@misc{brůna_aryal_dudchenko_sargent_mead_buti_cavallini_hytönen_andrés_pham_et al._2022, title={A chromosome-length genome assembly and annotation of blackberry (<i>Rubus argutus</i>, cv. ‘Hillquist’)}, url={http://dx.doi.org/10.1101/2022.04.28.489789}, DOI={10.1101/2022.04.28.489789}, abstractNote={Abstract Background Blackberries ( Rubus spp.) are the fourth most economically important berry crop worldwide. Genome assemblies and annotations have been developed for Rubus species in subgenus Idaeobatus , including black raspberry ( R. occidentalis ), red raspberry ( R. idaeus ), and R. chingii , but very few genomic resources exist for blackberries and their relatives in subgenus Rubus . Findings Here we present a chromosome-length assembly and annotation of the diploid blackberry germplasm accession ‘Hillquist’ ( R. argutus ). ‘Hillquist’ is the only known source of primocane-fruiting (annual-fruiting) in tetraploid fresh-market blackberry breeding programs and is represented in the pedigree of many important cultivars worldwide. The ‘Hillquist’ assembly, generated using PacBio long reads scaffolded with Hi-C sequencing, consisted of 298 Mb, of which 270 Mb (90%) was placed on seven chromosome-length scaffolds with an average length of 38.6 Mb. Approximately 52.8% of the genome was composed of repetitive elements. The genome sequence was highly collinear with a novel maternal haplotype-resolved linkage map of the tetraploid blackberry selection A-2551TN and genome assemblies of R. chingii and red raspberry. A total of 38,503 protein-coding genes were predicted using the assembly and Iso-Seq and RNA-seq data, of which 72% were functionally annotated. Conclusions The utility of the ‘Hillquist’ genome has been demonstrated here by the development of the first genotyping-by-sequencing based linkage map of tetraploid blackberry and the identification of several possible candidate genes for primocane-fruiting within the previously mapped locus. This chromosome-length assembly will facilitate future studies in Rubus biology, genetics, and genomics and strengthen applied breeding programs.}, publisher={Cold Spring Harbor Laboratory}, author={Brůna, Tomáš and Aryal, Rishi and Dudchenko, Olga and Sargent, Daniel James and Mead, Daniel and Buti, Matteo and Cavallini, Andrea and Hytönen, Timo and Andrés, Javier and Pham, Melanie and et al.}, year={2022}, month={Apr} }
 @article{brůna_aryal_dudchenko_sargent_mead_buti_cavallini_hytönen_andrés_pham_et al._2022, title={A chromosome-length genome assembly and annotation of blackberry (<i>Rubus argutus</i>, cv. “Hillquist”)}, volume={11}, ISSN={2160-1836}, url={http://dx.doi.org/10.1093/g3journal/jkac289}, DOI={10.1093/g3journal/jkac289}, abstractNote={Abstract Blackberries (Rubus spp.) are the fourth most economically important berry crop worldwide. Genome assemblies and annotations have been developed for Rubus species in subgenus Idaeobatus, including black raspberry (R. occidentalis), red raspberry (R. idaeus), and R. chingii, but very few genomic resources exist for blackberries and their relatives in subgenus Rubus. Here we present a chromosome-length assembly and annotation of the diploid blackberry germplasm accession “Hillquist” (R. argutus). “Hillquist” is the only known source of primocane-fruiting (annual-fruiting) in tetraploid fresh-market blackberry breeding programs and is represented in the pedigree of many important cultivars worldwide. The “Hillquist” assembly, generated using Pacific Biosciences long reads scaffolded with high-throughput chromosome conformation capture sequencing, consisted of 298 Mb, of which 270 Mb (90%) was placed on 7 chromosome-length scaffolds with an average length of 38.6 Mb. Approximately 52.8% of the genome was composed of repetitive elements. The genome sequence was highly collinear with a novel maternal haplotype-resolved linkage map of the tetraploid blackberry selection A-2551TN and genome assemblies of R. chingii and red raspberry. A total of 38,503 protein-coding genes were predicted, of which 72% were functionally annotated. Eighteen flowering gene homologs within a previously mapped locus aligning to an 11.2 Mb region on chromosome Ra02 were identified as potential candidate genes for primocane-fruiting. The utility of the “Hillquist” genome has been demonstrated here by the development of the first genotyping-by-sequencing-based linkage map of tetraploid blackberry and the identification of possible candidate genes for primocane-fruiting. This chromosome-length assembly will facilitate future studies in Rubus biology, genetics, and genomics and strengthen applied breeding programs.}, journal={G3 Genes|Genomes|Genetics}, publisher={Oxford University Press (OUP)}, author={Brůna, Tomáš and Aryal, Rishi and Dudchenko, Olga and Sargent, Daniel James and Mead, Daniel and Buti, Matteo and Cavallini, Andrea and Hytönen, Timo and Andrés, Javier and Pham, Melanie and et al.}, editor={Pyhäjärvi, TEditor}, year={2022}, month={Nov} }
 @article{willman_bushakra_bassil_finn_dossett_perkins-veazie_bradish_fernandez_weber_scheerens_et al._2022, title={Analysis of a Multi-Environment Trial for Black Raspberry (Rubus occidentalis L.) Quality Traits}, volume={13}, ISSN={2073-4425}, url={http://dx.doi.org/10.3390/genes13030418}, DOI={10.3390/genes13030418}, abstractNote={U.S. black raspberry (BR) production is currently limited by narrowly adapted, elite germplasm. An improved understanding of genetic control and the stability of pomological traits will inform the development of improved BR germplasm and cultivars. To this end, the analysis of a multiple-environment trial of a BR mapping population derived from a cross that combines wild ancestors introgressed with commercial cultivars on both sides of its pedigree has provided insights into genetic variation, genotype-by-environment interactions, quantitative trait loci (QTL), and QTL-by-environment interactions (QEI) of fruit quality traits among diverse field environments. The genetic components and stability of four fruit size traits and six fruit biochemistry traits were characterized in this mapping population following their evaluation over three years at four distinct locations representative of current U.S. BR production. This revealed relatively stable genetic control of the four fruit size traits across the tested production environments and less stable genetic control of the fruit biochemistry traits. Of the fifteen total QTL, eleven exhibited significant QEI. Closely overlapping QTL revealed the linkage of several fruit size traits: fruit mass, drupelet count, and seed fraction. These and related findings are expected to guide further genetic characterization of BR fruit quality, management of breeding germplasm, and development of improved BR cultivars for U.S. production.}, number={3}, journal={Genes}, publisher={MDPI AG}, author={Willman, Matthew R. and Bushakra, Jill M. and Bassil, Nahla and Finn, Chad E. and Dossett, Michael and Perkins-Veazie, Penelope and Bradish, Christine M. and Fernandez, Gina E. and Weber, Courtney A. and Scheerens, Joseph C. and et al.}, year={2022}, month={Feb}, pages={418} }
 @book{fernandez_2021, place={Raleigh, NC}, title={2021 PMSP for Blackberry in Alabama, Arkansas, Georgia, Louisiana, Mississippi, North Carolina, South Carolina, Tennessee and Virginia}, url={https://ipmdata.ipmcenters.org/source_report.cfm?view=yes&sourceid=1444}, institution={National IPM Database}, author={Fernandez, G.E.}, year={2021} }
 @article{chandra_oh_han_salinas_anciro_whitaker_chacon_fernandez_lee_2021, title={Comparative Transcriptome Analysis to Identify Candidate Genes for FaRCg1 Conferring Resistance Against Colletotrichum gloeosporioides in Cultivated Strawberry (Fragaria × ananassa)}, volume={12}, ISSN={1664-8021}, url={http://dx.doi.org/10.3389/fgene.2021.730444}, DOI={10.3389/fgene.2021.730444}, abstractNote={Colletotrichum crown rot (CCR) caused by Colletotrichum gloeosporioides is a serious threat to the cultivated strawberry ( Fragaria × ananassa ). Our previous study reported that a major locus, FaRCg1 , increases resistance. However, the genomic structure of FaRCg1 and potential candidate genes associated with the resistance remained unknown. Here, we performed comparative transcriptome analyses of resistant ‘Florida Elyana’ and susceptible ‘Strawberry Festival’ after infection and identified candidate genes potentially involved in resistance. In ‘Florida Elyana’, 6,099 genes were differentially expressed in response to C. gloeosporioides . Gene ontology analysis showed that the most upregulated genes were functionally associated with signaling pathways of plant defense responses. Three genes in the genomic region of FaRCg1 were highly upregulated: a von Willebrand Factor A domain-containing protein, a subtilisin-like protease, and a TIFY 11A-like protein. Subgenome-specific markers developed for the candidate genes were tested with a diverse panel of 219 accessions from University of Florida and North Carolina State University breeding programs. Significant and positive associations were found between the high-resolution melting (HRM) marker genotypes and CCR phenotypes. These newly developed subgenome-specific functional markers for FaRCg1 can facilitate development of resistant varieties through marker-assisted selection.}, journal={Frontiers in Genetics}, publisher={Frontiers Media SA}, author={Chandra, Saket and Oh, Youngjae and Han, Hyeondae and Salinas, Natalia and Anciro, Ashlee and Whitaker, Vance M. and Chacon, Jose Guillermo and Fernandez, Gina and Lee, Seonghee}, year={2021}, month={Aug} }
