box C/D Ribonucleoprotein Particle}, volume={39}, ISSN={["1097-4164"]}, DOI={10.1016/j.molcel.2010.08.022}, abstractNote={Box C/D small nucleolar and Cajal body ribonucleoprotein particles (sno/scaRNPs) direct site-specific 2'-O-methylation of ribosomal and spliceosomal RNAs and are critical for gene expression. Here we report crystal structures of an archaeal box C/D RNP containing three core proteins (fibrillarin, Nop56/58, and L7Ae) and a half-mer box C/D guide RNA paired with a substrate RNA. The structure reveals a guide-substrate RNA duplex orientation imposed by a composite protein surface and the conserved GAEK motif of Nop56/58. Molecular modeling supports a dual C/D RNP structure that closely mimics that recently visualized by electron microscopy. The substrate-bound dual RNP model predicts an asymmetric protein distribution between the RNP that binds and methylates the substrate RNA. The predicted asymmetric nature of the holoenzyme is consistent with previous biochemical data on RNP assembly and provides a simple solution for accommodating base-pairing between the C/D guide RNA and large ribosomal and spliceosomal substrate RNAs.}, number={6}, journal={MOLECULAR CELL}, author={Xue, Song and Wang, Ruiying and Yang, Fangping and Terns, Rebecca M. and Terns, Michael P. and Zhang, Xinxin and Maxwel, E. Stuart and Li, Hong}, year={2010}, month={Sep}, pages={939–949} }
 @article{bleichert_gagnon_brown_maxwell_leschziner_unger_baserga_2009, title={A Dimeric Structure for Archaeal Box C/D Small Ribonucleoproteins}, volume={325}, ISSN={["1095-9203"]}, DOI={10.1126/science.1176099}, abstractNote={Seeing Double A particular set of ubiquitous small (nucleolar) ribonucleoproteins are important for optimal ribosome function and protein synthesis. Bleichert et al. (p. 1384 ) used electron microscopy and single-particle analysis to investigate the structure of an archaeal version that contains the small RNA (sRNA) and all the associated core proteins. Unexpectedly, this ribonucleoprotein is a homodimer, formed of two sRNAs and four copies of each of the core proteins. This dimer is likely to be the enzymatically active form, as mutations disrupting di-sRNP formation inhibited activity.}, number={5946}, journal={SCIENCE}, author={Bleichert, Franziska and Gagnon, Keith T. and Brown, Bernard A., II and Maxwell, E. Stuart and Leschziner, Andres E. and Unger, Vinzenz M. and Baserga, Susan J.}, year={2009}, month={Sep}, pages={1384–1387} }
 @article{gagnon_ju_goshe_maxwell_franzen_2009, title={A role for hydrophobicity in a DielsAlder reaction catalyzed by pyridyl-modified RNA}, volume={37}, ISSN={["1362-4962"]}, DOI={10.1093/nar/gkp177}, abstractNote={New classes of RNA enzymes or ribozymes have been obtained by in vitro evolution and selection of RNA molecules. Incorporation of modified nucleotides into the RNA sequence has been proposed to enhance function. DA22 is a modified RNA containing 5-(4-pyridylmethyl) carboxamide uridines, which has been selected for its ability to promote a Diels–Alder cycloaddition reaction. Here, we show that DA_TR96, the most active member of the DA22 RNA sequence family, which was selected with pyridyl-modified nucleotides, accelerates a cycloaddition reaction between anthracene and maleimide derivatives with high turnover. These widely used reactants were not used in the original selection for DA22 and yet here they provide the first demonstration of DA_TR96 as a true multiple-turnover catalyst. In addition, the absence of a structural or essential kinetic role for Cu2+, as initially postulated, and nonsequence-specific hydrophobic interactions with the anthracene substrate have led to a reevaluation of the pyridine modification's role. These findings broaden the catalytic repertoire of the DA22 family of pyridyl-modified RNAs and suggest a key role for the hydrophobic effect in the catalytic mechanism.}, number={9}, journal={NUCLEIC ACIDS RESEARCH}, author={Gagnon, Keith T. and Ju, Show-Yi and Goshe, Michael B. and Maxwell, E. Stuart and Franzen, Stefan}, year={2009}, month={May}, pages={3074–3082} }
 @article{tang_maxwell_2008, title={Xenopus microRNA genes are predominantly located within introns and are diffferentially expressed in adult frog tissues via post-transcriptional regulation}, volume={18}, ISSN={["1549-5469"]}, DOI={10.1101/gr.6539108}, abstractNote={The amphibian Xenopus provides a model organism for investigating microRNA expression during vertebrate embryogenesis and development. Searching available Xenopus genome databases using known human pre-miRNAs as query sequences, more than 300 genes encoding 142 Xenopus tropicalis miRNAs were identified. Analysis of Xenopus tropicalis miRNA genes revealed a predominate positioning within introns of protein-coding and nonprotein-coding RNA Pol II-transcribed genes. MiRNA genes were also located in pre-mRNA exons and positioned intergenically between known protein-coding genes. Many miRNA species were found in multiple locations and in more than one genomic context. MiRNA genes were also clustered throughout the genome, indicating the potential for the cotranscription and coordinate expression of miRNAs located in a given cluster. Northern blot analysis confirmed the expression of many identified miRNAs in both X. tropicalis and X. laevis. Comparison of X. tropicalis and X. laevis blots revealed comparable expression profiles, although several miRNAs exhibited species-specific expression in different tissues. More detailed analysis revealed that for some miRNAs, the tissue-specific expression profile of the pri-miRNA precursor was distinctly different from that of the mature miRNA profile. Differential miRNA precursor processing in both the nucleus and cytoplasm was implicated in the observed tissue-specific differences. These observations indicated that post-transcriptional processing plays an important role in regulating miRNA expression in the amphibian Xenopus.}, number={1}, journal={GENOME RESEARCH}, author={Tang, Guo-Qing and Maxwell, E. Stuart}, year={2008}, month={Jan}, pages={104–112} }
 @misc{gagnon_zhang_maxwell_2007, title={In vitro reconstitution and affinity purification of catalytically active archaeal box C/D sRNP complexes}, volume={425}, DOI={10.1016/s0076-6879(07)25012-8}, abstractNote={Archaeal box C/D RNAs guide the site‐specific 2′‐ O ‐methylation of target nucleotides in ribosomal RNAs and tRNAs. In vitro reconstitution of catalytically active box C/D RNPs by use of in vitro transcribed box C/D RNAs and recombinant core proteins provides model complexes for the study of box C/D RNP assembly, structure, and function. Described here are protocols for assembly of the archaeal box C/D RNP and assessment of its nucleotide modification activity. Also presented is a novel affinity purification scheme that uses differentially tagged core proteins and a sequential three‐step affinity selection protocol that yields fully assembled and catalytically active box C/D RNPs. This affinity selection protocol can provide highly purified complex in sufficient quantities not only for biochemical analyses but also for biophysical approaches such as cryoelectron microscopy and X‐ray crystallography.}, journal={RNA modification}, publisher={San Diego: Elsevier academic press inc}, author={Gagnon, K. and Zhang, X. X. and Maxwell, E. S.}, year={2007}, pages={263–282} }
