@article{stephens_gannon_thiessen_cubeta_kerns_2023, title={In Vitro Fungicide Sensitivity and Effect of Organic Matter Concentration on Fungicide Bioavailability in Take-All Root Rot Pathogens Isolated from North Carolina}, volume={24}, ISSN={["1535-1025"]}, DOI={10.1094/PHP-08-22-0072-RS}, abstractNote={Take-all root rot (TARR) of ultradwarf bermudagrass is caused by Gaeumannomyces graminis (Gg), Gaeumannomyces graminicola (Ggram), Candidacolonium cynodontis (Cc), and Magnaporthiopsis cynodontis (Mc). Multiple pathogens have recently been associated with this disease, and biological parameters such as fungicide sensitivity have not been explored in ultradwarf bermudagrass. Although fungicides are commonly used to mitigate disease development, high organic matter present in the turfgrass system could limit the bioavailability of fungicides. Fungicide bioavailability can be influenced by organic matter concentration, and the physicochemical properties of fungicides could provide insight into their binding affinity. However, the influence of organic matter content on fungicide bioavailability has not been investigated. Therefore, the in vitro sensitivity of Gg, Ggram, Cc, and Mc to 14 different fungicides across three chemical classes was determined. An in vitro bioavailability assay was developed using three fungicides and three organic matter concentrations. Generally, demethylation inhibitor and quinone outside inhibitor fungicides provided the greatest reduction in mycelial growth, whereas succinate dehydrogenase inhibitors did not reduce mycelial growth. These data can serve as a foundation for TARR pathogen sensitivity to inform in vitro fungicide sensitivity studies and field efficacy trials. Pyraclostrobin and propiconazole have a high affinity to bind to organic matter, which was evident as more fungicide was required to inhibit Gg growth as organic matter concentration increased. This was not observed when evaluating azoxystrobin, which has a lower binding affinity. Understanding how TARR pathogens respond to fungicide in vitro and how organic matter concentration affects in vitro sensitivity will improve fungicide selection for management of TARR.}, number={2}, journal={PLANT HEALTH PROGRESS}, author={Stephens, Cameron M. and Gannon, Travis W. and Thiessen, Lindsey D. and Cubeta, Marc A. and Kerns, James P.}, year={2023}, month={Jul}, pages={162–170} }
 @article{stephens_gannon_cubeta_sit_kerns_2022, title={Characterization and Aggressiveness of Take-All Root Rot Pathogens Isolated from Symptomatic Bermudagrass Putting Greens}, volume={112}, ISSN={["1943-7684"]}, DOI={10.1094/PHYTO-05-21-0215-R}, abstractNote={Take-all root rot is a disease of ultradwarf bermudagrass putting greens caused by Gaeumannomyces graminis (Gg), Gaeumannomyces sp. (Gx), Gaeumannomyces graminicola (Ggram), Candidacolonium cynodontis (Cc), and Magnaporthiopsis cynodontis (Mc). Many etiological and epidemiological components of this disease remain unknown. Improving pathogen identification and our understanding of the aggressiveness of these pathogens along with growth at different temperatures will advance our knowledge of disease development to optimize management strategies. Take-all root rot pathogens were isolated from symptomatic bermudagrass root and stolon pieces from 16 different golf courses. Isolates of Gg, Gx, Ggram, Cc, and Mc were used to inoculate 'Champion' bermudagrass in an in planta aggressiveness assay. Each pathogen was also evaluated at 10, 15, 20, 25, 30, and 35°C to determine growth temperature optima. Infected plant tissue was used to develop a real-time PCR high-resolution melt assay for pathogen detection. This assay was able to differentiate each pathogen directly from infected plant tissue using a single primer pair. In general, Ggram, Gg, and Gx were the most aggressive while Cc and Mc exhibited moderate aggressiveness. Pathogens were more aggressive when incubated at 30°C compared with 20°C. While they grew optimally between 24.4 and 27.8°C, pathogens exhibited limited growth at 35°C and no growth at 10°C. These data provide important information on this disease and its causal agents that may improve take-all root rot management.}, number={4}, journal={PHYTOPATHOLOGY}, author={Stephens, Cameron M. and Gannon, Travis W. and Cubeta, Marc A. and Sit, Tim L. and Kerns, James P.}, year={2022}, month={Apr}, pages={811–819} }
 @article{hutchens_henderson_bush_kerns_mccall_2022, title={Geographic Distribution of Ophiosphaerella Species in the Mid-Atlantic United States}, volume={23}, ISSN={["1535-1025"]}, DOI={10.1094/PHP-04-21-0076-S}, abstractNote={Spring dead spot (SDS) of bermudagrass (Cynodon dactylon) is primarily caused by Ophiosphaerella herpotricha and Ophiosphaerella korrae in North America. These two species respond differently to numerous management practices, grow optimally at different soil pH ranges, and differ in aggressiveness. Understanding the Ophiosphaerella species distribution in regions where SDS occurs will allow turfgrass managers to tailor their management practices toward the predominant species present. A survey was conducted in the Mid-Atlantic United States in which 1 to 14 samples of bermudagrass expressing SDS symptoms were taken from 51 athletic fields, golf courses, or sod farms across Delaware, Maryland, North Carolina, and Virginia. DNA was isolated from necrotic root and stolon tissue, amplified using species-specific primers, and detected in a real-time PCR assay. At least one isolate of O. herpotricha was recovered from 76% of the locations, and O. korrae was recovered from 73% of the locations. O. herpotricha was amplified from 55% of the samples, whereas O. korrae was amplified from 37% of the samples. There were distinct regions in the Mid-Atlantic in which either O. herpotricha or O. korrae was predominant. O. herpotricha was predominant in western Virginia, central North Carolina, Delaware, and eastern Maryland. However, O. korrae was predominant in central Maryland and Virginia as well as eastern Virginia and North Carolina. O. herpotricha was isolated from certain cultivars more frequently than O. korrae and vice versa. These survey results elucidate the geographic distribution of O. herpotricha and O. korrae throughout the Mid-Atlantic United States.}, number={1}, journal={PLANT HEALTH PROGRESS}, author={Hutchens, Wendell J. and Henderson, Caleb A. and Bush, Elizabeth A. and Kerns, James P. and McCall, David S.}, year={2022}, pages={93–100} }