 @article{kraft_sit_diepenbrock_ashrafi_aryal_fernandez_burrack_2021, title={Detection of Fruit Meals Within Laboratory-Raised and Field-Trapped Adult Drosophila suzukii (Diptera: Drosophilidae) Guts}, volume={9}, ISSN={2296-701X}, url={http://dx.doi.org/10.3389/fevo.2021.719645}, DOI={10.3389/fevo.2021.719645}, abstractNote={The feeding habits of adult Brachycera are understudied and may provide important context for understanding invasive pest biology, as with the polyphagous small fruit pest Drosophila suzukii . We developed molecular methods to study adult D. suzukii gut content in order to understand its feeding habits. We designed and verified two primer pairs specific for either blueberries or blackberries and used a qPCR melt curve analysis to determine whether we can detect the presence or absence of berry feeding by adult flies. In a laboratory assay, the blueberry fly meal DNA can be detected for longer periods than the blackberry meal DNA. Generally, female gut contents are less variable than male gut contents. We also tested recently emerged flies that were not fed as adults but developed as larvae in either blueberries or blackberries. Some adult flies from each fruit had detectable fruit DNA in their gut, which could be due to pupal meconium feeding after emergence. Next, we aimed to test the primers in the field to develop techniques to track fruit feeding by D. suzukii in its natural field environment. First, to identify the most appropriate collection method, we determined how long we could detect fruit DNA, using previously developed primers within D. suzukii gut preserved in four types of trap fluid in the laboratory. The likelihood of detecting blackberry DNA differed by day, trap fluid, and between sexes. For the blueberry primer, the possibility of detecting blueberry DNA differed by trap fluid only. Based on those results, we used RV antifreeze with a Scentry SWD lure in field trials at two research station locations, one containing blackberries and one with blueberries. We established transects away from each fruit planting and collected up to 120 total flies at each point along transects. There were no significant differences in the number of flies containing berry DNA among collection points along the transect in both locations. These results suggest that adult flies move between crop and non-crop habitats and may not be highly dependent on fruit food resources.}, journal={Frontiers in Ecology and Evolution}, publisher={Frontiers Media SA}, author={Kraft, Laura J. and Sit, Tim L. and Diepenbrock, Lauren M. and Ashrafi, Hamid and Aryal, Rishi and Fernandez, Gina E. and Burrack, Hannah J.}, year={2021}, month={Aug} }
 @article{fernandez_pattison_perkins-veazie_ballington_clevinger_schiavone_gu_samtani_vinson_mcwhirt_et al._2020, title={'Liz' and 'Rocco' Strawberries}, volume={55}, ISSN={["2327-9834"]}, DOI={10.21273/HORTSCI14516-19}, abstractNote={North Carolina Strawberry Association; North American Strawberry Growers Association; Southern Region Small Fruit Consortium; Golden Leaf Foundation; Virginia Strawberry Growers Association}, number={4}, journal={HORTSCIENCE}, author={Fernandez, Gina and Pattison, Jeremy and Perkins-Veazie, Penelope and Ballington, James R. and Clevinger, Elizabeth and Schiavone, Rocco and Gu, Sanjun and Samtani, Jayesh and Vinson, Edgar and McWhirt, Amanda and et al.}, year={2020}, month={Apr}, pages={597–600} }
 @article{jacobs_adhikari_pattison_yencho_fernandez_louws_2020, title={Assessing Rate-Reducing Foliar Resistance to Anthracnose Crown Rot and Fruit Rot in Strawberry}, volume={104}, ISSN={0191-2917 1943-7692}, url={http://dx.doi.org/10.1094/PDIS-04-19-0687-RE}, DOI={10.1094/PDIS-04-19-0687-RE}, abstractNote={Anthracnose fruit rot and anthracnose crown rot (ACR) caused by two species complexes of the fungus referred to as Colletotrichum acutatum and Colletotrichum gloeosporioides, respectively, are major pathogens of strawberry in North Carolina. Anthracnose epidemics are common when susceptible cultivars and asymptomatic planting stocks carrying quiescent Colletotrichum infection or hemibiotrophic infection (HBI) are planted. The main objective of this study was to assess resistance to HBI and ACR in strawberry. Strawberry cultivars and breeding lines were spray inoculated with isolates of C. acutatum or C. gloeosporioides. Four epidemiological parameters providing estimates of rate-reducing resistance to HBI and ACR in strawberry cultivars and lines were evaluated in repeated experiments in controlled environments in a greenhouse. HBI severity, measured as the percentage of total leaf area covered by acervuli, was estimated visually and by image analysis. ACR severity was rated weekly for wilt symptoms, and relative area under disease progress curve scores were calculated for comparing strawberry cultivars and lines. Significant differences (P ≤ 0.005) in HBI severity were found among strawberry genotypes; however, the correlations were not remarkable between Colletotrichum species (r = 0.4251). Although significant variation in resistance was observed for ACR, this was also weakly correlated (r = 0.2430) with resistance to C. gloeosporioides HBI. Overall, rate-reducing resistance to HBI and ACR in strawberry identified in this study could be utilized in breeding programs to develop durable resistance to anthracnose in North Carolina.}, number={2}, journal={Plant Disease}, publisher={Scientific Societies}, author={Jacobs, Raymond L. and Adhikari, Tika B. and Pattison, Jeremy and Yencho, G. Craig and Fernandez, Gina E. and Louws, Frank J.}, year={2020}, month={Feb}, pages={398–407} }
 @article{worthington_aryal_bassil_mead_fernandez_clark_fernández-fernández_finn_hummer_ashrafi_2020, title={Development of new genomic resources and tools for molecular breeding in blackberry}, volume={4}, ISSN={0567-7572 2406-6168}, url={http://dx.doi.org/10.17660/ActaHortic.2020.1277.6}, DOI={10.17660/ActaHortic.2020.1277.6}, number={1277}, journal={Acta Horticulturae}, publisher={International Society for Horticultural Science (ISHS)}, author={Worthington, M.L. and Aryal, R. and Bassil, N.V. and Mead, D. and Fernandez, G.E. and Clark, J.R. and Fernández-Fernández, F. and Finn, C.E. and Hummer, K.E. and Ashrafi, H.}, year={2020}, month={Apr}, pages={39–46} }
 @article{willman_bushakra_bassil_finn_dossett_perkins-veazie_bradish_fernandez_weber_scheerens_et al._2020, title={Genetic analysis of drupelet count in black raspberry (<i>Rubus occidentalis</i>)}, volume={4}, ISSN={0567-7572 2406-6168}, url={http://dx.doi.org/10.17660/ActaHortic.2020.1277.9}, DOI={10.17660/ActaHortic.2020.1277.9}, abstractNote={U.S. black raspberry (BR) production is currently limited by narrowly adapted, elite germplasm. Improved understanding of genetic control and genotype-by-environment interactions (GEI) of pomological traits will inform the development of improved BR germplasm and cultivars. To this end, analysis of a multi-environment trial of two BR mapping populations derived from crosses of commercial cultivars with wild accessions is providing insights into genetic variation, quantitative trait loci (QTL), and GEI related to traits of horticultural value. Twenty-six horticultural and fruit quality traits were evaluated in two mapping populations over three years at four distinct locations representative of current U.S. BR production. One fruit quality trait, drupelet count, has been analyzed, and nine additional fruit quality traits are being analyzed. Random factor analysis of genetic effect was used to account for missing data. GEI analysis was performed using a Bayesian approach to Finlay-Wilkinson regression and genotyping-by-sequencing (GBS)-derived genomic relationship matrices, with the purpose of verifying relatedness and identifying genotypes with stable performance over environments. Genetic maps were reconstructed using GBS-derived markers and the latest genome assembly for BR. Among relevant results, pedigree verification led to construction of reliable linkage maps, and a QTL spanning a one to five megabase region containing several hundred genes was identified on chromosome 1. This region has a stable influence over drupelet count over environments (location by year). These and related findings are expected to guide further genetic characterization of BR fruit quality, management of breeding germplasm, and development of improved BR cultivars for U.S. production.}, number={1277}, journal={Acta Horticulturae}, publisher={International Society for Horticultural Science (ISHS)}, author={Willman, M. and Bushakra, J.M. and Bassil, N.V. and Finn, C.E. and Dossett, M. and Perkins-Veazie, P. and Bradish, C.M. and Fernandez, G.E. and Weber, C.A. and Scheerens, J. and et al.}, year={2020}, month={Apr}, pages={65–72} }
 @article{kon_fernandez_perkins-veazie_blaedow_2020, title={Managing vigor of blackberry with prohexadione calcium: effects on primocane and floricane development}, volume={4}, ISSN={0567-7572 2406-6168}, url={http://dx.doi.org/10.17660/ActaHortic.2020.1277.47}, DOI={10.17660/ActaHortic.2020.1277.47}, number={1277}, journal={Acta Horticulturae}, publisher={International Society for Horticultural Science (ISHS)}, author={Kon, T.M. and Fernandez, G.E. and Perkins-Veazie, P. and Blaedow, K.}, year={2020}, month={Apr}, pages={329–336} }
 @article{finn_peterson_clark_fernandez_hall_worthington_2020, title={Merging blackberry germplasm pools and moving previously unutilized species into commercially viable selections}, volume={4}, ISSN={0567-7572 2406-6168}, url={http://dx.doi.org/10.17660/ActaHortic.2020.1277.7}, DOI={10.17660/ActaHortic.2020.1277.7}, number={1277}, journal={Acta Horticulturae}, publisher={International Society for Horticultural Science (ISHS)}, author={Finn, C.E. and Peterson, M.E. and Clark, J.R. and Fernandez, G.E. and Hall, H.K. and Worthington, M.L.}, year={2020}, month={Apr}, pages={47–54} }
 @article{bradish_bushakra_robbins_karaadac_teo_willard_perkins-veazie_lee_scheerens_weber_et al._2020, title={Standardized Phenotyping in Black Raspberry}, volume={74}, number={1}, journal={Journal of the American Pomological Society}, author={Bradish, C.M. and Bushakra, J.M. and Robbins, L.R. and Karaadac, E. and Teo, S. and Willard, J.L. and Perkins-Veazie, P. and Lee, J. and Scheerens, J.C. and Weber, C.A. and et al.}, year={2020}, month={Jan}, pages={2–17} }
 @misc{molina-bravo_worthington_fernandez_2019, title={Advances and challenges in raspberry and blackberry breeding}, volume={54}, ISBN={9781786762122}, ISSN={2059-6936}, url={http://dx.doi.org/10.19103/AS.2018.0040.27}, DOI={10.19103/AS.2018.0040.27}, journal={Achieving sustainable cultivation of temperate zone tree fruits and berries Volume 2: Case studies}, publisher={Burleigh Dodds Science Publishing}, author={Molina-Bravo, Ramón and Worthington, Margaret Leigh and Fernandez, Gina E.}, year={2019}, month={Jun}, pages={363–396} }