 @article{appel_maxwell_2007, title={Structural features of the guide : target RNA duplex required for archaeal box C/D sRNA-guided nucleotide 2 '-O-methylation}, volume={13}, ISSN={["1469-9001"]}, DOI={10.1261/rna.517307}, abstractNote={Archaeal box C/D sRNAs guide the 2′- O -methylation of target nucleotides using both terminal box C/D and internal C′/D′ RNP complexes. In vitro assembly of a catalytically active Methanocaldococcus jannaschii sR8 box C/D RNP provides a model complex to determine those structural features of the guide:target RNA duplex important for sRNA-guided nucleotide methylation. Watson–Crick pairing of guide and target nucleotides was found to be essential for methylation, and mismatched bases within the guide:target RNA duplex also disrupted nucleotide modification. However, dependence upon Watson–Crick base-paired guide:target nucleotides for methylation was compromised in elevated Mg 2+ concentrations where mismatched target nucleotides were modified. Nucleotide methylation required that the guide:target duplex consist of an RNA:RNA duplex as a target ribonucleotide within a guide RNA:target DNA duplex that was not methylated. Interestingly, D and D′ target RNAs exhibited different levels of methylation when deoxynucleotides were inserted into the target RNA or when target methylation was carried out in elevated Mg 2+ concentrations. These observations suggested that unique structural features of the box C/D and C′/D′ RNPs differentially affect their respective methylation capabilities. The ability of the sR8 box C/D sRNP to methylate target nucleotides positioned within highly structured RNA hairpins suggested that the sRNP can facilitate unwinding of double-stranded target RNAs. Finally, increasing target RNA length to extend beyond those nucleotides that base pair with the sRNA guide sequence significantly increased sRNP turnover and thus nucleotide methylation. This suggests that target RNA interaction with the sRNP core proteins is also important for box C/D sRNP-guided nucleotide methylation.}, number={6}, journal={RNA}, author={Appel, C. Denise and Maxwell, E. Stuart}, year={2007}, month={Jun}, pages={899–911} }
 @article{gagnon_zhang_agris_maxwell_2006, title={Assembly of the archaeal box C/D sRNP can occur via alternative pathways and requires temperature-facilitated sRNA remodeling}, volume={362}, DOI={10.1016/j.jmb.2006.07.091}, abstractNote={Archaeal dual-guide box C/D small nucleolar RNA-like RNAs (sRNAs) bind three core proteins in sequential order at both terminal box C/D and internal C'/D' motifs to assemble two ribonuclear protein (RNP) complexes active in guiding nucleotide methylation. Experiments have investigated the process of box C/D sRNP assembly and the resultant changes in sRNA structure or "remodeling" as a consequence of sRNP core protein binding. Hierarchical assembly of the Methanocaldococcus jannaschii sR8 box C/D sRNP is a temperature-dependent process with binding of L7 and Nop56/58 core proteins to the sRNA requiring elevated temperature to facilitate necessary RNA structural dynamics. Circular dichroism (CD) spectroscopy and RNA thermal denaturation revealed an increased order and stability of sRNA folded structure as a result of L7 binding. Subsequent binding of the Nop56/58 and fibrillarin core proteins to the L7-sRNA complex further remodeled sRNA structure. Assessment of sR8 guide region accessibility using complementary RNA oligonucleotide probes revealed significant changes in guide region structure during sRNP assembly. A second dual-guide box C/D sRNA from M. jannaschii, sR6, also exhibited RNA remodeling during temperature-dependent sRNP assembly, although core protein binding was affected by sR6's distinct folded structure. Interestingly, the sR6 sRNP followed an alternative assembly pathway, with both guide regions being continuously exposed during sRNP assembly. Further experiments using sR8 mutants possessing alternative guide regions demonstrated that sRNA folded structure induced by specific guide sequences impacted the sRNP assembly pathway. Nevertheless, assembled sRNPs were active for sRNA-guided methylation independent of the pathway followed. Thus, RNA remodeling appears to be a common and requisite feature of archaeal dual-guide box C/D sRNP assembly and formation of the mature sRNP can follow different assembly pathways in generating catalytically active complexes.}, number={5}, journal={Journal of Molecular Biology}, author={Gagnon, K. T. and Zhang, X. X. and Agris, P. F. and Maxwell, E. S.}, year={2006}, pages={1025–1042} }
 @article{tran_zhang_lackey_maxwell_2005, title={Conserved spacing between the box C/D and C '/D ' RNPs of the archaeal box C/D sRNP complex is required for efficient 2 '-O-methylation of target RNAs}, volume={11}, ISSN={["1469-9001"]}, DOI={10.1261/rna.7223405}, abstractNote={RNA-guided nucleotide modification complexes direct the post-transcriptional nucleotide modification of both archaeal and eukaryotic RNAs. We have previously demonstrated that efficient 2'-O-methylation activity guided by an in vitro reconstituted archaeal box C/D sRNP requires juxtaposed box C/D and C'/D' RNP complexes. In these experiments, we investigate the importance of spatially positioning the box C/D and C'/D' RNPs within the sRNP complex for nucleotide modification. Initial sequence analysis of 245 archaeal box C/D sRNAs from both Eukyarchaeota and Crenarchaeota kingdoms revealed highly conserved spacing between the box C/D and C'/D' RNA motifs. Distances between boxes C to D' and C' to D (D' and D spacers, respectively) exhibit highly constrained lengths of 12 nucleotides (nt). Methanocaldococcus jannaschii sR8 sRNA, a model box C/D sRNA with D and D' spacers of 12 nt, was mutated to alter the distance between the two RNA motifs. sRNAs with longer or shorter spacer regions could still form sRNPs by associating with box C/D core proteins, L7, Nop56/58, and fibrillarin, comparable to wild-type sR8. However, these reconstituted box C/D sRNP complexes were severely deficient in methylation activity. Alteration of the D and D' spacer lengths disrupted the guided methylation activity of both the box C/D and C'/D' RNP complexes. When only one spacer region was altered, methylation activity of the corresponding RNP was lost. Collectively, these results demonstrate the importance of box C/D and C'/D' RNP positioning for preservation of critical inter-RNP interactions required for efficient box C/D sRNP-guided nucleotide methylation.}, number={3}, journal={RNA}, author={Tran, E and Zhang, XX and Lackey, L and Maxwell, ES}, year={2005}, month={Mar}, pages={285–293} }
 @article{suryadi_tran_maxwell_brown_2005, title={The crystal structure of the Methanocaldococcus jannaschii multifunctional L7Ae RNA-binding protein reveals an induced-fit interaction with the box C/D RNAs}, volume={44}, ISSN={["0006-2960"]}, DOI={10.1021/bi050568q}, abstractNote={Archaeal ribosomal protein L7Ae is a multifunctional RNA-binding protein that recognizes the K-turn motif in ribosomal, box H/ACA, and box C/D sRNAs. The crystal structure of Methanocaldococcus jannaschii L7Ae has been determined to 1.45 A, and L7Ae's amino acid composition, evolutionary conservation, functional characteristics, and structural details have been analyzed. Comparison of the L7Ae structure to those of a number of related proteins with diverse functions has revealed significant structural homology which suggests that this protein fold is an ancient RNA-binding motif. Notably, the free M. jannaschii L7Ae structure is essentially identical to that with RNA bound, suggesting that RNA binding occurs through an induced-fit interaction. Circular dichroism experiments show that box C/D and C'/D' RNA motifs undergo conformational changes when magnesium or the L7Ae protein is added, corroborating the induced-fit model for L7Ae-box C/D RNA interactions.}, number={28}, journal={BIOCHEMISTRY}, author={Suryadi, J and Tran, EJ and Maxwell, ES and Brown, BA}, year={2005}, month={Jul}, pages={9657–9672} }