 @article{zeng_chen_ni_zhao_kerns_tredway_roberts_2022, title={Morphological and Molecular Characterization of Prevalent Plant-Parasitic Nematodes from Turfgrasses in Guangdong, China}, volume={8}, ISSN={["2311-7524"]}, DOI={10.3390/horticulturae8070611}, abstractNote={The turfgrass industry has undergone a rapid development in Guangdong province, China, which has the largest number of golf courses in the country. Recent surveys of turfgrasses in the province revealed five plant-parasitic nematodes that are prevalent: Helicotylenchus dihystera, Mesocriconema xenoplax, Meloidogyne graminis, Hemicriconemoides rosae and Tylenchorhynchus leviterminalis. The most prevalent species are M. xenoplax and M. graminis, found in 60.6% and 27.3% of locations, respectively. These five species are morphologically and morphometrically described. Molecular characterization and phylogenetic analyses using 18S rRNA and the D2-D3 expansion segments of 28S rRNA sequences are provided. This is the first report on molecular characterization and phylogenetic relationships of plant-parasitic nematodes associated with turfgrasses in Guangdong, China. This work was a first step for future study including pathogenicity assay, relationship examination with other pathogens and development of control measures of these turf nematodes to provide more precise and effective management options to turf superintendents.}, number={7}, journal={HORTICULTURAE}, author={Zeng, Yongsan and Chen, Xiaoguan and Ni, Yibei and Zhao, Chen and Kerns, James and Tredway, Lane and Roberts, Joseph}, year={2022}, month={Jul} }
 @article{kimberly n. d'arcangelo_adams_kerns_quesada-ocampo_2021, title={Assessment of fungicide product applications and program approaches for control of downy mildew on pickling cucumber in North Carolina}, volume={140}, ISSN={["1873-6904"]}, url={https://doi.org/10.1016/j.cropro.2020.105412}, DOI={10.1016/j.cropro.2020.105412}, abstractNote={Pseudoperonospora cubensis, the causal agent of cucurbit downy mildew (CDM), is the most economically devastating and widespread disease of cucurbitaceous crops in the Eastern United States (US). Cucumbers are particularly susceptible and as a result, disease management of P. cubensis relies heavily on fungicide use. The re-emergence of P. cubensis in the US in 2004 resulted in the failure of previously effective host resistance and the pathogen has become less sensitive to several fungicides, limiting the efficacy of crop protection. The implementation of effective spray programs is recommended to minimize the development of fungicide resistance in pathogen populations. However, few studies have examined annual efficacy trials to generate robust recommendations. To determine the efficacy of fungicide applications on CDM in pickling cucumber regarding disease severity and marketable yield, field experiments were conducted from 2013 to 2016 in North Carolina. Evaluations included single-product fungicide applications as well as program treatments on susceptible cultivars. Although there was some variability between years due to differences in products applied, our analysis revealed that several single-site treatments were effective in the suppression of disease, including treatments that included oxathiapiprolin, cyazofamid, propamocarb, ethaboxam, fluazinam, and a mixture of mancozeb/zoxamide. Additionally, when compared to the non-treated controls, spray programs that included tank mixes with protectants and alternations of fungicide modes of action, resulted in lower levels of downy mildew and increased marketable yield.}, journal={CROP PROTECTION}, publisher={Elsevier BV}, author={Kimberly N. D'Arcangelo and Adams, Mike L. and Kerns, James P. and Quesada-Ocampo, Lina M.}, year={2021}, month={Feb} }
 @article{lookabaugh_kerns_shew_2021, title={Evaluating Fungicide Selections to Manage Pythium Root Rot on Poinsettia Cultivars with Varying Levels of Partial Resistance}, volume={105}, ISSN={["1943-7692"]}, DOI={10.1094/PDIS-04-20-0807-RE}, abstractNote={Pythium aphanidermatum is the predominant species causing Pythium root rot of commercially grown poinsettia (Euphorbia pulcherrima Willd. ex Kotzch) in North Carolina. Pythium root rot is managed primarily through a combination of sanitation practices and preventative fungicide applications of mefenoxam or etridiazole. Insensitivity to mefenoxam is common but growers continue to rely on it from lack of inexpensive and efficacious alternatives. This research was conducted to identify alternative fungicides for Pythium root rot control and to evaluate their efficacy on poinsettia cultivars with varying levels of partial resistance. Greenhouse studies were conducted to assess efficacy of fungicide treatments in seven poinsettia cultivars inoculated with a mefenoxam-sensitive isolate of P. aphanidermatum. One study examined control with a single fungicide drench made at transplant and a second study examined repeat fungicide applications made throughout the experiment. Treatments containing etridiazole, mefenoxam, fenamidone, and cyazofamid provided control of Pythium root rot across all cultivars in both experiments whereas Fosetyl-al, potassium phosphite, and Trichoderma spp. failed to offer satisfactory control. Azoxystrobin, pyraclostrobin, and propamocarb reduced disease on some cultivars but failed to control Pythium root rot on highly susceptible cultivars. Four isolates of P. aphanidermatum cultured from plants growing in commercial greenhouses were evaluated for in vitro sensitivity to fungicides labeled for Pythium root rot control at four rates. Etridiazole, fosetyl-al, and potassium phosphite completely inhibited mycelial growth, whereas isolates varied in response to mefenoxam, cyazofamid, propamocarb, fenamidone, azoxystrobin, and pyraclostrobin in vitro. Twenty-one additional isolates then were evaluated at label rates of these fungicides. Seven isolates were insensitive to label rates of all three quinone outside inhibitors and one isolate was insensitive to the quinone outside inhibitors and mefenoxam. These results provide guidelines for selecting fungicides to maximize control of Pythium root rot on poinsettia cultivars.}, number={6}, journal={PLANT DISEASE}, author={Lookabaugh, Emma C. and Kerns, James P. and Shew, Barbara B.}, year={2021}, month={Jun}, pages={1640–1647} }