 @article{adhikari_chacon_fernandez_louws_2019, title={First Report of Anthracnose Causing Both Crown and Fruit Rot of Strawberry by Colletotrichum siamense in North Carolina}, volume={5}, ISSN={0191-2917 1943-7692}, url={http://dx.doi.org/10.1094/pdis-02-19-0314-pdn}, DOI={10.1094/pdis-02-19-0314-pdn}, abstractNote={HomePlant DiseaseVol. 103, No. 7First Report of Anthracnose Causing Both Crown and Fruit Rot of Strawberry by Colletotrichum siamense in North Carolina PreviousNext DISEASE NOTESFirst Report of Anthracnose Causing Both Crown and Fruit Rot of Strawberry by Colletotrichum siamense in North CarolinaT. B. Adhikari, J. G. Chacon, G. E. Fernandez, and F. J. LouwsT. B. Adhikari†Corresponding author: T. B. Adhikari; E-mail Address: [email protected]http://orcid.org/0000-0001-7118-6875Department of Entomology and Plant Pathology, North Carolina State University, Raleigh, NC 27695Search for more papers by this author, J. G. ChaconDepartment of Horticultural Science, North Carolina State University, Raleigh, NC 27695Search for more papers by this author, G. E. FernandezDepartment of Horticultural Science, North Carolina State University, Raleigh, NC 27695Search for more papers by this author, and F. J. LouwsDepartment of Entomology and Plant Pathology, North Carolina State University, Raleigh, NC 27695Department of Horticultural Science, North Carolina State University, Raleigh, NC 27695Search for more papers by this authorAffiliationsAuthors and Affiliations T. B. Adhikari1 † J. G. Chacon2 G. E. Fernandez2 F. J. Louws1 2 1Department of Entomology and Plant Pathology, North Carolina State University, Raleigh, NC 27695 2Department of Horticultural Science, North Carolina State University, Raleigh, NC 27695 Published Online:10 May 2019https://doi.org/10.1094/PDIS-02-19-0314-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Anthracnose fruit rot and anthracnose crown rot of strawberries (Fragaria × ananassa Duch.), caused by Colletotrichum spp., have been mainly associated with the C. acutatum complex (Baroncelli et al. 2015; Damm et al. 2012) and the C. gloeosporioides complex (Weir et al. 2012), respectively. In September 2017, typical symptoms of anthracnose were observed on strawberry plants in a propagation greenhouse in North Carolina, U.S.A. Symptoms that appeared were crown rotting, wilting, and stunting. Small pieces (2 mm2) of necrotic tissue were cut with a sterile scalpel from the crown lesion. Approximately 15% of the plants showed such typical symptoms. The diseased segment was surface sterilized with 70% ethanol for 30 s and placed on acidified potato dextrose agar (APDA). Hyphal tips from colonies emerging from the edge of the tissue were transferred onto fresh APDA Petri plates and incubated at 25°C. Morphological characteristics after 7 days of incubation showed light-gray to whitish aerial mycelium. Conidia were hyaline, aseptate, fusiform with obtuse ends, cylindrical, 13.2 to 17.5 µm long, and 4.9 to 7.5 µm wide. These characteristics of conidia were matched with some species belonging to the C. gloeosporioides complex including C. siamense (Weir et al. 2012). For accurate identification, genomic DNA of isolate 28244 was extracted and amplified with partial sequences of actin (ACT), chitin synthase (CHS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal internal transcribed spacer (ITS), and manganese-superoxide dismutase (SOD2) primer sets (Weir et al. 2012). Sequencing of the purified polymerase chain reaction products was performed at the Genomic Sciences Laboratory, North Carolina State University, Raleigh, NC (White et al. 1990). Sequences of the amplified regions of isolate 28244 were deposited to GenBank (accession nos. MH722310 to MH722314). Additionally, sequences of 22 Colletotrichum species within the C. gloeosporioides complex (Weir et al. 2012) were retrieved from GenBank. Jukes–Cantor neighbor-joining trees inferred from the concatenated sequences (ACT, CHS, GAPDH, ITS, and SOD2) placed isolate 28244 from North Carolina within the same cluster of C. siamense including isolate BRSP09 from Bangladesh (Gupta et al. 2018). These sequences were compared with the GenBank database using BLASTn and revealed a high percentage of similarity (>99%). To confirm pathogenicity of the fungus, Koch’s postulates were performed by three methods. Three-month-old strawberry plants of cultivar ‘Camarosa’ were either spray inoculated on leaves with a conidial suspension (106 conidia/ml) or injected (10 μl) into the crown of each plant. Ten plants inoculated with distilled water served as controls. Plants were covered with plastic bags for 48 h and placed in the greenhouse at 28°C. Leaf and crown rot symptoms were monitored weekly after inoculation. No symptoms or spores developed on leaves, which was also confirmed by a paraquat assay after the first 3 weeks. However, dark brown necrotic lesions were observed on the crowns 4 weeks after inoculation. The fungus was reisolated from the inoculated crown tissues. In another experiment, 10 immature (half-green and half-yellow) strawberry fruit (cv. ‘Chandler’) were surface sterilized with 70% ethanol and then 0.5% sodium hypochlorite for 30 s and rinsed with sterile distilled water three times. Fruit was injected with 10 μl of conidial suspension (106 conidia/ml) and placed in a plastic crisper container. Sterile distilled water–inoculated fruits served as controls. Fruits in the containers were incubated at 25°C in the dark. All experiments were conducted twice. Fruit rot symptoms were observed on fruits 3 days after inoculation, and the control fruits remained asymptomatic. Within the C. gloeosporioides species complex, C. aenigma, C. fructicola, C. siamense, and C. theobromicola were previously reported on strawberries (Baroncelli et al. 2015; Weir et al. 2012). More recently, C. siamense has been reported to cause crown rot of strawberry in Bangladesh (Gupta et al. 2018) and fruit rot on strawberry in Brazil (Capobiango et al. 2016). To our best knowledge, this is the first report of anthracnose causing both crown and fruit rot of strawberry by C. siamense, one of the species within the C. gloeosporioides complex, in North Carolina. This disease can seriously affect strawberry fruit quality and yield and is capable of producing resistance to Fungicide Resistance Action Committee code 11 fungicides (Hu et al. 2015); thus, effective disease management strategies should be investigated and implemented.The author(s) declare no conflict of interest.References:Baroncelli, R. et al. 2015. PLoS One 10:e0129140. https://doi.org/10.1371/journal.pone.0129140 Crossref, ISI, Google ScholarCapobiango, N. P. et al. 2016. Plant Dis. 100:859. https://doi.org/10.1094/PDIS-10-15-1121-PDN Link, ISI, Google ScholarDamm, U. et al. 2012. Stud. Mycol. 73:37. https://doi.org/10.3114/sim0010 Crossref, ISI, Google ScholarGupta, D. R. et al. 2018. Plant Dis. 103:580. https://doi.org/10.1094/PDIS-08-18-1461-PDN Link, ISI, Google ScholarHu, et al. 2015. Plant Dis. 99:806. https://doi.org/10.1094/PDIS-10-14-1077-RE Link, ISI, Google ScholarWeir, B. S., et al. 2012. Stud. Mycol. 73:115. https://doi.org/10.3114/sim0011 Crossref, ISI, Google ScholarWhite, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA. Crossref, Google ScholarThe author(s) declare no conflict of interest.DetailsFiguresLiterature CitedRelated Vol. 103, No. 7 July 2019SubscribeISSN:0191-2917e-ISSN:1943-7692 DownloadCaptionApple cultivar Joya Cripps Red lesions caused by Colletotrichum fructicola (Nodet et al.). Photo credit: P. Nodet. Symptoms of Lotus powdery mildew caused by Erysiphe takamatsui (Zhou et al.). Photo credit: C. Liang. Symptoms of tar spot (Phyllachora maydis) on maize leaves (Dalla Lana et al.). Photo credit: F. Dalla Lana. Metrics Article History Issue Date: 20 Jun 2019Published: 10 May 2019First Look: 4 Mar 2019Accepted: 13 Feb 2019 Pages: 1775-1775 Information© 2019 The American Phytopathological SocietyKeywordsfungismall fruitsetiologyThe author(s) declare no conflict of interest.Cited byComparative characterization and expression analysis revealed cinnamyl alcohol dehydrogenase genes differentially responding to Colletotrichum fructicola in woodland and cultivated strawberriesJournal of Berry Research, Vol. 17Different responses to elevated temperature in the representative strains of strawberry pathogenic Colletotrichum spp.from eastern China9 December 2022 | Mycological Progress, Vol. 22, No. 1Identification and Observation of Infection Processes of Colletotrichum Species Associated with Pearl Plum Anthracnose in Guangxi, ChinaRong Huang, Qing Gui, Yujie Zhang, Wenxiu Sun, Lihua Tang, Suiping Huang, Tangxun Guo, Qili Li, Jianyou Mo, Huiye Huang, Mingzhong Fan, Zongbin Zhang, and Tom Hsiang20 November 2022 | Plant Disease, Vol. 106, No. 12Colletotrichum species pathogenic to strawberry: discovery history, global diversity, prevalence in China, and the host range of top two species16 November 2022 | Phytopathology Research, Vol. 4, No. 1Comparative Analysis of the Microbial Community Structures Between Healthy and Anthracnose-Infected Strawberry Rhizosphere Soils Using Illumina Sequencing Technology in Yunnan Province, Southwest of China16 May 2022 | Frontiers in Microbiology, Vol. 13Characterization of Colletotrichum siamense causing crown rot of strawberry in Jingzhou, Hubei Province18 August 2021 | Notulae Botanicae Horti Agrobotanici Cluj-Napoca, Vol. 49, No. 3Resistance to Azoxystrobin and Thiophanate-Methyl Is Widespread in Colletotrichum spp. Isolates From the Mid-Atlantic Strawberry FieldsQiuchen Luo, Anita Schoeneberg, and Mengjun Hu15 September 2021 | Plant Disease, Vol. 105, No. 8Diversity and Cross-Infection Potential of Colletotrichum Causing Fruit Rots in Mixed-Fruit Orchards in KentuckyMadison J. Eaton, Shanice Edwards, Harrison A. Inocencio, Franklin J. Machado, Etta M. Nuckles, Mark Farman, Nicole A. Gauthier, and Lisa J. Vaillancourt26 February 2021 | Plant Disease, Vol. 105, No. 4Diversity and pathogenicity of Colletotrichum species causing strawberry anthracnose in Taiwan and description of a new species, Colletotrichum miaoliense sp. nov.4 September 2020 | Scientific Reports, Vol. 10, No. 1}, journal={Plant Disease}, publisher={Scientific Societies}, author={Adhikari, T. B. and Chacon, J. G. and Fernandez, G. E. and Louws, F. J.}, year={2019}, month={May}, pages={PDIS-02–19-0314} }