 @article{tran_brown_maxwell_2004, title={Evolutionary origins of the RNA-guided nucleotide-modification complexes: from the primitive translation apparatus?}, volume={29}, ISSN={0968-0004}, url={http://dx.doi.org/10.1016/j.tibs.2004.05.001}, DOI={10.1016/j.tibs.2004.05.001}, abstractNote={Eukarya and Archaea possess scores of RNA-guided nucleotide-modification complexes that target specific ribonucleotides for 2′-O-methylation or pseudouridylation. Recent characterization of these RNA-modification machines has yielded striking results with implications for their evolutionary origins: the two main classes of nucleotide-modification complex in Archaea share a common ribonucleoprotein (RNP) core element that has evolved from a progenitor RNP. The fact that this common RNP element is also found in ribosomes suggests that the origin of the progenitor RNP lies in the primitive translation apparatus. Thus, the trans-acting, RNA-guided nucleotide-modification complexes of the modern RNP world seem to have evolved from cis-acting RNA or RNP elements contained in the primitive translation apparatus during the transition from the ancient RNA world to the modern RNP world.}, number={7}, journal={Trends in Biochemical Sciences}, publisher={Elsevier BV}, author={Tran, Elizabeth and Brown, James and Maxwell, E.Stuart}, year={2004}, month={Jul}, pages={343–350} }
 @article{sanjay_singh_gurha_tran_maxwell_gupta_2004, title={Sequential 2 '-O-methylation of archaeal pre-tRNA(Trp) nucleotides is guided by the intron-encoded but trans-acting box c/D ribonucleoprotein of pre-tRNA}, volume={279}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M408868200}, abstractNote={Haloferax volcanii pre-tRNATrp processing requires box C/D ribonucleoprotein (RNP)-guided 2′-O-methylation of nucleotides C34 and U39 followed by intron excision. Positioning of the box C/D guide RNA within the intron of this pre-tRNA led to the assumption that nucleotide methylation is guided by the cis-positioned box C/D RNPs. We have now investigated the mechanism of 2′-O-methylation for the H. volcanii pre-tRNATrpin vitro by assembling methylation-competent box C/D RNPs on both the pre-tRNA and the excised intron (both linear and circular forms) using Methanocaldococcus jannaschii box C/D RNP core proteins. With both kinetic studies and single nucleotide substitutions of target and guide nucleotides, we now demonstrate that pre-tRNA methylation is guided in trans by the intron-encoded box C/D RNPs positioned in either another pre-tRNATrp or in the excised intron. Methylation by in vitro assembled RNPs prefers but does not absolutely require Watson-Crick pairing between the guide and target nucleotides. We also demonstrate for the first time that methylation of two nucleotides guided by a single box C/D RNA is sequential, that is, box C′/D′ RNP-guided U39 methylation first requires box C/D RNP-guided methylation of C34. Methylation of the two nucleotides of exogenous pre-tRNATrp added to an H. volcanii cell extract also occurs sequentially and is also accomplished in trans using RNPs that pre-exist in the extract. Thus, this trans mechanism is analogous to eukaryal pre-rRNA 2′-O-methylation guided by intron-encoded but trans-acting box C/D small nucleolar RNPs. This trans mechanism could explain the observed accumulation of the excised H. volcanii pre-tRNATrp intron in vivo. A trans mechanism would also eliminate the obligatory refolding of the pre-tRNA that would be required to carry out two cis-methylation reactions before pre-tRNA splicing. Haloferax volcanii pre-tRNATrp processing requires box C/D ribonucleoprotein (RNP)-guided 2′-O-methylation of nucleotides C34 and U39 followed by intron excision. Positioning of the box C/D guide RNA within the intron of this pre-tRNA led to the assumption that nucleotide methylation is guided by the cis-positioned box C/D RNPs. We have now investigated the mechanism of 2′-O-methylation for the H. volcanii pre-tRNATrpin vitro by assembling methylation-competent box C/D RNPs on both the pre-tRNA and the excised intron (both linear and circular forms) using Methanocaldococcus jannaschii box C/D RNP core proteins. With both kinetic studies and single nucleotide substitutions of target and guide nucleotides, we now demonstrate that pre-tRNA methylation is guided in trans by the intron-encoded box C/D RNPs positioned in either another pre-tRNATrp or in the excised intron. Methylation by in vitro assembled RNPs prefers but does not absolutely require Watson-Crick pairing between the guide and target nucleotides. We also demonstrate for the first time that methylation of two nucleotides guided by a single box C/D RNA is sequential, that is, box C′/D′ RNP-guided U39 methylation first requires box C/D RNP-guided methylation of C34. Methylation of the two nucleotides of exogenous pre-tRNATrp added to an H. volcanii cell extract also occurs sequentially and is also accomplished in trans using RNPs that pre-exist in the extract. Thus, this trans mechanism is analogous to eukaryal pre-rRNA 2′-O-methylation guided by intron-encoded but trans-acting box C/D small nucleolar RNPs. This trans mechanism could explain the observed accumulation of the excised H. volcanii pre-tRNATrp intron in vivo. A trans mechanism would also eliminate the obligatory refolding of the pre-tRNA that would be required to carry out two cis-methylation reactions before pre-tRNA splicing. Eukaryotic cells possess numerous small nucleolar RNAs (snoRNAs), 1The abbreviations used are: sno, small nucleolar; sRNA, sno-like RNA; sRNP, sno-like RNP; RNP, ribonucleoprotein; nt, nucleotide; AdoMet, S-adenosylmethionine.1The abbreviations used are: sno, small nucleolar; sRNA, sno-like RNA; sRNP, sno-like RNP; RNP, ribonucleoprotein; nt, nucleotide; AdoMet, S-adenosylmethionine. the primary function of which is to guide the 2′-O-methylation and pseudouridylation of specific nucleotides within pre-rRNA and other target RNAs (1Maxwell E.S. Fournier M.J. Annu. Rev. Biochem. 1995; 64: 897-934Crossref PubMed Scopus (536) Google Scholar, 2Weinstein L.B. Steitz J.A. Curr. Opin. Cell Biol. 1999; 11: 378-384Crossref PubMed Scopus (249) Google Scholar, 3Kiss T. Cell. 2002; 109: 145-148Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar, 4Filipowicz W. Pogacic V. Curr. Opin. Cell Biol. 2002; 14: 319-327Crossref PubMed Scopus (320) Google Scholar, 5Terns M.P. Terns R.M. Gene Expr. 2002; 10: 17-39PubMed Google Scholar, 6Bachellerie J.P. Cavaille J. Huttenhofer A. Biochimie (Paris). 