 @article{crouch_beirn_boehm_carbone_clarke_kerns_malapi-wight_mitchell_venu_tredway_2021, title={Genome Resources for Seven Fungal Isolates That Cause Dollar Spot Disease in Turfgrass, Including Clarireedia jacksonii and C. monteithiana}, volume={105}, ISSN={["1943-7692"]}, DOI={10.1094/PDIS-06-20-1296-A}, abstractNote={Fungi in the genus Clarireedia are widespread and destructive pathogens of grasses worldwide, and are best known as the causal agents of dollar spot disease in turfgrass. Here, we report genome assemblies of seven Clarireedia isolates, including ex-types of the two most widespread species, Clarireedia jacksonii and C. monteithiana. These datasets provide a valuable resource for ongoing studies of the dollar spot pathogens that include population diversity, host–pathogen interactions, marker development, and disease control.}, number={3}, journal={PLANT DISEASE}, author={Crouch, Jo Anne and Beirn, Lisa A. and Boehm, Michael J. and Carbone, Ignazio and Clarke, Bruce B. and Kerns, James P. and Malapi-Wight, Martha and Mitchell, Thomas K. and Venu, R. C. and Tredway, Lane P.}, year={2021}, month={Mar}, pages={691–694} }
 @article{rioux_stephens_koch_kabbage_kerns_2021, title={Identification of a tractable model system and oxalic acid-dependent symptom development of the dollar spot pathogen Clarireedia jacksonii}, volume={70}, ISSN={["1365-3059"]}, DOI={10.1111/ppa.13319}, abstractNote={Abstract Clarireedia jacksonii causes dollar spot disease of cool‐season turfgrasses in the United States and produces the phytotoxin oxalic acid. The role of oxalic acid in host–pathogen interactions of C . jacksonii is unknown and there are multiple challenges to studying these interactions in natural turfgrass hosts. Consequently, identification of model plants to study C . jacksonii– host interactions and the role of oxalic acid in pathogenesis is necessary. Controlled environment inoculation assays were used to evaluate pathogenesis of C . jacksonii in various model plants and investigate the role of oxalic acid in symptom development. Observations at microscopic and macroscopic levels demonstrated that infection progressed similarly in all monocots tested (creeping bentgrass, wheat, barley, rice, Brachypodium distachyon ) but not in the dicot Arabidopsis thaliana . Plant oxalic acid content increased from near zero to around 0.2–0.4 mM following inoculation with C . jacksonii in creeping bentgrass, barley, and wheat. Conversely, oxalic acid content remained near zero in A . thaliana and was not well correlated with inoculation in rice and B . distachyon , both of which had higher endogenous oxalic acid levels than other monocots. Time‐course oxalic acid quantification experiments with creeping bentgrass and B . distachyon further supported a link between symptom development and in planta oxalic acid content and identified 48 hr postinoculation as a critical time‐point for investigating the role of oxalic acid in C . jacksonii pathogenesis. These studies demonstrate that various monocots can serve as tractable model systems for studying C . jacksonii– host interactions and that increases in oxalic acid content are associated with C . jacksonii symptom development.}, number={3}, journal={PLANT PATHOLOGY}, author={Rioux, Renee A. and Stephens, Cameron M. and Koch, Paul L. and Kabbage, Mehdi and Kerns, James P.}, year={2021}, month={Apr}, pages={722–734} }
 @article{tredway_soika_butler_kerns_2021, title={Impact of nitrogen source, fall fertilizers, and preventive fungicides on spring dead spot caused by Ophiosphaerella korrae and O. herpotricha}, volume={61}, ISSN={["1435-0653"]}, DOI={10.1002/csc2.20306}, abstractNote={Abstract The effects of N source, fall fertilization, and preventive fungicides were evaluated in bermudagrass [ Cynodon dactylon (L.) Pers.] artificially inoculated with Ophiosphaerella korrae and O. herpotricha , the most common spring dead spot (SDS) pathogens in the United States. The source of N applied to bermudagrass from May to August 2006–2008 had a significant effect on SDS symptoms appearing in the spring of 2007–2009. Ammonium sulfate [(NH 4 ) 2 SO 4 ] provided excellent suppression of O. herpotricha but had no effect on O. korrae , which was suppressed instead by calcium nitrate (CaNO 3 ). More research is needed to determine the underlying mechanisms responsible for suppression of SDS with N sources and the potential role of Mn and Ca in development of the disease. Fall applications of K, S, gypsum, or dolomitic lime had no influence on SDS development. Preventive applications of propiconazole, propiconazole + azoxystrobin, tebuconazole, or fenarimol provided effective control of O. herpotricha but failed to provide significant suppression of O. korrae . The differential response of SDS pathogens to fertilization practices and preventive fungicide applications highlight the importance of pathogen identification in development of integrated management programs.}, number={5}, journal={CROP SCIENCE}, author={Tredway, L. P. and Soika, M. D. and Butler, E. L. and Kerns, J. P.}, year={2021}, month={Sep}, pages={3187–3196} }
 @article{stephens_kerns_ahmed_gannon_2021, title={Influence of post-application irrigation and mowing timing on fungicide fate on a United States Golf Association golf course putting green}, volume={6}, ISSN={["1537-2537"]}, DOI={10.1002/jeq2.20249}, abstractNote={Abstract Fungicides are routinely applied to golf course putting greens throughout the growing season. Gaining a better understanding of fungicide fate can improve fungicide use and stewardship. Therefore, optimizing fungicide applications with post‐application management practices may enhance fungicide movement and limit potential off‐target effects. Two field studies were initiated on a golf course putting green to evaluate the influence of post‐fungicide application irrigation and mowing timing on fungicide movement into the soil profile and removal in turfgrass clippings. Plots were treated with a single application of either pyraclostrobin, triadimefon, or penthiopyrad and received 0.64 cm post‐application irrigation immediately or 6 h after application or received no post‐application irrigation. Clippings were collected 0, 1, and 3 d after treatment (DAT). Cores were harvested 0, 1, 3, 5, 7, and 14 DAT and dissected into the remaining aboveground vegetation (RAV; verdure/thatch; 0‐to‐2.5‐, 2.5‐to‐5.1‐, and 5.1‐to‐7.6‐cm soil subsections). A small amount of fungicide (<3.6%) was removed with clippings regardless of mowing and irrigation treatment. Post‐application irrigation treatment influenced fungicide movement; however, >50% of fungicide remained restricted to the RAV for the first 3 DAT. Less fungicide remained restricted to the RAV, and more fungicide was detected in deeper soil depths when plots were irrigated immediately after application. Fungicide was only detected at the 5.1‐to‐7.6‐cm depth when plots were irrigated immediately. Applying post‐application irrigation immediately may result in more fungicide moving down to soilborne targets. Irrigating 6 h after application facilitated moderate fungicide movement compared with irrigating immediately but was better than no post‐application irrigation.}, journal={JOURNAL OF ENVIRONMENTAL QUALITY}, author={Stephens, Cameron M. and Kerns, James P. and Ahmed, Khalied A. and Gannon, Travis W.}, year={2021}, month={Jun} }