 @article{jacobs_adhikari_pattison_yencho_fernandez_louws_2019, title={Inheritance of Resistance to Colletotrichum gloeosporioides and C. acutatum in Strawberry}, volume={109}, ISSN={0031-949X 1943-7684}, url={http://dx.doi.org/10.1094/PHYTO-08-18-0283-R}, DOI={10.1094/PHYTO-08-18-0283-R}, abstractNote={Information on the inheritance of resistance to Colletotrichum gloeosporioides and C. acutatum hemibiotrophic infections (HBI) in strawberry leaf tissue and the genetic control of anthracnose crown rot (ACR) in crown tissue are relatively unknown. Six parental genotypes were crossed in a half-diallel mating design to generate 15 full-sib families. HBI and ACR experiments were conducted concurrently. Both seedlings and parental clones were inoculated with 1 × 10 6 conidia/ml of C. gloeosporioides or C. acutatum. Percent sporulating leaf area, wilt symptoms, and relative area under the disease progress curve were calculated to characterize resistance among genotypes and full-sib families. Low dominance/additive variance ratios for C. acutatum HBI (0.13) and C. gloeosporioides ACR (0.20) were observed, indicating additive genetic control of resistance to these traits. Heritability estimates were low for C. acutatum HBI (0.25) and C. gloeosporioides HBI (0.16) but moderate for C. gloeosporioides ACR (0.61). A high genetic correlation (r A = 0.98) between resistance to C. acutatum HBI and C. gloeosporioides HBI was observed, suggesting that resistance to these two Colletotrichum spp. may be controlled by common genes in strawberry leaf tissue. In contrast, negative genetic correlations between ACR and both HBI traits (r A = −0.85 and −0.61) suggest that resistance in crown tissue is inherited independently of resistance in leaf tissue in the populations tested. Overall, these findings provide valuable insight into the genetic basis of resistance, and the evaluation and deployment of resistance to HBIs and ACR in strawberry breeding programs.}, number={3}, journal={Phytopathology}, publisher={Scientific Societies}, author={Jacobs, Raymond L. and Adhikari, Tika B. and Pattison, Jeremy and Yencho, G. Craig and Fernandez, Gina E. and Louws, Frank J.}, year={2019}, month={Mar}, pages={428–435} }
 @article{samtani_rom_friedrich_fennimore_finn_petran_wallace_pritts_fernandez_chase_et al._2019, title={The Status and Future of the Strawberry Industry in the United States}, volume={29}, ISSN={1063-0198 1943-7714}, url={http://dx.doi.org/10.21273/HORTTECH04135-18}, DOI={10.21273/HORTTECH04135-18}, abstractNote={Strawberry ( Fragaria × ananassa ) production practices followed by growers in the United States vary by region. Understanding the challenges, needs, and opportunities in each region is essential to guide research, policy, and marketing strategies for the strawberry industry across the country, and to enable the development of general and region-specific educational and production tools. This review divided the United States into eight distinct geographic regions and an indoor controlled or protected environment production system. Current production systems, markets, cultivars, trends, and future directions for each region are discussed. A common trend across all regions is the increasing use of protected culture strawberry production with both day-neutral and short-day cultivars for season extension to meet consumer demand for year-round availability. All regions experience challenges with pests and obtaining adequate harvest labor. Increasing consumer demand for berries, climate change-induced weather variability, high pesticide use, labor and immigration policies, and land availability impact regional production, thus facilitating the adoption of new technologies such as robotics and network communications to assist with strawberry harvesting in open-field production and production under controlled-environment agriculture and protected culture.}, number={1}, journal={HortTechnology}, publisher={American Society for Horticultural Science}, author={Samtani, Jayesh B. and Rom, Curt R. and Friedrich, Heather and Fennimore, Steven A. and Finn, Chad E. and Petran, Andrew and Wallace, Russell W. and Pritts, Marvin P. and Fernandez, Gina and Chase, Carlene A. and et al.}, year={2019}, month={Feb}, pages={11–24} }
 @article{jibran_spencer_fernandez_monfort_mnejja_dzierzon_tahir_davies_chagné_foster_et al._2019, title={Two Loci, RiAF3 and RiAF4, Contribute to the Annual-Fruiting Trait in Rubus}, volume={10}, ISSN={1664-462X}, url={http://dx.doi.org/10.3389/fpls.2019.01341}, DOI={10.3389/fpls.2019.01341}, abstractNote={Most Rubus species have a biennial cycle of flowering and fruiting with an intervening period of winter dormancy, in common with many perennial fruit crops. Annual-fruiting (AF) varieties of raspberry (Rubus idaeus and Rubus occidentalis L.) and blackberry (Rubus subgenus Rubus) are able to flower and fruit in one growing season, without the intervening dormant period normally required in biennial-fruiting (BF) varieties. We used a red raspberry (R. idaeus) population segregating for AF obtained from a cross between NC493 and 'Chilliwack' to identify genetic factors controlling AF. Genotyping by sequencing (GBS) was used to generate saturated linkage maps in both parents. Trait mapping in this population indicated that AF is controlled by two newly identified loci (RiAF3 and RiAF4) located on Rubus linkage groups (LGs) 3 and 4. The location of these loci was analyzed using single-nucleotide polymorphism (SNP) markers on independent red raspberry and blackberry populations segregating for the AF trait. This confirmed that AF in Rubus is regulated by loci on LG 3 and 4, in addition to a previously reported locus on LG 7. Comparative RNAseq analysis at the time of floral bud differentiation in an AF and a BF variety revealed candidate genes potentially regulating the trait.}, journal={Frontiers in Plant Science}, publisher={Frontiers Media SA}, author={Jibran, Rubina and Spencer, Jessica and Fernandez, Gina and Monfort, Amparo and Mnejja, Mourad and Dzierzon, Helge and Tahir, Jibran and Davies, Kevin and Chagné, David and Foster, Toshi M. and et al.}, year={2019}, month={Oct} }
 @article{livingston_tuong_hoffman_fernandez_2018, title={Protocol for Producing Three-Dimensional Infrared Video of Freezing in Plants}, volume={9}, ISSN={1940-087X}, url={http://dx.doi.org/10.3791/58025}, DOI={10.3791/58025}, abstractNote={Freezing in plants can be monitored using infrared (IR) thermography, because when water freezes, it gives off heat. However, problems with color contrast make 2-dimensions (2D) infrared images somewhat difficult to interpret. Viewing an IR image or the video of plants freezing in 3 dimensions (3D) would allow a more accurate identification of sites for ice nucleation as well as the progression of freezing. In this paper, we demonstrate a relatively simple means to produce a 3D infrared video of a strawberry plant freezing. Strawberry is an economically important crop that is subjected to unexpected spring freeze events in many areas of the world. An accurate understanding of the freezing in strawberry will provide both breeders and growers with more economical ways to prevent any damage to plants during freezing conditions. The technique involves a positioning of two IR cameras at slightly different angles to film the strawberry freezing. The two video streams will be precisely synchronized using a screen capture software that records both cameras simultaneously. The recordings will then be imported into the imaging software and processed using an anaglyph technique. Using red-blue glasses, the 3D video will make it easier to determine the precise site of ice nucleation on leaf surfaces.}, number={139}, journal={Journal of Visualized Experiments}, publisher={MyJove Corporation}, author={Livingston, David P., III and Tuong, Tan D. and Hoffman, Mark and Fernandez, Gina}, year={2018}, month={Sep} }
 @inbook{fernandez_molina-bravo_takeda_2018, title={What We Know About Heat Stress in Rubus}, ISBN={9783319990309 9783319990316}, url={http://dx.doi.org/10.1007/978-3-319-99031-6_3}, DOI={10.1007/978-3-319-99031-6_3}, booktitle={Raspberry}, publisher={Springer International Publishing}, author={Fernandez, Gina E. and Molina-Bravo, Ramon and Takeda, Fumiomi}, year={2018}, pages={29–40} }
 @article{perkins-veazie_ma_fernandez_bradish_bushakra_bassil_weber_scheerens_robbins_finn_et al._2016, title={Black raspberry fruit composition over two years from seedling populations grown at four US geographic locations}, volume={1133}, ISSN={0567-7572 2406-6168}, url={http://dx.doi.org/10.17660/actahortic.2016.1133.52}, DOI={10.17660/actahortic.2016.1133.52}, number={1133}, journal={Acta Horticulturae}, publisher={International Society for Horticultural Science (ISHS)}, author={Perkins-Veazie, P. and Ma, G. and Fernandez, G.E. and Bradish, C.M. and Bushakra, J.M. and Bassil, N.V. and Weber, C.A. and Scheerens, J.C. and Robbins, L. and Finn, C.E. and et al.}, year={2016}, month={May}, pages={335–338} }
 @article{bradish_overbaugh_ballington_fernandez_bassil_2016, title={Comparative diversity analysis of southeastern Rubus germplasm through molecular and pedigree techniques}, volume={1127}, ISSN={["2406-6168"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85007394056&partnerID=MN8TOARS}, DOI={10.17660/actahortic.2016.1127.25}, journal={XXIX INTERNATIONAL HORTICULTURAL CONGRESS ON HORTICULTURE: SUSTAINING LIVES, LIVELIHOODS AND LANDSCAPES (IHC2014): INTERNATIONAL SYMPOSIUM ON PLANT BREEDING IN HORTICULTURE}, author={Bradish, C. M. and Overbaugh, E. and Ballington, J. and Fernandez, G. E. and Bassil, N. V.}, year={2016}, pages={157–161} }
 @article{beck_schroeder-moreno_fernandez_grossman_creamer_2016, title={Effects of Cover Crops, Compost, and Vermicompost on Strawberry Yields and Nitrogen Availability in North Carolina}, volume={26}, ISSN={["1943-7714"]}, DOI={10.21273/horttech03447-16}, abstractNote={Summer cover crop rotations, compost, and vermicompost additions can be important strategies for transition to organic production that can provide various benefits to crop yields, nitrogen (N) availability, and overall soil health, yet are underused in strawberry ( Fragaria × ananassa ) production in North Carolina. This study was aimed at evaluating six summer cover crop treatments including pearl millet ( Pennisetum glaucum ), soybean ( Glycine max ), cowpea ( Vigna unguiculata ), pearl millet/soybean combination, pearl millet/cowpea combination, and a no cover crop control, with and without vermicompost additions for their effects on strawberry growth, yields, nutrient uptake, weeds, and soil inorganic nitrate-nitrogen and ammonium-nitrogen in a 2-year field experiment. Compost was additionally applied before seeding cover crops and preplant N fertilizer was reduced by 67% to account for organic N additions. Although all cover crops (with compost) increased soil N levels during strawberry growth compared with the no cover crop treatment, cover crops did not impact strawberry yields in the first year of the study. In the 2nd year, pearl millet cover crop treatments reduced total and marketable strawberry yields, and soybean treatments reduced marketable strawberry yields when compared with the no cover crop treatment, whereas vermicompost additions increased strawberry biomass and yields. Results from this study suggest that vermicompost additions can be important sustainable soil management strategies for transitional and certified organic strawberry production. Summer cover crops integrated with composts can provide considerable soil N, reducing fertilizer needs, but have variable responses on strawberry depending on the specific cover crop species or combination. Moreover, these practices are suitable for both organic and conventional strawberry growers and will benefit from longer-term studies that assess these practices individually and in combination and other benefits in addition to yields.}, number={5}, journal={HORTTECHNOLOGY}, author={Beck, John E. and Schroeder-Moreno, Michelle S. and Fernandez, Gina E. and Grossman, Julie M. and Creamer, Nancy G.}, year={2016}, month={Oct}, pages={604–613} }