2002; 84: 775-790Crossref PubMed Scopus (507) Google Scholar, 7Decatur W.A. Fournier M.J. J. Biol. Chem. 2003; 278: 695-698Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). The box C/D snoRNAs direct 2′-O-methylation of specific nucleotides within target RNAs. Members of this snoRNA family are defined by conserved box C (RUGAUGA) and D (CUGA) consensus sequences located in the 5′ and 3′ termini, respectively, of the snoRNA. Often, imperfect copies called C′ and D′ boxes are found internally. Regions of 10–21 nucleotides located upstream of boxes D and D′ function as guide sequences, pairing with those regions in rRNA containing the nucleotide to be modified. The nucleotide sugar to be methylated resides within the snoRNA-rRNA duplex and is located 5 nucleotides upstream of box D or D′.Box C/D RNAs are also found in Archaea, in which they are designated snoRNA-like RNAs or sRNAs (8Omer A.D. Lowe T.M. Russell A.G. Ebhardt H. Eddy S.R. Dennis P.P. Science. 2000; 288: 517-522Crossref PubMed Scopus (275) Google Scholar, 9Gaspin C. Cavaille J. Erauso G. Bachellerie J.P. J. Mol. Biol. 2000; 297: 895-906Crossref PubMed Scopus (151) Google Scholar, 10Dennis P.P. Omer A. Lowe T. Mol. Microbiol. 2001; 40: 509-519Crossref PubMed Scopus (112) Google Scholar, 11Tang T.H. Bachellerie J.P. Rozhdestvensky T. Bortolin M.L. Huber H. Drungowski M. Elge T. Brosius J. Huttenhofer A. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 7536-7541Crossref PubMed Scopus (290) Google Scholar). Archaeal sRNAs are generally smaller than the eukaryal snoRNAs and typically possess C′ and D′ boxes that vary little from the terminal box C and D sequences. The primary function of the archaeal box C/D sRNAs also is to guide the 2′-O-methylation of targeted nucleotides, and their mechanism of nucleotide modification is analogous to the eukaryal snoRNAs.Both the eukaryal and archaeal box C/D RNAs are bound to core proteins to establish snoRNP and sRNP complexes, respectively. Four snoRNP core proteins are bound to the box C/D snoRNAs: fibrillarin (Nop1p), Nop56p, Nop58p (Nop5p), and the 15.5-kDa (Snu13p) protein (4Filipowicz W. Pogacic V. Curr. Opin. Cell Biol. 2002; 14: 319-327Crossref PubMed Scopus (320) Google Scholar, 5Terns M.P. Terns R.M. Gene Expr. 2002; 10: 17-39PubMed Google Scholar, 6Bachellerie J.P. Cavaille J. Huttenhofer A. Biochimie (Paris). 2002; 84: 775-790Crossref PubMed Scopus (507) Google Scholar, 7Decatur W.A. Fournier M.J. J. Biol. Chem. 2003; 278: 695-698Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar). The methylation activity resides in the proteins of the snoRNP, with fibrillarin functioning as the methyltransferase. The differential distribution of the 15.5-kDa Nop56 and Nop58 proteins on the box C/D and C′/D′ motifs establishes an asymmetric snoRNP complex (12Cahill N.M. Friend K. Speckmann W. Li Z.H. Terns R.M. Terns M.P. Steitz J.A. EMBO J. 2002; 21: 3816-3828Crossref PubMed Scopus (94) Google Scholar, 13Szewczak L.B. DeGregorio S.J. Strobel S.A. Steitz J.A. Chem. Biol. 2002; 9: 1095-1107Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). The archaeal box C/D sRNP complex possesses three core proteins. Ribosomal protein L7Ae (the archaeal homolog of the eukaryal 15.5-kDa protein), afibrillarin, and aNop5p (a single homolog of eukaryal Nop56p and Nop58p) bind both the terminal C/D and internal C′/D′ RNA motifs to establish a symmetrical RNP complex (4Filipowicz W. Pogacic V. Curr. Opin. Cell Biol. 2002; 14: 319-327Crossref PubMed Scopus (320) Google Scholar, 5Terns M.P. Terns R.M. Gene Expr. 2002; 10: 17-39PubMed Google Scholar, 14Newman D.R. Kuhn J.F. Shanab G.M. Maxwell E.S. RNA (N. Y.). 2000; 6: 861-879Crossref PubMed Scopus (111) Google Scholar, 15King T.H. Decatur W.A. Bertrand E. Maxwell E.S. Fournier M.J. Mol. Cell. Biol. 2001; 21: 7731-7746Crossref PubMed Scopus (98) Google Scholar, 16Omer A.D. Ziesche S. Ebhardt H. Dennis P.P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5289-5294Crossref PubMed Scopus (158) Google Scholar, 17Omer A.D. Ziesche S. Decatur W.A. Fournier M.J. Dennis P.P. Mol. Microbiol. 2003; 48: 617-629Crossref PubMed Scopus (79) Google Scholar, 18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar, 19Kuhn J.F. Tran E.J. Maxwell E.S. Nucleic Acids Res. 2002; 30: 931-941Crossref PubMed Scopus (129) Google Scholar). In vitro assembly systems using purified archaeal sRNAs and recombinant core proteins have reconstituted enzymatically active box C/D sRNPs (16Omer A.D. Ziesche S. Ebhardt H. Dennis P.P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5289-5294Crossref PubMed Scopus (158) Google Scholar, 18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar, 20Rashid R. Aittaleb M. Chen Q. Spiegel K. Demeler B. Li H. J. Mol. Biol. 2003; 333: 295-306Crossref PubMed Scopus (58) Google Scholar, 21Bortolin M.L. Bachellerie J.P. Clouet-d'Orval B. Nucleic Acids Res. 2003; 31: 6524-6535Crossref PubMed Scopus (42) Google Scholar). Core protein binding follows an order of assembly in which L7Ae binds first followed by aNop5p and then afibrillarin. Efficient catalysis requires that the box C/D and C′/D′ RNPs be juxtaposed within the full-length sRNA (18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar).The tRNATrp of Haloferax volcanii is derived from an intron-containing pre-tRNA (22Daniels C.J. Gupta R. Doolittle W.F. J. Biol. Chem. 1985; 260: 3132-3134Abstract Full Text PDF PubMed Google Scholar) and possesses 2′-O-methylated nucleotides at positions 34 (Cm) and 39 (Um) (where “m” is 2′-O-methylation of the residue) (23Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). Analysis of the pre-tRNATrp structure (see Fig. 1, upper left) revealed that the intron contains box C/D and C′/D′ motifs with guide sequences complementary to the pre-tRNA regions encompassing modified nucleotides Cm34 and Um39, respectively (8Omer A.D. Lowe T.M. Russell A.G. Ebhardt H. Eddy S.R. Dennis P.P. Science. 2000; 288: 517-522Crossref PubMed Scopus (275) Google Scholar, 10Dennis P.P. Omer A. Lowe T. Mol. Microbiol. 2001; 40: 509-519Crossref PubMed Scopus (112) Google Scholar, 24Clouet d'Orval B. Bortolin M.L. Gaspin C. Bachellerie J.P. Nucleic Acids Res. 2001; 29: 4518-4529Crossref PubMed Scopus (122) Google Scholar). Subsequent investigations that involved deleting regions of the pre-tRNA intron and then examining nucleotide methylation in vitro led to the conclusion that these intron-encoded box C/D motifs are indeed responsible for guiding the methylation of pre-tRNATrp nucleotides C34 and U39 (21Bortolin M.L. Bachellerie J.P. Clouet-d'Orval B. Nucleic Acids Res. 2003; 31: 6524-6535Crossref PubMed Scopus (42) Google Scholar, 24Clouet d'Orval B. Bortolin M.L. Gaspin C. Bachellerie J.P. Nucleic Acids Res. 2001; 29: 4518-4529Crossref PubMed Scopus (122) Google Scholar). These investigations also led to the proposal that the box C/D RNPs of the unspliced intron are responsible for guiding in cis the methylation of the pre-tRNATrp nucleotides (21Bortolin M.L. Bachellerie J.P. Clouet-d'Orval B. Nucleic Acids Res. 2003; 31: 6524-6535Crossref PubMed Scopus (42) Google Scholar, 24Clouet d'Orval B. Bortolin M.L. Gaspin C. Bachellerie J.P. Nucleic Acids Res. 2001; 29: 4518-4529Crossref PubMed Scopus (122) Google Scholar). The presence of a cis mechanism for intramolecular methylation would be unique and provide a stark contrast from the box C/D RNP-guided trans-methylation in eukaryal and other archaeal systems. Although box C/D snoRNAs are frequently found in the introns of eukaryal pre-messenger RNAs, they are excised from the host pre-mRNA as snoRNPs before they guide the 2′-O-methylation of target nucleotides.In this investigation, we