 @article{reeves_kerns_cowger_shew_2021, title={Pythium spp. Associated with Root Rot and Stunting of Winter Crops in North Carolina}, volume={105}, ISSN={["1943-7692"]}, DOI={10.1094/PDIS-11-20-2403-RE}, abstractNote={Annual double-crop rotation systems that incorporate winter wheat, clary sage, or a cover crop are common in eastern North Carolina. Stunting and root rot of clary sage (Salvia sclarea L.) reduce yields of this crop, especially in wet soils. Stunting and reduced stand establishment also afflict winter cover crops, including rye, rapeseed, and winter pea. Pythium spp. are causal agents of root rot of winter wheat in this region, but their role in root rot and stunting of other winter crops is not understood. During the growing seasons of 2018 to 2019 and 2019 to 2020, samples of clary sage, rye, rapeseed, and winter pea displaying symptoms of stunting were collected across eastern North Carolina, resulting in the recovery of 420 isolates of Pythium from the roots of all hosts. Pythium irregulare, Pythium spinosum, and the complex Pythium sp. cluster B2A were the species most frequently isolated from clary sage. P. irregulare and P. spinosum were aggressive pathogens of clary sage at 18°C and caused moderate root rot at 28°C. Koch's postulates confirmed that isolates belonging to Pythium sp. cluster B2A, Pythium sylvaticum, Pythium pachycaule, Pythium aphanidermatum, Pythium myriotylum, and Pythium oopapillum are pathogens of clary sage. P. irregulare (37% of all isolates) and members of the species complex Pythium sp. cluster B2A (28% of all isolates) constituted the majority of isolates collected from all hosts and were the species most frequently isolated from rye, rapeseed, and winter pea. In pathogenicity assays, isolates representing P. irregulare and P. spinosum caused slight to moderate root necrosis on rye, rapeseed, and winter pea. Isolates representing Pythium sp. cluster B2A caused slight to moderate root necrosis on rapeseed and clary sage, but no symptoms on rye or winter pea.}, number={11}, journal={PLANT DISEASE}, author={Reeves, Ella R. and Kerns, James P. and Cowger, Christina and Shew, Barbara B.}, year={2021}, month={Nov}, pages={3433–3442} }
 @article{reeves_kerns_cowger_shew_2021, title={Pythium spp. Associated with Root Rot and Stunting of Winter Wheat in North Carolina}, volume={105}, ISSN={["1943-7692"]}, url={https://doi.org/10.1094/PDIS-09-20-2022-RE}, DOI={10.1094/PDIS-09-20-2022-RE}, abstractNote={In eastern North Carolina, mild to severe stunting and root rot have reduced yields of winter wheat, especially during years with abundant rainfall. Causal agents of root rot of wheat in this region were previously identified as Pythium irregulare, P. vanterpoolii, and P. spinosum. To investigate species prevalence, 114 isolates of Pythium were obtained from symptomatic wheat plants collected in eight counties. Twelve species were recovered, with P. irregulare (32%), P. vanterpoolii (17%), and P. spinosum (16%) the most common. Pathogenicity screens were performed with selected isolates of each species, and slight to severe necrosis of young roots was observed. The aggressiveness of five isolates each of P. irregulare, P. vanterpoolii, and P. spinosum was compared on a single cultivar of wheat at 14°C, and very aggressive isolates were found within all species. In vitro growth of these isolates was measured at 14 and 20°C, and all isolates grew faster at the warmer temperature. The effects of varying temperatures and rates of nitrogen on root rot caused by Pythium spp. alone or in combination were investigated. All inoculation treatments caused severe root rot under all conditions tested, and disease was more severe at 12 and 14°C compared with 18 and 20°C; however, there was no effect of nitrogen application.}, number={4}, journal={PLANT DISEASE}, author={Reeves, Ella R. and Kerns, James P. and Cowger, Christina and Shew, Barbara B.}, year={2021}, month={Apr}, pages={986–996} }
 @article{townsend_rioux_kabbage_stephens_kerns_koch_2020, title={Oxalic Acid Production inClarireedia jacksoniiIs Dictated by pH, Host Tissue, and Xylan}, volume={11}, ISSN={["1664-302X"]}, DOI={10.3389/fmicb.2020.01732}, abstractNote={Dollar spot is caused by the fungus Clarireedia jacksonii and is the most common disease of golf course turfgrass in temperate climates. Oxalic acid (OA) is an important pathogenicity factor in other fungal plant pathogens, such as the dicot pathogen Sclerotinia sclerotiorum, but its role in C. jacksonii pathogenicity on monocot hosts remains unclear. Herein, we assess fungal growth, OA concentration, and pH change in potato dextrose broth (PDB) following incubation of C. jacksonii. In addition, OA production by C. jacksonii and S. sclerotiorum was compared in PDB amended with creeping bentgrass or common plant cell wall components (cellulose, lignin, pectin, or xylan). Our results show that OA production is highly dependent on the environmental pH, with twice as much OA produced at pH 7 than pH 4 and a corresponding decrease in PDB pH from 7 to 5 following 96 h of C. jacksonii incubation. In contrast, no OA was produced or changes in pH observed when C. jacksonii was incubated in PDB at a pH of 4. Interestingly, C. jacksonii increased OA production in response to PDB amended with creeping bentgrass tissue and the cell wall component xylan, a major component of all walls of grasses. S. sclerotiorum produced large amounts of OA relative to C. jacksonii regardless of treatment and no treatment increased OA production by this fungus, though pectin suppressed S. sclerotiorum OA production. These results suggest that OA production by C. jacksonii is reliant on host specific components within the infection court, as well as the ambient pH of the foliar environment during its pathogenic development.}, journal={FRONTIERS IN MICROBIOLOGY}, author={Townsend, Ronald V and Rioux, Renee A. and Kabbage, Mehdi and Stephens, Cameron and Kerns, James P. and Koch, Paul}, year={2020}, month={Aug} }