 @article{bradish_fernandez_bushakra_perkins-veazie_dossett_bassil_finn_2016, title={Evaluation of vigor and winter hardiness of black raspberry breeding populations (Rubus occidentalis) grown in the southeastern US}, volume={1133}, ISSN={["2406-6168"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84973606487&partnerID=MN8TOARS}, DOI={10.17660/actahortic.2016.1133.19}, abstractNote={Demand for fresh berry products continues to grow in the United States; however, commercial raspberry production in the southeastern US is difficult because cultivars are not well adapted to the warm climate and fluctuating winter temperatures, where heat degrades plant vigor and fruit quality, and warm spells in mid to late winter can cause low chilling plants to break bud too early. Recent research about the health benefits of a polyphenolic-rich diet has led to a resurgence of interest and breeding efforts in black raspberry, and is the driving factor for this particular research. Two half-sib populations, ORUS 4304 and ORUS 4305 (307 progeny total) were planted in Jackson Springs, North Carolina in 2012. From fall 2012-spring 2015, a number of traits were measured on each plant, among them vigor, winter hardiness, and heat damage, analyzed in several different ways. Plant vigor increased or decreased over harvest seasons based on individual differences in the segregating plant population, but also showed correlations with temperature, i.e., less vigorous plants were more susceptible to damage by heat or cold. Overall, ORUS 4305 was less vigorous than ORSU 4304. As is the case with most raspberries grown in the southeast, vigor in general is expected to decrease over time; however, certain individuals show transgressive segregation for the trait. Linkage mapping for both populations is underway to identify and validate QTL for vigor, winter hardiness, heat tolerance, and other traits within black raspberry. Ultimately, we hope to gain a more complete understanding of black raspberry physiology and genetics to make breeding commercial quality cultivars a possibility in the southeast.}, number={1133}, journal={XI INTERNATIONAL RUBUS AND RIBES SYMPOSIUM}, publisher={International Society for Horticultural Science (ISHS)}, author={Bradish, C. M. and Fernandez, G. E. and Bushakra, J. M. and Perkins-Veazie, P. and Dossett, M. and Bassil, N. V. and Finn, C. E.}, year={2016}, pages={129–133} }
 @article{perkins-veazie_pattison_fernandez_ma_2016, title={Fruit Quality and Composition of Two Advanced North Carolina Strawberry Selections}, volume={16}, ISSN={["1553-8362"]}, DOI={10.1080/15538362.2016.1219289}, abstractNote={The advanced selections, NCS 10-038 and NCS 10-156, from the North Carolina breeding program were compared to the traditionally used cultivars, Camarosa and Chandler, for storage life and fruit composition in 2014 and 2015. Postharvest quality of NCS 10-038 was similar to that of ‘Camarosa’ and ‘Chandler’ after 8 days storage at 4 °C. NCS 10-156 was significantly worse in overall appearance and had more fruit shrivel, calyx browning, and mold than the other genotypes. However, NCS 10-156 was highest in soluble solids content and was similar in total anthocyanin content and total phenolic content to ‘Camarosa’ and ‘Chandler’. Further analysis of flavonoids by high performance liquid chromatography showed that NCS 10-156 was much lower in total flavonols than the other genotypes and comparable in anthocyanin pigments to ‘Chandler’. NCS 10-038, while similar in pigment profile to ‘Camarosa’, had less total anthocyanin than the other genotypes. NCS 10-038 had a lighter red color than the other genotypes and was similar in postharvest quality to ‘Chandler’ and ‘Camarosa’ and may be suitable for long-distance markets. NCS 10-156 is slightly softer than the other genotypes and more prone to mold while the higher soluble solids content may make it suitable for direct market sales. Both selections show postharvest promise for strawberry production in the humid mid-South region.}, journal={INTERNATIONAL JOURNAL OF FRUIT SCIENCE}, author={Perkins-Veazie, Penelope and Pattison, Jeremy and Fernandez, Gina and Ma, Guoying}, year={2016}, pages={220–227} }
 @article{bradish_bushakra_dossett_bassil_finn_fernandez_2016, title={Genotyping and phenotyping heat tolerance in black raspberry (Rubus occidentalis L.)}, volume={1127}, ISSN={["2406-6168"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85007373316&partnerID=MN8TOARS}, DOI={10.17660/actahortic.2016.1127.50}, number={1127}, journal={XXIX INTERNATIONAL HORTICULTURAL CONGRESS ON HORTICULTURE: SUSTAINING LIVES, LIVELIHOODS AND LANDSCAPES (IHC2014): INTERNATIONAL SYMPOSIUM ON PLANT BREEDING IN HORTICULTURE}, publisher={International Society for Horticultural Science (ISHS)}, author={Bradish, C. M. and Bushakra, J. M. and Dossett, M. and Bassil, N. V. and Finn, C. E. and Fernandez, G. E.}, year={2016}, pages={321–324} }
 @article{kim_perkins-veazie_fernandez_2016, title={Phenolic compounds and antioxidant capacity of organically grown fresh market blackberries}, volume={1133}, ISSN={["0567-7572"]}, DOI={10.17660/actahortic.2016.1133.55}, journal={XI INTERNATIONAL RUBUS AND RIBES SYMPOSIUM}, author={Kim, Moo Jung and Perkins-Veazie, P. and Fernandez, G. E.}, year={2016}, pages={353–356} }
 @book{fernandez_hummer_2016, title={Proceedings of the XI International Rubus and Ribes Symposium}, publisher={ISHS}, year={2016} }
 @article{bushakra_bradish_weber_dossett_fernandez_weiland_peterson_scheerens_robbins_serce_et al._2016, title={Toward understanding genotype x environment interactions in black raspberry (Rubus occidentalis L.)}, volume={1117}, ISSN={["0567-7572"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84971528876&partnerID=MN8TOARS}, DOI={10.17660/actahortic.2016.1117.5}, number={1117}, journal={XXIX INTERNATIONAL HORTICULTURAL CONGRESS ON HORTICULTURE: SUSTAINING LIVES, LIVELIHOODS AND LANDSCAPES (IHC2014): II INTERNATIONAL BERRY FRUIT SYMPOSIUM: INTERACTIONS! LOCAL AND GLOBAL BERRY RESEARCH AND INNOVATION}, publisher={International Society for Horticultural Science (ISHS)}, author={Bushakra, J. M. and Bradish, C. M. and Weber, C. A. and Dossett, M. and Fernandez, G. and Weiland, J. and Peterson, M. and Scheerens, J. C. and Robbins, L. and Serce, S. and et al.}, year={2016}, pages={25–29} }
 @article{bradish_yousef_ma_perkins-veazie_fernandez_2015, title={Anthocyanin, carotenoid, tocopherol, and ellagitannin content of red raspberry cultivars grown under field or high tunnel cultivation in the Southeastern United States}, volume={140}, number={2}, journal={Journal of the American Society for Horticultural Science}, author={Bradish, C. M. and Yousef, G. G. and Ma, G. Y. and Perkins-Veazie, P. and Fernandez, G. E.}, year={2015}, pages={163–171} }
 @article{rysin_mcwhirt_fernandez_louws_schroeder-moreno_2015, title={Economic viability and environmental impact assessment of three different strawberry production systems in the Southeastern United States}, volume={25}, number={4}, journal={HortTechnology}, author={Rysin, O. and McWhirt, A. and Fernandez, G. and Louws, F. J. and Schroeder-Moreno, M.}, year={2015}, pages={585–594} }
 @article{kim_perkins-veazie_ma_fernandez_2015, title={Shelf life and changes in phenolic compounds of organically grown blackberries during refrigerated storage}, volume={110}, ISSN={["1873-2356"]}, DOI={10.1016/j.postharvbio.2015.08.020}, abstractNote={Fruit of organically grown fresh market blackberry cultivars ‘Natchez’, ‘Ouachita’, and ‘Navaho’ harvested at shiny black and dull black ripeness stages were stored at 1 °C for 15 d or at 1 °C for 13 d plus 20 °C for 2 d. Berries were subjectively rated and anthocyanins and phenolic compounds were analyzed by high performance liquid chromatography (HPLC) to determine storage effects on berry postharvest quality and phenolic compounds. Berries harvested at the shiny black ripeness stage or those stored constantly at 1 °C had lower leakage, decay, and softness and a higher overall rating. ‘Navaho’ fruit had generally better storability compared to the other cultivars. Total anthocyanin content was generally higher in ‘Natchez’ and ‘Navaho’ than in ‘Ouachita’, and increased with storage at 20 °C for 2 d, while shiny black and dull black fruit were similar in anthocyanin content. Cyanidin 3-glucoside was found to represent 87–96% of the total anthocyanin content, and cyanidin 3-rutinoside, cyanidin 3-xyloside, and pelargonidin 3-glucoside were also detected. Total phenolic content increased during storage for all cultivars, especially when berries were stored at 20 °C for 2 d. Hydroxybenzoic acids were the primary phenolic compounds identified in fruit tissues of the three cultivars. Content and proportion of cyanidin 3-xyloside and vanillic acid in ‘Natchez’ were significantly lower than in ‘Ouachita’ or ‘Navaho’ fruit. Results indicate that the fruit of blackberry fruit of these cultivars, when grown organically, could be held with acceptable results when harvested at the shiny black stage of ripeness and stored at 1 °C. Transferring fruit to room temperature for as little as 2 d, even after cold storage, decreased marketability. In contrast, phenolic composition differed among cultivars and generally increased with storage.}, journal={POSTHARVEST BIOLOGY AND TECHNOLOGY}, author={Kim, Moo Jung and Perkins-Veazie, Penelope and Ma, Guoying and Fernandez, Gina}, year={2015}, month={Dec}, pages={257–263} }