have assembled in vitro a box C/D sRNP using recombinant Methanocaldococcus jannaschii core proteins L7Ae, aNop5p, and afibrillarin and H. volcanii pre-tRNATrp. This complex is enzymatically active and methylates tRNATrp nucleotides C34 and U39. However, the experiments demonstrated that modification of the pre-tRNA target nucleotides was accomplished in trans using box C/D RNPs assembled in another unspliced pre-tRNA or in the excised intron (both linear and circular). Certain non-Watson-Crick pairings between target and guide nucleotides permitted 2′-O-methylations, although less efficiently. Nucleotide modification was also sequential, that is, modification of U39 guided by the C′/D′ RNP first required methylation of C34 guided by the box C/D RNP. Pre-tRNATrp methylation carried out in an H. volcanii cell extract confirmed the sequential methylation of these two nucleotides guided by trans-acting box C/D RNP complexes already present in the extract. Collectively, these observations indicate that the sequential methylation of the H. volcanii pre-tRNATrp nucleotides guided by the intron-encoded box C/D RNP occurs via an intermolecular or trans mechanism rather than an intramolecular or cis mechanism as previously assumed. This trans mechanism could explain the accumulation of the excised introns of this pre-tRNA in vivo (25Salgia S.R. Singh S.K. Gurha P. Gupta R. RNA (N. Y.). 2003; 9: 319-330Crossref PubMed Scopus (69) Google Scholar).EXPERIMENTAL PROCEDURESDNA Template Construction and Site-directed Mutagenesis—The following DNA oligonucleotide primers were used in PCR-amplification of plasmid pVT9P11 (25Salgia S.R. Singh S.K. Gurha P. Gupta R. RNA (N. Y.). 2003; 9: 319-330Crossref PubMed Scopus (69) Google Scholar) to produce DNA templates for in vitro transcription: 1) TAATACGACTCACTATAGGGGCTGTGGCCAAGC; 2) TGGGGCCGGAGGGATTTGAAC; 3) TCAGTATATCAGCTGGAGTGT; 4) TAATACGACTCACTATAGGCTTGGCGCCCGGGA; and 5) ATCTCCGGTGGGCACCT. Primer pairs 1 and 2, 1 and 3, and 4 and 5 were used to prepare full-length H. volcanii pre-tRNATrp (177 nt), 5′-half pre-tRNA (78 nt), and intron RNA (102 nt), respectively. Specific nucleotide mutations at pre-tRNA target or guide positions C34G (C at position 34 mutated to G), C34U, C34A, G117C, G117A, G117U, U39A, and A70U were introduced into the pVT9P11 templates using the QuikChange site-directed mutagenesis kit (Stratagene) and appropriate DNA oligonucleotides. These residues correspond to target or guide nucleotides of the box C/D and C′/D′ motifs contained within the H. volcanii pre-tRNATrp.In Vitro RNA Synthesis—Generally, in vitro transcription was carried out in 20-μl reactions at 37 °C for 2–3 h in buffer containing 40 mm Tris-Cl, pH 7.9, 6 mm MgCl2, 10mm dithiothreitol, 2 mm spermidine, 10 μCi of [α-32P]ATP (specific activity, 3000 Ci/mmol) (MP Biomedicals), 0.6 mm unlabeled ATP, and unlabeled GTP, CTP, and UTP each at 1.0 mm, PCR-amplified DNA, and 50 units of T7 RNA polymerase (New England Biolabs). Radiolabeled RNA transcripts were purified by denaturing PAGE, and amounts were approximated by Cerenkov counting. High specific activity transcripts were prepared similarly except that unlabeled ATP was omitted.RNP Assembly and Electrophoretic Mobility Shift Assay—Recombinant M. jannaschii L7Ae, aNop5p, and afibrillarin proteins were prepared, and RNP complexes were assembled as described previously (18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar). Briefly, ∼0.2 pmol of radiolabeled RNA was incubated at 70 °C with 10 pmol of L7Ae in 20-μl reactions (20 mm HEPES, pH 7.0, 150 mm NaCl, 0.75 mm dithiothreitol, 1.5 mm MgCl2, 0.1 mm EDTA, 10% glycerol) for 10 min. Assembly of higher order RNP complexes was accomplished by incubating 10 pmol of L7Ae, 32 pmol of aNop5p, and 33 pmol of afibrillarin with radiolabeled RNA transcripts in the presence of 10 μg of Escherichia coli tRNA. Assembled RNP complexes were resolved by electrophoretic mobility shift assay using 4% polyacrylamide gels containing 25 mm potassium phosphate, pH 7.0, and 2% glycerol as described previously (18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar). Resolved RNPs were visualized by phosphorimaging using a Packard Cyclone system.In Vitro RNP-directed Nucleotide 2′-O-Methylation and Thin Layer Chromatography Analysis of Modified Nucleotides—Generally, RNP complexes were assembled in the presence of 0.05 mmS-adenosylmethionine (AdoMet) using recombinant core proteins and 0.2 pmol of [α-32P]ATP-labeled RNAs as described above. After incubation at 70 °C for 2 h, radiolabeled RNA was purified by phenol/chloroform extraction and ethanol precipitation. In cases in which two different transcripts were included in the reaction, the amount of each transcript was 0.1 pmol. RNA samples were digested with RNase T2, and the digestion products were resolved on cellulose plates (EM Science) using two-dimensional TLC. The solvents for TLC were isobutyric acid, 0.5 n NH4OH (5:3, v/v) for the first dimension and isopropanol/HCl/H2O (70:15:15, v/v/v) for the second dimension (23Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). Radiolabeled nucleotides resolved by TLC analysis were visualized and quantified by phosphorimaging. The identity of dinucleotides was established based on our previous study (23Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). A small aliquot of RNA was obtained before the RNase T2 digestion and saved. These RNAs were checked by denaturing PAGE for RNA stability and integrity, especially for those cases in which methylation was not observed. Target nucleotide 2′-O-methylation was calculated by dividing the amount of radioactivity in the corresponding dinucleotide spot on the TLC plate by 33 (number of A residues in the pre-tRNA) of the sum of the total radioactivity in all spots and expressed as the percentage of modification.The amount of radiolabeled wild type pre-tRNA transcript used in the reactions and their incubation times varied (up to 2 h) for the kinetic study experiments (see Fig. 2D). Incubation at 70 °C beyond this time leads to RNA degradation. In some reactions, small amounts (<0.08 fmol) of high specific activity transcript were included as tracers to quantify the minimal levels of detectable modification. Two specific and more sensitive experiments using the G117C mutant pre-tRNA were carried out. In one experiment, instead of the typical 0.2 pmol, 2 pmol of pre-tRNA was used for the standard 2-h reaction. For wild type pre-tRNA, more than 80 and 40% of C34 and U39, respectively, were methylated under these conditions (see Fig. 2D). In another experiment, 0.2 pmol of normally radiolabeled and 2.25 fmol of high specific activity tracer transcript (in place of the typical <0.08 fmol transcript) were used in the reaction. We are able to detect methylation of a given residue as low as 2.5% under these conditions.Fig. 2The kinetics of H. volcanii pre-tRNATrp methylation indicate that nucleotides C34 and U39 are modified sequentially by trans-acting box C/D RNPs. Radiolabeled pre-tRNATrp transcripts (0.2 pmol) were incubated with recombinant M. jannaschii sRNP core proteins in the presence of AdoMet for 0 min (A) and 15 min (B). TLC analysis of RNase T2-digested pre-tRNA revealed C34 and U39 methylation with the appearance of dinucleotides CmCp and UmCp, respectively. C, methylation reaction was identical to B except that the pre-tRNA