 @article{hutchens_gannon_shew_kerns_2019, title={Effect of post-application irrigation on fungicide movement and efficacy against Magnaporthiopsis poae}, volume={122}, ISSN={["1873-6904"]}, DOI={10.1016/j.cropro.2019.04.027}, abstractNote={Management of many crown and root diseases of turfgrasses includes the use of fungicides. The physicochemical properties of the fungicides used vary greatly, but most have low mobility and are not phloem mobile, which results in little active ingredient present in the basal and underground structures of turfgrass plants. Two studies were conducted in a laboratory setting to determine the effects of post-application irrigation amounts (0, 0.3, 0.6, 1.3, and 2.5 cm) on the distribution of 14C myclobutanil and 14C tebuconazole in a soil profile of 90% sand and 10% peat moss by volume. In addition, growth chamber experiments were conducted to examine the effect of post-application irrigation amount on azoxystrobin efficacy against summer patch (Magnaporthiopsis poae) in ‘Penn A-4’ creeping bentgrass (Agrostis stolonifera L.). The creeping bentgrass was treated with azoxystrobin and immediately irrigated with 0, 0.25, 0.3, or 0.6 cm of irrigation. Lastly, an in vitro fungicide sensitivity assay was conducted on three M. poae isolates to determine their sensitivities to two succinate dehydrogenase inhibitors (SDHIs), three demethylation inhibitors (DMIs), and four strobilurins (QoIs) to determine if fungicide concentrations in the soil profile reached levels high enough to suppress fungal growth. In both 14C experiments, more than 54% of the 14C was retained in the top 5 cm of soil for all irrigation treatments. For the 14C myclobutanil experiment, lysimeters treated with 2.5 cm of post-application irrigation resulted in 3.9% of 14C recovered in the 7.6–10.2 cm sampling depth, which was higher than all other irrigation treatments. Post-application irrigation at 2.5 cm in the 14C tebuconazole experiment yielded 6.3% of the 14C at the 7.6–10.2 cm sampling depth and 2.3% at the 10.2–12.7 cm sampling depth—recoveries at both depths were higher with 2.5 cm of irrigation than all other irrigation treatments. No 14C was detected below 12.7 cm for either experiment. Less disease was observed when azoxystrobin received post-application irrigation. Both 0.25 and 0.3 cm of post-application irrigation increased turf quality compared to no irrigation; moreover, 0.25 and 0.6 cm of post-application irrigation increased root length compared to no irrigation. In the in vitro fungicide sensitivity assay, isolates of M. poae were sensitive to all fungicides with only minor sensitivity to the SDHIs. In general, isolates were most sensitive to the QoIs with some variability in isolate sensitivities noted. Isolates of M. poae are sensitive to commonly used fungicides and efficacy is enhanced by post-application irrigation due to improved fungicide distribution into the soil profile.}, journal={CROP PROTECTION}, author={Hutchens, W. J. and Gannon, T. W. and Shew, H. D. and Kerns, J. P.}, year={2019}, month={Aug}, pages={106–111} }
 @article{butler_galle_kerns_2019, title={Influence of Nitrogen Rate and Timing, Fungicide Application Method, and Simulated Rainfall after Fungicide Application on Brown Patch Severity in Tall Fescue}, volume={5}, ISSN={["2374-3832"]}, DOI={10.2134/cftm2019.03.0018}, abstractNote={Core Ideas Tall fescue lawns can be fertilized during the summer months at modest N rates without affecting brown patch severity. When an appropriate fungicide such as Heritage was used for brown patch management, the method of fungicide delivery did not affect brown patch suppression. Simulated rainfall up to 0.5 inches within 15 min of fungicide application did not compromise fungicide efficacy. In North Carolina, tall fescue (Festuca arundinacea Schreb.) is widely grown throughout the Mountain and Piedmont regions. North Carolina is in the transition zone, which is subject to hot, humid summers that predispose tall fescue to brown patch (Rhizoctonia solani Kühn). Field trials were conducted over a 2-year period (2015–2016) to evaluate the effects of nitrogen rate and timing, application method of a fungicide, and rainfall following fungicide application on brown patch severity on lawn height tall fescue. Seven rates of urea providing 0 to 6 lb N 1000 ft-2 year-1 were initiated each year in March with repeat applications monthly at 1 lb N 1000 ft-2. In a separate study, various timings of urea were conducted throughout the year for a total of 3 lb N 1000 ft-2 yr-1. In 2015, no significant differences in disease severity or turfgrass quality were observed among the seven N rates. Only the application of 6 lb N 1000 ft-2 yr-1 resulted in significantly higher brown patch compared with the non-treated control in 2016. No significant differences in disease severity or turfgrass quality were observed in the timing study in both years. Azoxystrobin was applied with a ride-on spreader/sprayer (11 gal water-carrier acre-1), a commercial applicator gun (130 gal water-carrier acre-1), and a research spray boom (88 gal water-carrier acre-1). No differences were detected among application methods. A rainfall event of 0.5 inches was simulated with overhead irrigation 30 min after application of fungicides. No differences were detected among the fungicide treatments, and all provided excellent control of brown patch.}, number={1}, journal={CROP FORAGE & TURFGRASS MANAGEMENT}, author={Butler, E. Lee and Galle, Glenn H. and Kerns, James P.}, year={2019}, month={Sep} }
 @article{garcia_kerns_thiessen_2019, title={Ralstonia solanacearum Species Complex: A Quick Diagnostic Guide}, volume={20}, ISSN={["1535-1025"]}, DOI={10.1094/PHP-04-18-0015-DG}, abstractNote={Ralstonia solanacearum (Smith 1896) Yabuuchi et al. 1996 is ranked second among the top 10 most economically important plant pathogenic bacteria. The soil-borne bacterium affects over 200 plant species worldwide, including economically and nutritionally important crops, such as potato (Solanum tuberosum), tomato (Solanum lycopersicum), and bananas (Musa spp.). R. solanacearum is a species complex, meaning that the species is composed of strains with differential characteristics, including different metabolic requirements, centers of origin, host range, and ideal environmental conditions for infection. Its nature and the fact that it is a species complex can make R. solanacearum a difficult bacterium to work with, especially when lacking experience. Inappropriate isolation or storage of the pathogen can lead to inaccurate diagnostics or misleading conclusions. Thus, the objectives of this diagnostic guide are to provide adequate methods for isolation, storage, and identification and to discuss other relevant aspects related to this important plant pathogenic bacterium.}, number={1}, journal={PLANT HEALTH PROGRESS}, author={Garcia, Raymond O. and Kerns, Jim P. and Thiessen, Lindsey}, year={2019}, pages={7–13} }