 @article{bassil_gilmore_hummer_weber_dossett_agunga_rhodes_mockler_scheerens_filichkin_et al._2014, title={Genetic and Genomic Resources in Black Raspberry}, volume={8}, ISSN={0567-7572 2406-6168}, url={http://dx.doi.org/10.17660/actahortic.2014.1048.1}, DOI={10.17660/actahortic.2014.1048.1}, abstractNote={Over the last 75 years, the black raspberry industry in the United States has steadily declined due to lack of adapted and disease resistant cultivars. The high anthocyanin content of black raspberry and associated health benefits have revived interest in production and breeding new cultivars. The United States Department of Agriculture (USDA) Agricultural Research Service, National Clonal Germplasm Repository manages black raspberry germplasm and maintains a collection of over 175 accessions. Wild black raspberries collected in their native range from more than 130 locations across 27 US states and two Canadian provinces were recently added to this collection. Evaluation of this wild germplasm led to the identification of four sources of aphid resistance, two of which were introgressed into the elite breeding pool in two mapping populations. A major focus of this project is to develop, and make available, genomic tools including linkage and physical maps, a draft genome assembly, ESTs, SNP and SSR markers for use in black and red raspberry breeding. We will study genotype by environment interactions in this black raspberry germplasm in four different production regions across North America and apply the genomic tools to identify QTL important for breeding objectives. These tools will facilitate informed decisions regarding germplasm value and usage, crossing, and selection through marker-assisted breeding, and will be useful for breeding programs across the US. Here, we present the current status of global genetic resources and genomic research in black raspberry.}, number={1048}, journal={Acta Horticulturae}, publisher={International Society for Horticultural Science (ISHS)}, author={Bassil, N. and Gilmore, B. and Hummer, K. and Weber, C. and Dossett, M. and Agunga, R. and Rhodes, E. and Mockler, T. and Scheerens, J.C. and Filichkin, S. and et al.}, year={2014}, month={Aug}, pages={19–24} }
 @article{molina-bravo_fernandez_sosinski_2014, title={Quantitative trait locus analysis of tolerance to temperature fluctuations in winter, fruit characteristics, flower color, and prickle-free canes in raspberry}, volume={33}, ISSN={["1572-9788"]}, DOI={10.1007/s11032-013-9947-4}, number={2}, journal={MOLECULAR BREEDING}, author={Molina-Bravo, Ramon and Fernandez, Gina E. and Sosinski, Bryon R.}, year={2014}, month={Feb}, pages={267–280} }
 @article{fernandez_ballington_perkins-veazie_2013, title={'Von' Thornless Blackberry}, volume={48}, ISSN={["0018-5345"]}, DOI={10.21273/hortsci.48.5.654}, number={5}, journal={HORTSCIENCE}, author={Fernandez, Gina E. and Ballington, James R. and Perkins-Veazie, Penelope}, year={2013}, month={May}, pages={654–656} }
 @article{burrack_fernandez_spivey_kraus_2013, title={Variation in selection and utilization of host crops in the field and laboratory by Drosophila suzukii Matsumara (Diptera: Drosophilidae), an invasive frugivore}, volume={69}, ISSN={["1526-4998"]}, DOI={10.1002/ps.3489}, abstractNote={BACKGROUND Drosophila suzukii, a pest of soft-skinned berries and stone fruits, has recently rapidly expanded its global range. The impacts of D. suzukii infestation and subsequent fruit damage in North America and Europe have been profound. The aim of the present work was to assess host selection of D. suzukii in the field and laboratory, with an emphasis on hosts commonly grown in the southeastern United States, where D. suzukii has been established since 2010. RESULTS Raspberries were infested at a greater rate than blackberries in the field, and varieties within both species were infested at different rates. Primocane-fruiting blackberries were often the least heavily infested. Further, blackberries and raspberries grown under high tunnels were infested at lower rates than those grown outside. Fruit and artificial substrates with a lower surface penetration force were more heavily infested than firmer substrates in the laboratory; no eggs were laid in artificial substrates exceeding 52.00 cN surface penetration force. CONCLUSION Infestation rates differ between species and varieties within species of Rubus in the southeastern United States. Fruit penetration force is one potential measure of host susceptibility, but host attractiveness will likely depend upon additional factors, such as soluble sugar content. © 2013 Society of Chemical Industry}, number={10}, journal={PEST MANAGEMENT SCIENCE}, author={Burrack, Hannah J. and Fernandez, Gina E. and Spivey, Taylor and Kraus, Dylan A.}, year={2013}, month={Oct}, pages={1173–1180} }
 @inproceedings{fernandez_perkins-veazie_2013, title={Yield and postharvest attributes of caneberries grown under high tunnels and in the open field in North Carolina}, volume={987}, DOI={10.17660/actahortic.2013.987.12}, booktitle={International symposium on high tunnel horticultural crop production}, author={Fernandez, Gina and Perkins-Veazie, P.}, year={2013}, pages={89–98} }
 @article{bradish_perkins-veazie_fernandez_xie_jia_2012, title={Comparison of Flavonoid Composition of Red Raspberries (Rubus idaeus L.) Grown in the Southern United States}, volume={60}, ISSN={["1520-5118"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84862185617&partnerID=MN8TOARS}, DOI={10.1021/jf203474e}, abstractNote={Raspberry flavonoid compounds have significant antioxidant activities, and regular consumption may help prevent and/or moderate chronic diseases. Targeted metabolite profiling is useful to identify compounds contributing to these antioxidant properties and health benefits and for tailored breeding for functional foods. In this study, metabolomic variation was determined among three fall-fruiting red raspberry cultivars (‘Autumn Britten’, ‘Caroline’, ‘Nantahala’) grown at three North Carolina locations differing in elevation and average day/night temperatures. ‘Nantahala’ was specifically bred for the mountainous regions of the southern United States. Ten flavonoid compounds were detected by liquid chromatography–time-of-flight–mass spectrometry (LC-TOF-MS). Of those, cyanidin-3-glucoside, cyanidin-3-sophoroside, cyanidin-3-rutinoside, cyanidin-3-sambubioside, and quercetin-3-glucoside were quantified against external standards. Variation in flavonoid composition was primarily attributed to genotype and associated with night temperature and hours exposed to temperatures over 29 °C. ‘Nantahala’ had particularly high levels of cyanidin-3-sambubioside, indicative of its purple raspberry lineage. Quercetin-3-glucoside levels increased the most with elevated temperatures.}, number={23}, journal={JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY}, author={Bradish, Christine M. and Perkins-Veazie, Penelope and Fernandez, Gina E. and Xie, Guoxiang and Jia, Wei}, year={2012}, month={Jun}, pages={5779–5786} }
 @article{molina-bravo_arellano_sosinski_fernandez_2011, title={A protocol to assess heat tolerance in a segregating population of raspberry using chlorophyll fluorescence}, volume={130}, ISSN={["1879-1018"]}, DOI={10.1016/j.scienta.2011.07.022}, abstractNote={A detached leaf protocol was developed to assess heat tolerance in raspberry (Rubus L. subgenus Idaeobatus) by measuring chlorophyll fluorescence. In order to establish the heat screen protocol for field measurements in a segregating population, several baseline experiments were performed on genotypes with known heat tolerance based on visual observations in multiple climates. ‘Mandarin’ and ‘Qualicum’ were used as heat tolerant and heat susceptible controls, respectively. We determined that: optimum collection time was in the morning before ambient temperatures reached 28 °C, critical temperature (Tc) was 45 °C, minimum duration of dark adaptation was 15 min, and optimum heat shock duration was 30 min. Parameters established in baseline experiments were subsequently used for screening a large population (196 genotypes) planted in the field, where warm conditions commonly occur (maximum temperatures ranging between 30 and 35 °C). A significant difference in chlorophyll fluorescence was found between the two controls; ‘Qualicum’, the heat sensitive cultivar, had the lowest Fv/Fm (variable fluorescence/maximum fluorescence) value, while 18.8% of the segregating population had a higher Fv/Fm value than ‘Mandarin’, the heat tolerant cultivar. We have identified 106 individuals with an Fv/Fm above 0.600 (representing 52% of the population), and 7 individuals above 0.680 (4% of the population). The distribution of heat tolerance within the population was essentially normal, and thus quantitative trait analysis is a plausible approach for studying heat tolerance. This protocol has potential application to other Rosaceae species, and is not dependent on visual assessment.}, number={3}, journal={SCIENTIA HORTICULTURAE}, author={Molina-Bravo, Ramon and Arellano, Consuelo and Sosinski, Bryon R. and Fernandez, Gina E.}, year={2011}, month={Sep}, pages={524–530} }
 @article{garland_schroeder-moreno_fernandez_creamer_2011, title={Influence of summer cover crops and mycorrhizal fungi on strawberry production in the Southeastern United States}, volume={46}, number={7}, journal={HortScience}, author={Garland, B. C. and Schroeder-Moreno, M. S. and Fernandez, G. E. and Creamer, N. G.}, year={2011}, pages={985–992} }
 @article{fernandez_ballington_2010, title={Performance of primocane-fruiting experimental blackberry cultivars in the Southern Appalachian Mountains}, volume={20}, number={6}, journal={HortTechnology}, author={Fernandez, G. E. and Ballington, J. R.}, year={2010}, pages={996–1000} }
 @article{fernandez_ballington_bryson_2009, title={'Nantahala' red raspberry}, volume={44}, number={1}, journal={HortScience}, author={Fernandez, G. E. and Ballington, J. R. and Bryson, S. J.}, year={2009}, pages={25–26} }