concentration was 2.0 pmol. D, the time course of nucleotide C34 and U39 methylation at different pre-tRNA concentrations is shown. Dinucleotides CmCp and UmCp produced at different time points were quantified by phosphorimaging analysis and plotted with respect to reaction time. Each curve, except for the U39 methylation curves at the two lowest pre-tRNA concentrations, was fitted as a single exponent. E, reaction rates (kapp) were calculated from each fitted C34 methylation curve and plotted versus pre-tRNA substrate concentration (pmol).View Large Image Figure ViewerDownload (PPT)Pre-tRNA Methylation in Cell Extracts—Some in vitro methylation reactions were carried out in cell extracts. Extracts were prepared by growing H. volcanii cells to an A550 density of 0.5–0.6 as described previously (23Gupta R. J. Biol. Chem. 1984; 259: 9461-9471Abstract Full Text PDF PubMed Google Scholar). Pelleted cells were resuspended in three volumes (w/v) of solution D (3.4 m KCl, 0.1 m MgOAc, 10 mm Tris-Cl, pH 7.6) and lysed by three passages through a French pressure cell at 20,000 psi. The lysate was cleared by centrifugation at 10,000 × g for 10 min followed by two additional centrifugations each at 32,000 × g for 30 min. Glycerol was added to a final concentration of 20%, and the cell extract was stored at –70 °C. Approximately 0.4 pmol of radiolabeled RNA was incubated at 37 °C for 1 h in a 35-μl reaction containing 30 μl of cell extract and 0.05 mm AdoMet. Purification of the RNA, RNase T2 digestion, and TLC analysis of digested nucleotides was performed as described above.Pre-tRNA Splicing Reactions—Splicing endonuclease and ligase reactions to produce linear and circular forms of H. volcanii pre-tRNATrp introns were carried out as described previously (25Salgia S.R. Singh S.K. Gurha P. Gupta R. RNA (N. Y.). 2003; 9: 319-330Crossref PubMed Scopus (69) Google Scholar, 26Zofallova L. Guo Y. Gupta R. RNA (N. Y.). 2000; 6: 1019-1030Crossref PubMed Scopus (31) Google Scholar). RNA products were separated by denaturing PAGE, and specific introns were eluted from the gels.RESULTSM. jannaschii sRNP Core Proteins Bind the H. volcanii Pre-tRNATrp and Its Derivative Introns in Vitro to Assemble Box C/D RNP—The folded H. volcanii pre-tRNATrp transcript shown in Fig. 1 (upper left) contains the bulge-helix-bulge motif recognized by the archaeal splicing endonuclease and possesses intron-encoded boxes C/D and C′/D′ in their characteristic conformation. Pre-tRNA is spliced after nucleotide methylation because the two exon-intron junctions are located within the target sequences of the box C/D RNPs. Both the linear intron formed after endonuclease cleavage of the pre-tRNA and the circular intron formed after ligation of the excised intron (25Salgia S.R. Singh S.K. Gurha P. Gupta R. RNA (N. Y.). 2003; 9: 319-330Crossref PubMed Scopus (69) Google Scholar) retain the essential features of the box C/D sRNA motifs (Fig. 1, upper middle and right); thus, both forms of the intron have the potential to guide the intermolecular, trans-2′-O-methylation of other pre-tRNATrp molecules.H. volcanii pre-tRNATrp as well as the linear and circular forms of its spliced intron can bind recombinant M. jannaschii box C/D sRNP core proteins in vitro to assemble sRNP complexes (Fig. 1, lower panels). Consistent with previous investigations (16Omer A.D. Ziesche S. Ebhardt H. Dennis P.P. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5289-5294Crossref PubMed Scopus (158) Google Scholar, 18Tran E.J. Zhang X. Maxwell E.S. EMBO J. 2003; 22: 3930-3940Crossref PubMed Scopus (90) Google Scholar, 20Rashid R. Aittaleb M. Chen Q. Spiegel K. Demeler B. Li H. J. Mol. Biol. 2003; 333: 295-306Crossref PubMed Scopus (58) Google Scholar, 21Bortolin M.L. Bachellerie J.P. Clouet-d'Orval B. Nucleic Acids Res. 2003; 31: 6524-6535Crossref PubMed Scopus (42) Google Scholar), electrophoretic mobility shift assay also demonstrated that core protein binding is ordered, with L7Ae binding first followed by aNop5p and then afibrillarin (data not shown). The mouse U14 box C/D core motif (19Kuhn J.F. Tran E.J. Maxwell E.S. Nucleic Acids Res. 2002; 30: 931-941Crossref PubMed Scopus (129) Google Scholar) is an effective competitor for protein binding (data not shown), indicating that core protein binding is specific for the box C/D motif. When the RNA products of a pre-tRNATrp splicing reaction were incubated with L7Ae, only the introns (both linear and circular forms) bound this core protein (data not shown). Thus, box C/D RNP assembly requires the box C/D and C′/D′ RNA motifs contained within the intron of this pre-tRNA.In Vitro Assembled Box C/D RNPs Guide the 2′-O-methylation of Target Nucleotides in Pre-tRNATrp—Box C/D RNPs assembled on the H. volcanii pre-tRNATrp with the three recombinant M. jannaschii sRNP core proteins guided the AdoMet-dependent, 2′-O-methylation of C34 and U39 target nucleotides in the tRNATrp precursor. Following RNP assembly and incubation in the presence of AdoMet, TLC of the nucleotides generated by RNase T2 digestion of the [α-32P]ATP-labeled pre-tRNATrp transcript revealed radiolabeled residues corresponding to the dinucleotides CmCp and UmCp (where “p” is 3′-phosphate of the residue) (Figs. 2, B and C, and 3A). (RNase T2 cleaves after every ribonucleotide to produce ribonucleoside 3′-monophosphate (Np), except when nucleotides are methylated at the 2′ position of the sugar.) Dinucleotides CmCp and UmCp are derived from 2′-O-methylation of residues C34 and U39, respectively. Specificity of methylation for these two nucleotides has been confirmed by dNTP concentration-dependent, primer extension (27Maden B.E. Methods. 2001; 25: 374-382Crossref PubMed Scopus (83) Google Scholar) analysis (data not shown) as well as by mutation studies described later. Nucleotide methylation required box C/D RNP assembly because neither dinucleotide was observed when any one of the three sRNP core proteins was omitted from the reaction (data not shown). These studies therefore demonstrate that the in vitro assembled box C/D RNPs function to guide the 2′-O-methylation of pre-tRNATrp nucleotides C34 and U39. The amount of the CmCp dinucleotide was always greater than the UmCp dinucleotide (Fig. 2, B and C, and Fig. 3A), suggesting that modification of U39 follows that of C34 and/or occurs at a significantly slower rate.Fig. 32′-O-Methylation of pre-tRNATrp nucleotides C34 and U39 is sequential; pre-tRNATrp nucleotide methylation in an H. volcanii cell extract is also sequential but utilizes pre-existing box C/D RNPs. Radiolabeled wild type and mutant pre-tRNATrp transcripts possessing altered guide and/or target nucleotides were incubated for 2 h with recombinant M. jannaschii sRNP core proteins in the methylation reactions. A–G, TLC analyses of RNase T2-digested pre-tRNAs are shown. The pre-tRNAs used in each reaction are indicated in the individual panels. Pre-tRNAs with wild type and mutant guide and/or target nucleotides are illustrated at the side (mutated nucleotides are designated by asterisks). Target (uppercase) and guide (lowercase) nucleotides are shown with target:guide nucleotide pairs for the box C/D motif and C′/D′ motif indicated in black squares and black circles, respectively. AA–GG, radiolabeled wild type and mutant pre-tRNATrp transcripts possessing altered guide and/or target nucleotides were incubated in an H. volcanii