 @article{smith_kerns_walker_payne_horvath_inguagiato_kaminski_tomaso-peterson_koch_2018, title={Development and validation of a weather-based warning system to advise fungicide applications to control dollar spot on turfgrass}, volume={13}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0194216}, abstractNote={Dollar spot is one of the most common diseases of golf course turfgrass and numerous fungicide applications are often required to provide adequate control. Weather-based disease warning systems have been developed to more accurately time fungicide applications; however, they tend to be ineffective and are not currently in widespread use. The primary objective of this research was to develop a new weather-based disease warning system to more accurately advise fungicide applications to control dollar spot activity across a broad geographic and climactic range. The new dollar spot warning system was developed from data collected at field sites in Madison, WI and Stillwater, OK in 2008 and warning system validation sites were established in Madison, WI, Stillwater, OK, Knoxville, TN, State College, PA, Starkville, MS, and Storrs, CT between 2011 and 2016. A meta-analysis of all site-years was conducted and the most effective warning system for dollar spot development consisted of a five-day moving average of relative humidity and average daily temperature. Using this model the highest effective probability that provided dollar spot control similar to that of a calendar-based program across the numerous sites and years was 20%. Additional analysis found that the 20% spray threshold provided comparable control to the calendar-based program while reducing fungicide usage by up to 30%, though further refinement may be needed as practitioners implement this warning system in a range of environments not tested here. The weather-based dollar spot warning system presented here will likely become an important tool for implementing precision disease management strategies for future turfgrass managers, especially as financial and regulatory pressures increase the need to reduce pesticide usage on golf course turfgrass.}, number={3}, journal={PLOS ONE}, author={Smith, D. L. and Kerns, J. P. and Walker, N. R. and Payne, A. F. and Horvath, B. and Inguagiato, J. C. and Kaminski, J. E. and Tomaso-Peterson, M. and Koch, P. L.}, year={2018}, month={Mar} }
 @article{lookabaugh_kerns_cubeta_shew_2018, title={Fitness Attributes of Pythium aphanidermatum with Dual Resistance to Mefenoxam and Fenamidone}, volume={102}, ISSN={0191-2917}, url={http://dx.doi.org/10.1094/PDIS-01-18-0043-RE}, DOI={10.1094/PDIS-01-18-0043-RE}, abstractNote={Pythium aphanidermatum is the predominant species causing Pythium root rot on commercially grown poinsettias in North Carolina. Resistance to mefenoxam is common in populations of P. aphanidermatum but resistance to fenamidone and other quinone outside inhibitor fungicides has only just been reported in greenhouse floriculture crops. The in vitro sensitivity to the label rate of mefenoxam (17.6 μl active ingredient [a.i.]/ml) and fenamidone (488 μl a.i./ml) was determined for 96 isolates of P. aphanidermatum. Isolates were assigned to four fungicide phenotypes: mefenoxam-sensitive/fenamidone-sensitive (MefS, FenS), mefenoxam-sensitive/fenamidone-insensitive (MefS, FenR), mefenoxam-insensitive/fenamidone-sensitive (MefR, FenS), and mefenoxam-insensitive/fenamidone-insensitive (MefR, FenR). In all, 58% of isolates were insensitive to one (MefR, FenS = 36% and MefS, FenR = 16%) or both fungicides (MefR, FenR = 6%). A single point mutation in the cytochrome b gene (G143A) was identified in fenamidone-insensitive isolates. Mycelial growth rate at three temperatures (20, 25, and 30°C), in vitro oospore production, and aggressiveness on poinsettia were evaluated to assess relative fitness of sensitive and insensitive isolates. Isolates with dual insensitivity to mefenoxam and fenamidone had reduced radial hyphal growth at 30°C and produced fewer oospores than isolates sensitive to one or both fungicides. Isolates sensitive to both fungicides produced greater numbers of oospores. Aggressiveness on poinsettia varied by isolate but fungicide phenotype was not a good predictor of aggressiveness. These results suggest that populations of P. aphanidermatum with dual resistance to mefenoxam and fenamidone may be less fit than sensitive populations under our imposed experimental conditions but populations of P. aphanidermatum should continue to be monitored in poinsettia production systems for mefenoxam and fenamidone insensitivity.}, number={10}, journal={Plant Disease}, publisher={Scientific Societies}, author={Lookabaugh, E. C. and Kerns, J. P. and Cubeta, M. A. and Shew, B. B.}, year={2018}, month={Oct}, pages={1938–1943} }
 @article{rioux_van ryzin_kerns_2017, title={Brachypodium: A Potential Model Host for Fungal Pathogens of Turfgrasses}, volume={107}, ISSN={["1943-7684"]}, DOI={10.1094/phyto-08-16-0318-r}, abstractNote={Brachypodium distachyon is a C3 grass that is an attractive model host system for studying pathogenicity of major turfgrass pathogens due to its genetic similarity to many cool-season turfgrasses. Infection assays with two or more isolates of the casual agents of dollar spot, brown patch, and Microdochium patch resulted in compatible interactions with B. distachyon inbred line Bd21-3. The symptoms produced by these pathogens on Bd21-3 closely resembled those observed on the natural turfgrass host (creeping bentgrass), demonstrating that B. distachyon is susceptible to the fungal pathogens that cause dollar spot, brown patch, and Microdochium patch on turfgrasses. The interaction between Sclerotinia homoeocarpa isolates and Brachypodium ecotypes was also investigated. Interestingly, differential responses of these ecotypes to S. homoeocarpa isolates was found, particularly when comparing B. distachyon to B. hybridum ecotypes. Taken together, these findings demonstrate that B. distachyon can be used as a model host system for these turfgrass diseases and leveraged for studies of molecular mechanisms contributing to host resistance.}, number={6}, journal={PHYTOPATHOLOGY}, author={Rioux, Renee A. and Van Ryzin, Benjamin J. and Kerns, James P.}, year={2017}, month={Jun}, pages={749–757} }