 @article{tzanetakis_guzman-baeny_vanesbroeck_fernandez_martin_2009, title={First Report of Impatiens necrotic spot virus in Blackberry in the Southeastern United States}, volume={93}, ISSN={["0191-2917"]}, DOI={10.1094/PDIS-93-4-0432A}, abstractNote={Blackberry yellow vein disease (BYVD) has emerged as an important disease of blackberry (Rubus spp.) in the south and southeastern United States (2,3). In an effort to characterize viruses that may be involved in the disease, double-stranded RNA extracted from a symptomatic ‘Apache’ blackberry from South Carolina was used for shotgun cDNA cloning (4). Sequence analysis showed that in addition to Blackberry yellow vein associated virus (BYVaV) (2), a constant component of BYVD, sequences of Impatiens necrotic spot virus (INSV) also were obtained. The 623-nt fragment of INSV (Genbank Accession No. EU287930) shared 98% nucleotide and amino acid sequence identity with GenBank Accession No. NC003616. Confirmation of the results of the initial shotgun cloning was done by reverse transcription-PCR with primers INSVF (5′ GATCTGTCCTGGGATTGTTC 3′) and INSVR (5′ GTCTCCTTCTGGTTCTATAATCAT 3′) that amplify a 460 base fragment of the M RNA of INSV. Amplicons obtained from single-stranded and dsRNA templates were sequenced and found to be identical with EU287930. The identity of INSV by PCR was also supported by positive results with a commercially available INSV-ELISA kit (AC Diagnostics, Fayetteville, AR). Earlier, more than 400 plants from North Carolina, South Carolina, and Virginia with BYVD and other virus-like symptoms were tested for INSV by ELISA and approximately 33% were found to be infected with the virus (1). Thus, INSV appears to be one of the major viruses infecting blackberry in the southeastern United States, and it remains to be seen if INSV acts synergistically with BYVaV and other viruses to contribute to the severity of BYDV. To our knowledge, this is the first report of INSV infecting Rubus spp. References: (1) T. L. Guzmán-Baeny. M.S. thesis. North Carolina State University, Raleigh, 2003. (2) J. Susaimuthu et al. Plant Pathol. 55:607, 2006. (3) J. Susaimuthu et al. Virus Res. 131:145, 2008. (4) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005.}, number={4}, journal={PLANT DISEASE}, author={Tzanetakis, I. E. and Guzman-Baeny, T. L. and VanEsbroeck, Z. P. and Fernandez, G. E. and Martin, R. R.}, year={2009}, month={Apr}, pages={432–432} }
 @article{ballington_fernandez_2008, title={Rubus breeding for the Southeastern United States}, volume={777}, journal={Acta Horticulturae}, author={Ballington, J.R. and Fernandez, G.E.}, year={2008}, pages={87–90} }
 @article{warmund_guinan_fernandez_2008, title={Temperatures and cold damage to small fruit crops across the eastern United States associated with the April 2007 freeze}, volume={43}, ISSN={["0018-5345"]}, DOI={10.21273/hortsci.43.6.1643}, abstractNote={An unprecedented freeze occurred between 4 and 10 Apr. 2007, causing extensive crop loss across a large area of the United States. This event occurred late in the spring and temperatures were unusually low for an extended period. Low-temperature injury on small fruit plants was reported in 21 states. Missouri and Arkansas experienced the highest estimated percentages of crop loss of grape ( Vitis spp .), strawberry ( Fragraria × ananassa Duch.), blueberry ( Vaccinium spp.), and blackberry ( Rubus subgenus Rubus Watson). Kentucky and Tennessee also reported high percentages of small fruit crop loss. Temperatures preceding the freeze event in the affected region were unusually warm and many of the crops were at a more advanced stage of growth than they would have been under more usual conditions. Although frost/freeze warnings were issued, the terminology used by different weather forecasters was inconsistent. Growers used various cold protection methods, but these were generally ineffective because of the stage of plant development and/or the advective nature of the freeze. Actual grape and blueberry crop losses may not be known for several years because of secondary injury to plant tissues from various pathogens.}, number={6}, journal={HORTSCIENCE}, author={Warmund, Michele Renee and Guinan, Patrick and Fernandez, Gina}, year={2008}, month={Oct}, pages={1643–1647} }
 @article{leandro_guzman_ferguson_fernandez_louws_2007, title={Population dynamics of Trichoderma in fumigated and compost-amended soil and on strawberry roots}, volume={35}, ISSN={["1873-0272"]}, DOI={10.1016/j.apsoil.2006.04.008}, abstractNote={Effectiveness of Trichoderma strains for biocontrol of soilborne pathogens requires an improved understanding of soil and root ecology of this fungus. We compared the population dynamics of Trichoderma hamatum strain T382 (T382) and indigenous Trichoderma spp. in soil and on roots in different strawberry production systems. Strawberry transplants, either amended or not-amended with Trichoderma biocontrol strains, were planted in field soil left untreated or treated with soil fumigant, compost, and compost-amended with T382. Soil and root samples were taken between October and June of two production seasons (2002-03 and 2003-04), and Trichoderma populations were assessed by plating soil dilutions and root pieces onto selective medium. Identity of T382 was confirmed using strain-specific primers. T382 became established and maintained a stable population of 103 cfu/g soil throughout the growing season when added to field soil in amended compost, but T382 was rarely isolated from strawberry roots. Populations of indigenous Trichoderma spp. were up to 60-fold greater in fumigated soil than in any other soil treatment. Indigenous Trichoderma spp. were isolated from a greater proportion (20–50%) of roots in fumigated soil than from roots in the other treatments (0–20%). Transplant treatments did not significantly affect Trichoderma populations on roots or in soil during field production. This study showed that compost may be used as a substrate to establish and promote survival of Trichoderma in field soil, and illustrates how soil manipulation can affect population dynamics of indigenous Trichoderma spp. on roots and in soil.}, number={1}, journal={APPLIED SOIL ECOLOGY}, publisher={Elsevier BV}, author={Leandro, L. F. S. and Guzman, T. and Ferguson, L. M. and Fernandez, G. E. and Louws, F. J.}, year={2007}, month={Jan}, pages={237–246} }
 @article{leandro_ferguson_louws_fernandez_2007, title={Strawberry growth and productivity in fumigated compared to compost-amended production systems}, volume={42}, number={2}, journal={HortScience}, author={Leandro, L. F. S. and Ferguson, L. M. and Louws, F. J. and Fernandez, G. E.}, year={2007}, pages={227–231} }
 @article{sydorovych_safley_ferguson_poling_fernandez_brannen_monks_louws_2006, title={Economic evaluation of methyl bromide alternatives for the production of strawberries in the southeastern United States}, volume={16}, number={1}, journal={HortTechnology}, author={Sydorovych, O. and Safley, C. D. and Ferguson, L. M. and Poling, E. B. and Fernandez, G. E. and Brannen, P. A. and Monks, D. M. and Louws, F. J.}, year={2006}, pages={118–128} }
 @article{safley_boldea_fernandez_2006, title={Estimated costs of producing, harvesting, and marketing blackberries in the southeastern United States}, volume={16}, number={1}, journal={HortTechnology}, author={Safley, C. D. and Boldea, O. and Fernandez, G. E.}, year={2006}, pages={109–117} }
 @article{martin_tzanetakis_gergerich_fernández_pesic_2004, title={Blackberry yellow vein associated virus: A new crinivirus found in blackberry.}, volume={9}, ISSN={0567-7572 2406-6168}, url={http://dx.doi.org/10.17660/actahortic.2004.656.21}, DOI={10.17660/actahortic.2004.656.21}, abstractNote={During the last three years blackberries in southern and southeastern U.S. have shown symptoms of vein clearing, yellow mottling and plant decline with considerable variation in symptoms with cultivars. We isolated dsRNA from symptomatic plants and identified high molecular weight bands similar to those isolated from plants infected with criniviruses. Paired extractions from virus-tested blackberries did not yield any dsRNA bands with molecular weight greater than 500 bp. Using degenerate primers developed against the crinivirus 1b protein in RTPCR resulted in an amplicon that when sequenced showed the virus was a member of the Crinivirus genus. We have also cloned the virus and sequenced clones containing regions of the minor coat protein of the virus. Phylogenetic analysis revealed that the new virus, designated as Blackberry yellow vein associated virus (BYVaV), is related most closely to Beet pseudo-yellows virus and Strawberry pallidosis associated virus, two criniviruses recently identified in strawberry. INTRODUCTION Symptoms of vein clearing, yellow mottling, ringspots and plant decline have been observed in blackberry in South Carolina, North Carolina and Arkansas over the past few years (Fig. 1). Initially the symptoms were thought to be caused by Tobacco ringspot virus (TRSV) as this virus is known to infect blackberry and similar symptoms attributed to TRSV infection have been reported (1). Symptomatic plants were tested for 14 viruses by ELISA including: Alfalfa mosaic, Arabis mosaic, Cucumber mosaic, Impatiens necrotic spot, Prunus necrotic ringspot, Raspberry bushy dwarf, Raspberry ringspot, Strawberry latent ringspot, Strawberry mild yellow edge, Tobacco ringspot, Tobacco streak, Tomato ringspot, and Tomato spotted wilt viruses as well as for Potyviruses using group specific antibodies. However, in ELISA tests very few plants that exhibited these symptoms tested positive for TRSV or any other virus. In this report we describe a crinivirus associated with the symptoms observed in blackberry and a reverse-transcritase polymerase chain reaction (RT-PCR) method for detecting this new virus. MATERIALS AND METHODS In an attempt to determine if there may be a new virus associated with these symptoms dsRNA was extracted from symptomatic and asymptomatic plants using a shortened version of the standard extraction method (2). After the dsRNA was bound to the cellulose powder in the presence of 16% ethanol in STE buffer, the samples were centrifuged for three minutes at 5,000 X g, the pellet was washed once with 50 ml of STE-EtOH and the cellulose repelleted by centrifugation. Two ml of STE was added to the final pellet and incubated at room temp for 5 min. The sample was then transferred to a microfuge tube and pellet at max rpm for 3 min. The supernatant was collected and nucleic acid precipitated by the addition of 2 ml of 95% EtOH with 5% 3 M sodium acetate. Samples were mixed then stored at -80C for 20 minutes before centrifugation in a microfuge at max speed for 30 minutes. Pellets were resuspend in 10 mM Tris-HCl containing 1 mM EDTA and analyzed by gel electrophoresis. Proc. X IS on Small Fruit Virus Diseases}, number={656}, journal={Acta Horticulturae}, publisher={International Society for Horticultural Science (ISHS)}, author={Martin, R.R. and Tzanetakis, I.E. and Gergerich, R. and Fernández, G. and Pesic, Z.}, year={2004}, month={Sep}, pages={137–142} }