cell extract, and nucleotide methylation was assessed with the TLC analysis of RNase T2-digested pre-tRNAs. Pre-tRNAs for each reaction are indicated in the individual panels and illustrated at the side (mutated nucleotides are designated by asterisks).View Large Image Figure ViewerDownload (PPT)The Kinetics of C34 and U39 Methylation Indicate That These Modifications Occur Sequentially and Are Guided via a trans Mechanism—A time course study of C34 and U39 nucleotide methylation was carried out in which the concentration of the pre-tRNA substrate was increased while the amount of core proteins was held constant. The initial rates and the extent (total percentage) of methylation for both nucleotides increased as pre-tRNA concentrations increased (Fig. 2D). Reaction rates for C34 methylation (kapp) were calculated and then plotted versus pre-tRNA substrate concentration (Fig. 2E). Consistent with a trans reaction, kapp increased as pre-tRNA substrate concentration increased. Lower reaction rates for U39 methylation, particularly at low substrate concentrations, caused a similar plot of the methylation rate of this nucleotide to be more problematic. However, visual inspection of the initial reaction rate for U39 at substrate concentrations of 0.2 and 2 pmol (Fig. 2D) clearly revealed increasing rates with respect to increasing pre-tRNA concentration. Indeed, the kapp rates at these two concentrations revealed values of 0.041 (0.2 pmol) and 0.059 (2 pmol). The fact that these rates are significantly less than C34 methylation rates at these same pre-tRNA substrate concentrations is consistent with the sequential methylation of these two target nucleotides (see below). Collectively, these kinetics are consistent with an intermolecular or trans reaction mechanism, thus suggesting that C34 and U39 nucleotide methylation do not occur via an intramolecular or cis mechanism as assumed previously (see below). Interestingly, inspection of the C34 methylation rate at higher substrate concentrations revealed the deviation of this curve from linearity (Fig. 2E). This suggests th}, number={46}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Sanjay, KS and Singh, SK and Gurha, P and Tran, EJ and Maxwell, ES and Gupta, R}, year={2004}, month={Nov}, pages={47661–47671} }
 @article{tran_zhang_maxwell_2003, title={Efficient RNA 2 '-O-methylation requires juxtaposed and symmetrically assembled archaeal box C/D and C '/D ' RNPs}, volume={22}, ISSN={["0261-4189"]}, DOI={10.1093/emboj/cdg368}, abstractNote={Box C/D ribonucleoprotein (RNP) complexes direct the nucleotide-specific 2'-O-methylation of ribonucleotide sugars in target RNAs. In vitro assembly of an archaeal box C/D sRNP using recombinant core proteins L7, Nop56/58 and fibrillarin has yielded an RNA:protein enzyme that guides methylation from both the terminal box C/D core and internal C'/D' RNP complexes. Reconstitution of sRNP complexes containing only box C/D or C'/D' motifs has demonstrated that the terminal box C/D RNP is the minimal methylation-competent particle. However, efficient ribonucleotide 2'-O-methylation requires that both the box C/D and C'/D' RNPs function within the full-length sRNA molecule. In contrast to the eukaryotic snoRNP complex, where the core proteins are distributed asymmetrically on the box C/D and C'/D' motifs, all three archaeal core proteins bind both motifs symmetrically. This difference in core protein distribution is a result of altered RNA-binding capabilities of the archaeal and eukaryotic core protein homologs. Thus, evolution of the box C/D nucleotide modification complex has resulted in structurally distinct archaeal and eukaryotic RNP particles.}, number={15}, journal={EMBO JOURNAL}, author={Tran, EJ and Zhang, XX and Maxwell, ES}, year={2003}, month={Aug}, pages={3930–3940} }
 @article{kuhn_tran_maxwell_2002, title={Archaeal ribosomal protein L7 is a functional homolog of the eukaryotic 15.5kD/Snu13p snoRNP core protein}, volume={30}, DOI={10.1093/nar/30.4.931}, abstractNote={Recent investigations have identified homologs of eukaryotic box C/D small nucleolar RNAs (snoRNAs) in Archaea termed sRNAs. Archaeal homologs of the box C/D snoRNP core proteins fibrillarin and Nop56/58 have also been identified but a homolog for the eukaryotic 15.5kD snoRNP protein has not been described. Our sequence analysis of archaeal genomes reveals that the highly conserved ribosomal protein L7 exhibits extensive homology with the eukaryotic 15.5kD protein. Protein binding studies demonstrate that recombinant Methanoccocus jannaschii L7 protein binds the box C/D snoRNA core motif with the same specificity and affinity as the eukaryotic 15.5kD protein. Identical to the eukaryotic 15.5kD core protein, archaeal L7 requires a correctly folded box C/D core motif and intact boxes C and D. Mutational analysis demonstrates that critical features of the box C/D core motif essential for 15.5kD binding are also required for L7 interaction. These include stem I which juxtaposes boxes C and D, as well as the sheared G:A pairs and protruded pyrimidine nucleotide of the asymmetric bulge region. The demonstrated presence of L7Ae in the Haloarcula marismortui 50S ribosomal subunit, taken with our demonstration of the ability of L7 to bind to the box C/D snoRNA core motif, indicates that this protein serves a dual role in Archaea. L7 functioning as both an sRNP core protein and a ribosomal protein could potentially regulate and coordinate sRNP assembly with ribosome biogenesis.}, number={4}, journal={Nucleic Acids Research}, author={Kuhn, J. F. and Tran, E. J. and Maxwell, E. S.}, year={2002}, pages={931–941} }
 @article{king_decatur_bertrand_maxwell_fournier_2001, title={A well-connected and conserved nucleoplasmic helicase is required for production of box C/D and H/ACA snoRNAs and localization of snoRNP proteins}, volume={21}, ISSN={["0270-7306"]}, DOI={10.1128/MCB.21.22.7731-7746.2001}, abstractNote={Biogenesis of small nucleolar RNA-protein complexes (snoRNPs) consists of synthesis of the snoRNA and protein components, snoRNP assembly, and localization to the nucleolus. Recently, two nucleoplasmic proteins from mice were observed to bind to a model box C/D snoRNA in vitro, suggesting that they function at an early stage in snoRNP biogenesis. Both proteins have been described in other contexts. The proteins, called p50 and p55 in the snoRNA binding study, are highly conserved and related to each other. Both have Walker A and B motifs characteristic of ATP- and GTP-binding and nucleoside triphosphate-hydrolyzing domains, and the mammalian orthologs have DNA helicase activity in vitro. Here, we report that the Saccharomyces cerevisiae ortholog of p50 (Rvb2, Tih2p, and other names) is required for production of C/D snoRNAs in vivo and, surprisingly, H/ACA snoRNAs as well. Point mutations in the Walker A and B motifs cause temperature-sensitive or lethal growth phenotypes and severe defects in snoRNA accumulation. Notably, depletion of p50 (called Rvb2 in this study) also impairs localization of C/D and H/ACA core snoRNP proteins Nop1p and Gar1p, suggesting a defect(s) in snoRNP assembly or trafficking to the nucleolus. Findings from other studies link Rvb2 orthologs with chromatin remodeling and transcription. Taken together, the present results indicate that Rvb2 is involved in an early stage of snoRNP biogenesis and may play a role in coupling snoRNA synthesis with snoRNP assembly and localization.}, number={22}, journal={MOLECULAR AND CELLULAR BIOLOGY}, author={King, TH and Decatur, WA and Bertrand, E and Maxwell, ES and Fournier, MJ}, year={2001}, month={Nov}, pages={7731–7746} }