 @article{zeng_ye_zhang_sun_yong_huang_zhao_liang_kerns_2016, title={Morphological and molecular characterization of Xiphinema species from Shenzhen, China}, volume={53}, ISSN={["1336-9083"]}, DOI={10.1515/helmin-2015-0068}, abstractNote={Summary During a nematode biodiversity survey from 2012 to 2014 in Shenzhen, China, ten nematode populations (SZX1301–SZX1310) of Xiphinema were recovered from rhizosphere of different plants, namely Acacia mangium (SZX1306), A. confuse (SZX1309), Blechnum orientale (SZX1301, SZX1302, SZX1307, SZX1308), Litchi chinensis (SZX1304, SZX1310) in Tianxinshan and Gleichenia linearis (SZX1303, SZX1305) in Yangmeikeng environmental monitoring sites. Morphological and molecular profiles of these populations were determined. Three species of Xiphinema , i.e., X. hunaniense Wang & Wu, 1992, X. brasiliense Lordello, 1951 and X. americanum Cobb, 1913 sensu lato were identified using morphological characters and molecular data of partial 18S and 28S D2–D3 rDNA expansion segments. Four populations (SZX1301–SZX1304) were X. hunaniense , one population (SZX1305) X. brasiliense , and five populations (SZX1306–SZX1310) X. americanum s.l .. Phylogenetic analysis based on sequences of the 28S rDNA D2–D3 expansion segment revealed these three species are all distinct species and supported a close relationship with their corresponding species. This is the first report of X. hunaniense, X. brasiliense and X. americanum s.l . in their hosts except for L. chinensis .}, number={1}, journal={HELMINTHOLOGIA}, author={Zeng, Y. and Ye, W. and Zhang, Z. and Sun, H. and Yong, L. and Huang, Y. and Zhao, K. and Liang, H. and Kerns, J.}, year={2016}, month={Mar}, pages={62–75} }
 @article{roberts_ritchie_kerns_2016, title={Plant Growth Regulator Effects on Bacterial Etiolation of Creeping Bentgrass Putting Green Turf Caused by Acidovorax avenae}, volume={100}, ISSN={["1943-7692"]}, DOI={10.1094/pdis-04-15-0419-re}, abstractNote={Bacterial etiolation, caused by Acidovorax avenae, is a widespread problem in creeping bentgrass putting green turf. The symptoms normally appear as abnormally elongated turfgrass stems and leaves. Observations at multiple field sites suggest the involvement of plant growth regulators (i.e., GA-biosynthesis inhibitors) commonly applied to turf, alluding to a phytohormone imbalance caused by the bacterium. A 2-year field study examined the effects of trinexapac-ethyl, flurprimidol, and paclobutrazol on bacterial etiolation severity caused by A. avenae. Trinexapac-ethyl applied at 0.05 kg a.i. ha −1 every 7 days and 0.10 kg ha −1 every 14 days increased etiolation compared with all other treatments in both years. Flurprimidol and paclobutrazol were not different from the control but high-rate applications caused phytotoxicity that lowered turf quality early in 2014. When the etiolated turfgrass was removed with mowing, turfgrass treated with trinexapac-ethyl exhibited the highest turfgrass quality on most rating dates. Results from this work illustrate that using plant growth regulator materials with different modes of action is a solution to managing creeping bentgrass growth while limiting the potential for bacterial etiolation outbreaks.}, number={3}, journal={PLANT DISEASE}, author={Roberts, Joseph A. and Ritchie, David F. and Kerns, James P.}, year={2016}, month={Mar}, pages={577–582} }
 @article{galle_opperman_kerns_2016, title={Population dynamics of Belonolaimus longicaudatus in Central North Carolina}, volume={48}, number={4}, journal={Journal of Nematology}, author={Galle, G. and Opperman, C. H. and Kerns, J. P.}, year={2016}, pages={322–323} }
 @article{roberts_kerns_ritchie_2015, title={Bacterial etiolation of creeping bentgrass as influenced by biostimulants and trinexapac-ethyl}, volume={72}, ISSN={["1873-6904"]}, DOI={10.1016/j.cropro.2015.03.009}, abstractNote={Abstract Bacterial etiolation, caused by Acidovorax avenae and Xanthomonas translucens , has become a widespread problem in turfgrass throughout the U.S. Various management tactics are used in managing this disease and differ among turfgrass managers. The use of biostimulants and trinexapac-ethyl (TE) has become a staple in putting green management and many products have been associated with etiolation outbreaks. Experiments performed in field and controlled environments evaluated the impact of commercial biostimulants and TE on etiolation of creeping bentgrass ( Agrostis stolonifera L. c.v. ‘Penn A-1’) caused by both A. avenae and X. translucens. In the field, a factorial study was arranged as a split-plot randomized complete block design with 4 replications. The main plot consisted of biostimulants (Knife Plus, CytoGro, Astron, Nitrozyme, PerkUp, BioMax, and none) applied at label rates while the subplot treatments consisted of TE application frequency (0.049 kg ha −1 applied at 7 d, 14 d, and none). For controlled environment experiments, biostimulant and TE treatments were arranged in a randomized complete block design with 4 replications. Bacterial etiolation was measured regularly when present using a grid count to determine the percent area exhibiting etiolation in the field while etiolated turfgrass plants were counted individually in controlled environments. Turf quality was also rated using a scale of 1–9 with 1 = completely dead, 9 = best, and 5 = minimum acceptable turf quality for all experiments. Biostimulant treatments did not have a significant effect on etiolation caused by either bacterium. Trinexapac-ethyl decreased etiolation caused by X. translucens and increased etiolation caused by A. avenae. These results support the necessity of identifying bacteria associated with etiolation as variable effects were observed with TE treatments. These factors should be considered when developing plant growth regulator programs if etiolation is problematic. Future research to evaluate phytohormone production in these bacteria may improve our understanding of etiolation development while improving methods for control.}, journal={CROP PROTECTION}, author={Roberts, Joseph A. and Kerns, James P. and Ritchie, David F.}, year={2015}, month={Jun}, pages={119–126} }
 @article{ye_zeng_kerns_2015, title={First Report of Trichodorus obtusus on Turfgrass in North Carolina, USA}, volume={99}, ISSN={["1943-7692"]}, DOI={10.1094/pdis-08-14-0830-pdn}, abstractNote={In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm 3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina. References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013.}, number={2}, journal={PLANT DISEASE}, author={Ye, W. and Zeng, Y. and Kerns, J.}, year={2015}, month={Feb}, pages={291–291} }