 @article{leandro_ferguson_fernandez_louws_2004, title={Evaluation of Trichoderma strains as biocontrol tools for integrated management of strawberry root rot}, ISBN={9290671708}, journal={Proceedings of a meeting of the WGs : management of plant diseases and arthropod pests by BCAs and their integration in agriculture systems at S. Michele all'Adige, Trentino, Italy, 9-13 June 2004}, publisher={Dijon, France : International Organization for Biological and Integrated Control of Noxious Animals and Plants, West Palaearctic Regional Section}, author={Leandro, L. and Ferguson, L. and Fernandez, G. and Louws, F.}, editor={Y. Elad, I. Pertot and Enkegaard, A.Editors}, year={2004} }
 @article{fernandez_ballington_2003, title={DOUBLE CROPPING OF STRAWBERRIES IN AN ANNUAL SYSTEM USING CONDITIONED PLUG PLANTS AND HIGH TUNNELS}, ISBN={["90-6605-300-3"]}, ISSN={0567-7572 2406-6168}, url={http://dx.doi.org/10.17660/actahortic.2003.614.81}, DOI={10.17660/actahortic.2003.614.81}, abstractNote={ISHS VI International Symposium on Protected Cultivation in Mild Winter Climate: Product and Process Innovation DOUBLE CROPPING OF STRAWBERRIES IN AN ANNUAL SYSTEM USING CONDITIONED PLUG PLANTS AND HIGH TUNNELS}, number={614}, journal={Acta Horticulturae}, publisher={International Society for Horticultural Science (ISHS)}, author={Fernandez, G.E. and Ballington, J.R.}, year={2003}, month={Sep}, pages={547–552} }
 @article{butler_fernandez_louws_2002, title={Strawberry plant growth parameters and yield among transplants of different types and from different geographic sources, grown in a plasticulture system}, volume={12}, number={1}, journal={HortTechnology}, author={Butler, L. M. and Fernandez, G. E. and Louws, F. J.}, year={2002}, pages={100–103} }
 @article{fernandez_2001, title={Fall-applied rowcovers enhance yield in plasticulture strawberries}, volume={11}, number={3}, journal={HortTechnology}, author={Fernandez, G. E.}, year={2001}, pages={440–444} }
 @article{fernandez_butler_louws_2001, title={Strawberry Growth and Development in an Annual Plasticulture System}, volume={36}, ISSN={0018-5345 2327-9834}, url={http://dx.doi.org/10.21273/hortsci.36.7.1219}, DOI={10.21273/hortsci.36.7.1219}, abstractNote={The growth and development of three strawberry cultivars commonly grown in a plasticulture system were documented. Strawberry plants were harvested monthly and divided by roots, crown, leaves, flowers, and fruit and then dried in an oven. The dry matter production and resource allocation proceeded along a predictable pattern of development. The establishment phase was characterized by an active period of growth of root, crown and leaves in the fall. Through the winter, the plants underwent slow growth, ending in a transition period in the late winter/early spring when resources were allocated to both vegetative and reproductive growth. In the spring, all plant parts received significantly increased allocation of, or redistribution of, resources. Cultivars of California origin, `Chandler' and `Camarosa', displayed similar trends in yield, dry matter production, seasonal resource allocation, and growth analysis variables throughout the season. `Sweet Charlie', a cultivar from Florida, showed lower dry matter accumulation and relative growth rate in the spring, higher harvest index and lower yield than the California cultivars.}, number={7}, journal={HortScience}, publisher={American Society for Horticultural Science}, author={Fernandez, Gina E. and Butler, Laura M. and Louws, Frank J.}, year={2001}, month={Dec}, pages={1219–1223} }
 @article{fernandez_pritts_1996, title={Carbon Supply Reduction has a Minimal Influence on Current Year's Red Raspberry (Rubus idaeus L.) Fruit Production}, volume={121}, ISSN={0003-1062 2327-9788}, url={http://dx.doi.org/10.21273/jashs.121.3.473}, DOI={10.21273/jashs.121.3.473}, abstractNote={A 2-year study was conducted to investigate the influence of the light environment on source-sink relationships in `Titan' red raspberry. Treatments imposed included flower and cane removal in conjunction with partial or whole canopy shading. Raspberry plants were remarkably resistant to a reduction in carbon supply. Yields and primocane production were maintained even when canopies were shaded. Furthermore, if raspberry plants were prevented from producing a full crop in one year, yields the following year tended to be higher than normal. These data, and other studies demonstrating that raspberry roots are strong carbon sinks, suggest that raspberry plants may rely on stored carbohydrate to mature the current crop of fruits when current photosynthate is inadequate. This trait is characteristic of some perennial species adapted to progressively changing environments, but may not be optimal for horticultural situations where growing conditions are relatively constant from year to year. A large root storage capacity and excessive primocane production likely contribute to the relatively low yields that are typical of this species.}, number={3}, journal={Journal of the American Society for Horticultural Science}, publisher={American Society for Horticultural Science}, author={Fernandez, Gina E. and Pritts, Marvin P.}, year={1996}, month={May}, pages={473–477} }
 @article{clark_irvin_fernandez_1994, title={Effects of Gibberellic Acid on Seed Traces of ‘Venus’ and ‘Saturn’ Grapes}, volume={2}, ISSN={1052-0015}, url={http://dx.doi.org/10.1300/j065v02n01_03}, DOI={10.1300/j065v02n01_03}, abstractNote={ABSTRACT Application of 150 or 300 ppm gibberellic acid (GA3) to ‘Venus’ table grapes 7 days after bloom resulted in reduced seed trace number but did not reduce individual seed trace weight. Neither berry nor cluster weight were affected by GA3, although a slight increase in yield was found in one of two years. Pre-bloom applications to ‘Venus’ produced no seed trace number or weight reductions, although a combined pre- and post-bloom treatment reduced seed trace weight significantly in one year. ‘Saturn’ had a slight reduction in seed trace number following a pre-bloom application one year, and a greater reduction was seen following application of pre- and post-bloom GA3 that same year. Post-bloom and combined applications during the following season gave similar reductions in seed trace number. Berry weight was increased for ‘Venus’ but not affected for ‘Saturn’ following the combined pre- and post-bloom applications.}, number={1}, journal={Journal of Small Fruit & Viticulture}, publisher={Informa UK Limited}, author={Clark, John R. and Irvin, Kelly M. and Fernandez, Gina E.}, year={1994}, month={Jan}, pages={11–19} }
 @article{fernandez_pritts_1994, title={Growth, Carbon Acquisition, and Source-Sink Relationships in `Titan' Red Raspberry}, volume={119}, ISSN={0003-1062 2327-9788}, url={http://dx.doi.org/10.21273/jashs.119.6.1163}, DOI={10.21273/jashs.119.6.1163}, abstractNote={Seasonal changes in growth, mean maximal photosynthetic rates, and the temperature and light response curves of `Titan' red raspberry ( Rubus idaeus L.) were obtained from potted plants grown under field conditions. Primocane dry weight accumulation increased steadily at the beginning and the end of the season, but growth slowed midseason during fruiting. The slower midseason dry-weight accumulation rate coincided with an increase in root dry weight. Primocane net assimilation rate (NAR) was highest early in the season. Floricane photosynthetic rates (A) were highest during the fruiting period, while primocane A remained steady throughout the season. Primocane and floricane leaflets displayed a midday depression in A under field conditions, with a partial recovery in the late afternoon. Photosynthetic rates of primocane and floricane leaves were very sensitive to temperature, exhibiting a decline from 15 to 40C. Light-response curves differed depending on cane type and time of year. A temporal convergence of sink demand from fruit, primocanes, and roots occurs when plants experience high temperatures. These factors may account for low red raspberry yield.}, number={6}, journal={Journal of the American Society for Horticultural Science}, publisher={American Society for Horticultural Science}, author={Fernandez, Gina E. and Pritts, Marvin P.}, year={1994}, month={Nov}, pages={1163–1168} }
 @article{fernandez_pritts_1993, title={Growth and source-sink relationships in 'Titan' red raspberry}, volume={10}, ISSN={0567-7572 2406-6168}, url={http://dx.doi.org/10.17660/actahortic.1993.352.21}, DOI={10.17660/actahortic.1993.352.21}, number={352}, journal={Acta Horticulturae}, publisher={International Society for Horticultural Science (ISHS)}, author={Fernandez, Gina E. and Pritts, Marvin P.}, year={1993}, month={Oct}, pages={151–158} }
 @article{patten_neuendorff_nimr_clark_fernandez_1991, title={Cold Injury of Southern Blueberries as a Function of Germplasm and Season of Flower Bud Development}, volume={26}, ISSN={0018-5345 2327-9834}, url={http://dx.doi.org/10.21273/hortsci.26.1.18}, DOI={10.21273/hortsci.26.1.18}, abstractNote={The relative tolerance of flower buds and flowers of southern highbush blueberry (Vaccinium spp.) to cold damage was compared to rabbiteye (Vaccinium ashei Reade) and highbush blueberry (Vaccinium corymbosum L.). For similar stages of floral bud development, southern highbush and highbush cultivars had less winter freeze and spring frost damage than rabbiteye cultivars. Cold damage increased linearly with stage of flower bud development. Small fruit were more sensitive to frost damage than open flowers. Rabbiteye blueberry flower buds formed during the fall growth flush were more hardy than buds formed during the spring growth flush, regardless of cultivar or stage of development.}, number={1}, journal={HortScience}, publisher={American Society for Horticultural Science}, author={Patten, Kim and Neuendorff, Elizabeth and Nimr, Gary and Clark, John R. and Fernandez, Gina}, year={1991}, month={Jan}, pages={18–20} }
 @article{fernandez_clark_moore_1991, title={Effect of Seedcoat Manipulation on the Germination of Stenospermocarpic Grape Embryos Cultured in Ovulo}, volume={26}, ISSN={0018-5345 2327-9834}, url={http://dx.doi.org/10.21273/hortsci.26.9.1220}, DOI={10.21273/hortsci.26.9.1220}, number={9}, journal={HortScience}, publisher={American Society for Horticultural Science}, author={Fernandez, Gina E. and Clark, John R. and Moore, J.N.}, year={1991}, month={Sep}, pages={1220} }
 @article{fernandez_clark_1991, title={In Vitro Propagation of the Erect Thornless `Navaho' Blackberry}, volume={26}, ISSN={0018-5345 2327-9834}, url={http://dx.doi.org/10.21273/hortsci.26.9.1219}, DOI={10.21273/hortsci.26.9.1219}, number={9}, journal={HortScience}, publisher={American Society for Horticultural Science}, author={Fernandez, Gina E. and Clark, John R.}, year={1991}, month={Sep}, pages={1219} }