 @article{newman_kuhn_shanab_maxwell_2000, title={Box C/D snoRNA-associated proteins: Two pairs of evolutionarily ancient proteins and possible links to replication and transcription}, volume={6}, ISSN={["1469-9001"]}, DOI={10.1017/S1355838200992446}, abstractNote={The eukaryotic nucleolus contains a diverse population of small nucleolar RNAs (snoRNAs) essential for ribosome biogenesis. The box C/D snoRNA family possesses conserved nucleotide boxes C and D that are multifunctional elements required for snoRNA processing, snoRNA transport to the nucleolus, and 2'-O-methylation of ribosomal RNA. We have previously demonstrated that the assembly of an snoRNP complex is essential for processing the intronic box C/D snoRNAs and that specific nuclear proteins associate with the box C/D core motif in vitro. Using a box C/D motif derived from mouse U14 snoRNA, we have now affinity purified and defined four mouse proteins that associate with this minimal RNA substrate. These four proteins consist of two protein pairs: members of each pair are highly related in sequence. One protein pair corresponds to the essential yeast nucleolar proteins Nop56p and Nop58p. Affinity purification of mouse Nop58 confirms observations made in yeast that Nop58 is a core protein of the box C/D snoRNP complex. Isolation of Nop56 using this RNA motif defines an additional snoRNP core protein. The second pair of mouse proteins, designated p50 and p55, are also highly conserved among eukaryotes. Antibody probing of nuclear fractions revealed a predominance of p55 and p50 in the nucleoplasm, suggesting a possible role for the p50/p55 pair in snoRNA production and/or nucleolar transport. The reported interaction of p55 with TATA-binding protein (TBP) and replication A protein as well as the DNA helicase activity of p55 and p50 may suggest the coordination of snoRNA processing and snoRNP assembly with replication and/or transcriptional events in the nucleus. Homologs for both snoRNA-associated protein pairs occur in Archaea, strengthening the hypothesis that the box C/D RNA elements and their interacting proteins are of ancient evolutionary origin.}, number={6}, journal={RNA}, author={Newman, DR and Kuhn, JF and Shanab, GM and Maxwell, ES}, year={2000}, month={Jun}, pages={861–879} }
 @article{lange_borovjagin_maxwell_gerbi_1998, title={Conserved boxes C and D are essential nucleolar localization elements of U14 and U8 snoRNAs}, volume={17}, ISSN={["1460-2075"]}, DOI={10.1093/emboj/17.11.3176}, abstractNote={Sequences necessary for nucleolar targeting were identified in Box C/D small nucleolar RNAs (snoRNAs) by fluorescence microscopy. Nucleolar preparations were examined after injecting fluorescein-labelled wild-type and mutated U14 or U8 snoRNA into Xenopus oocyte nuclei. Regions in U14 snoRNA that are complementary to 18S rRNA and necessary for rRNA processing and methylation are not required for nucleolar localization. Truncated U14 molecules containing Boxes C and D with or without the terminal stem localized efficiently. Nucleolar localization was abolished upon mutating just one or two nucleotides within Boxes C and D. Moreover, the spatial position of Boxes C or D in the molecule is essential. Mutations in Box C/D of U8 snoRNA also impaired nucleolar localization, suggesting the general importance of Boxes C and D as nucleolar localization sequences for Box C/D snoRNAs. U14 snoRNA is shown to be required for 18S rRNA production in vertebrates.}, number={11}, journal={EMBO JOURNAL}, author={Lange, TS and Borovjagin, A and Maxwell, ES and Gerbi, SA}, year={1998}, month={Jun}, pages={3176–3187} }
 @article{watkins_newman_kuhn_maxwell_1998, title={In vitro assembly of the mouse U14 snoRNP core complex and identification of a 65-kDa box C/D-binding protein}, volume={4}, ISSN={["1469-9001"]}, DOI={10.1017/S1355838298980128}, abstractNote={The eukaryotic nucleolus contains a diverse population of small nucleolar RNAs (snoRNAs) that have been categorized into two major families based on evolutionarily conserved sequence elements. U14 snoRNA is a member of the larger, box C/D snoRNA family and possesses nucleotide box C and D consensus sequences. In previous studies, we have defined a U14 box C/D core motif that is essential for intronic U14 snoRNA processing. These studies also revealed that nuclear proteins that recognize boxes C/D are required. We have now established an in vitro U14 snoRNP assembly system to characterize protein binding. Electrophoretic mobility-shift analysis demonstrated that all the sequences and structures of the box C/D core motif required for U14 processing are also necessary for protein binding and snoRNP assembly. These required elements include a base paired 5',3' terminal stem and the phylogenetically conserved nucleotides of boxes C and D. The ability of other box C/D snoRNAs to compete for protein binding demonstrated that the box C/D core motif-binding proteins are common to this family of snoRNAs. UV crosslinking of nuclear proteins bound to the U14 core motif identified a 65-kDa mouse snoRNP protein that requires boxes C and D for binding. Two additional core motif proteins of 55 and 50 kDa were also identified by biochemical fractionation of the in vitro-assembled U14 snoRNP complex. Thus, the U14 snoRNP core complex is a multiprotein particle whose assembly requires nucleotide boxes C and D.}, number={5}, journal={RNA}, author={Watkins, NJ and Newman, DR and Kuhn, JF and Maxwell, ES}, year={1998}, month={May}, pages={582–593} }
 @article{leader_clark_boag_watters_simpson_watkins_maxwell_brown_1998, title={Processing of vertebrate box C/D small nucleolar RNAs in plant cells}, volume={253}, ISSN={["0014-2956"]}, DOI={10.1046/j.1432-1327.1998.2530154.x}, abstractNote={The recent isolation of a number of plant box C/D small nucleolar (sno)RNAs demonstrates the conservation in plants of sequence and structural elements of processed box C/D snoRNAs. Boxes C and D, and terminal inverted repeats are known to be essential for accumulation and processing in vertebrates and yeast. Processing of vertebrate box C/D snoRNAs was examined by expression of various mouse hsc70 intron 5-U14 constructs in tobacco protoplasts. Full-length U14 and internally deleted U14 accumulated in the plant cells. Human U3 and U8 fragments, consistent with processing to internal box C/C' sequences, also accumulated in the plant cells. The similarity of processing behaviour of the vertebrate box C/D constructs in tobacco protoplasts and Xenopus oocytes suggests the mechanism of processing, involving recognition and association of proteins, is conserved in plants.}, number={1}, journal={EUROPEAN JOURNAL OF BIOCHEMISTRY}, author={Leader, DJ and Clark, GP and Boag, J and Watters, JA and Simpson, CG and Watkins, NJ and Maxwell, ES and Brown, JWS}, year={1998}, month={Apr}, pages={154–160} }
 @article{xia_watkins_maxwell_1997, title={Identification of specific nucleotide sequences and structural elements required for intronic U14 snorna processing}, volume={3}, number={1}, journal={RNA}, author={Xia, L. and Watkins, N. J. and Maxwell, E. S.}, year={1997}, pages={17–26} }