 @article{ye_zeng_kerns_2015, title={Molecular Characterisation and Diagnosis of Root-Knot Nematodes (Meloidogyne spp.) from Turfgrasses in North Carolina, USA}, volume={10}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0143556}, abstractNote={Root-knot nematodes (Meloidogyne spp.) are the most common and destructive plant-parasitic nematode group worldwide and adversely influence both crop quality and yield. In this study, a total of 51 root-knot nematode populations from turfgrasses were tested, of which 44 were from North Carolina, 6 from South Carolina and 1 from Virginia. Molecular characterisation was performed on these samples by DNA sequencing on the ribosomal DNA 18S, ITS and 28S D2/D3. Species-specific primers were developed to identify turfgrass root-knot nematode through simplex or duplex PCR. Four species were identified, including M. marylandi Jepson & Golden in Jepson, 1987, M. graminis (Sledge & Golden, 1964) Whitehead, 1968, M. incognita (Kofoid & White, 1919) Chitwood, 1949 and M. naasi Franklin, 1965 through a combined analysis of DNA sequencing and PCR by species-specific primers. M. marylandi has been reported from North Carolina and South Carolina for the first time. Molecular diagnosis using PCR by species-specific primers provides a rapid and cheap species identification approach for turfgrass root-knot nematodes.}, number={11}, journal={PLOS ONE}, author={Ye, Weimin and Zeng, Yongsan and Kerns, James}, year={2015}, month={Nov} }
 @article{zeng_ye_kerns_tredway_martin_martin_2015, title={Molecular Characterization and Phylogenetic Relationships of Plant-Parasitic Nematodes Associated with Turfgrasses in North Carolina and South Carolina, United States}, volume={99}, ISSN={["1943-7692"]}, DOI={10.1094/pdis-10-14-1060-re}, abstractNote={The near-full-length 18S ribosomal DNA (rDNA) gene and internal transcribed spacer 1 region were amplified and sequenced from 52 nematode populations belonging to 28 representative species in 13 families recovered from turfgrasses in North Carolina (38 populations) and South Carolina (14 populations). This study also included 13 nematode populations from eight other plant hosts from North Carolina for comparison. Nematodes were molecularly characterized and the phylogenetic relationships were explored based on 18S rDNA sequences. Phylogenetic analysis using Bayesian inference was performed using five groups of the plant-parasitic nematode populations Tylenchids, Criconematids, Longidorids, Xiphinematids, and Trichodorids. The 65 nematode populations were clustered correspondingly within appropriate positions of 13 families, including Belonolaimidae, Caloosiidae, Criconematidae, Dolichodoridae, Hemicycliophoridae, Hoplolaimidae, Heteroderidae, Longidoridae, Meloidogynidae, Paratylenchidae, Pratylenchidae, Telotylenchidae, and Trichodoridae. This study confirms previous morphological-based identification of the plant-parasitic nematode species found in turfgrasses and provides a framework for future studies of plant-parasitic nematodes associated with turfgrasses based upon DNA sequences and phylogenetic relationships.}, number={7}, journal={PLANT DISEASE}, author={Zeng, Yongsan and Ye, Weimin and Kerns, James and Tredway, Lane and Martin, Samuel and Martin, Matt}, year={2015}, month={Jul}, pages={982–993} }
 @article{koch_stier_kerns_2015, title={Snow cover has variable effects on persistence of fungicides and their suppression of microdochium patch on amenity turfgrass}, volume={64}, ISSN={["1365-3059"]}, DOI={10.1111/ppa.12379}, abstractNote={Fungicides applied to turfgrass in temperate climates prior to snowfall are expected to suppress fungal diseases such as microdochium patch (Microdochium nivale) until infection conditions become unfavourable the following spring. However, mild winters with inconsistent snow cover may alter fungicide persistence and render the turf more susceptible to fungal infection. This study was conducted to determine the effect of snow cover on the persistence of the fungicides chlorothalonil and iprodione applied to creeping bentgrass (Agrostis stolonifera), maintained as a golf course fairway. The fungicides were applied 1 day prior to the first accumulating snowfall in Madison, Wisconsin, for four consecutive winters, beginning in 2009/10. Fungicide treatments were kept under continuous snow cover or maintained free of snow cover the entire winter to determine the effect of snow cover on fungicide persistence (2010/11 to 2012/13) and microdochium patch development in a controlled environment chamber (2009/10 to 2012/13). Iprodione concentration was not impacted by snow cover in 2010/11 but was reduced under snow cover relative to bare turf in 2011/12 and 2012/13. Chlorothalonil concentration was not impacted by snow cover in 2011/12 but was greater under snow cover in 2012/13. Microdochium patch severity in the controlled environment chamber was not impacted by snow cover with either fungicide in 2009/10 or 2011/12 but was slightly reduced under snow cover with both fungicides during 2010/11 and 2012/13. The majority of fungicide depletion occurred shortly after rainfall or snowmelt events, except in 2010/11 when both fungicides rapidly depleted during a warming trend without rainfall.}, number={6}, journal={PLANT PATHOLOGY}, author={Koch, P. L. and Stier, J. C. and Kerns, J. P.}, year={2015}, month={Dec}, pages={1417–1428} }
 @article{rioux_van ryzin_kerns_2014, title={Development of a semi-selective medium for improved isolation of the turfgrass dollar spot pathogen Sclerotinia homoeocarpa from host tissues}, volume={36}, ISSN={["1715-2992"]}, DOI={10.1080/07060661.2014.906505}, abstractNote={Dollar spot, caused by Sclerotinia homoeocarpa, is one of the most economically devastating diseases of amenity turfgrasses worldwide. The pathogen is readily isolated from active lesions, but detection from seed, dormant host tissue and other plant debris that may serve as a source of primary inoculum is difficult. A semi-selective medium was developed to enhance isolation of S. homoeocarpa. Various fungicides used on turfgrass, the pH indicator dye bromophenol blue, and two pH levels, were assessed for their effects on, and in the case of bromophenol blue, response to growth of S. homoeocarpa and contaminant fungi frequently isolated from field and seed samples. Amendment of the medium to pH 4 promoted growth of S. homoeocarpa in the absence of fungicides and enhanced pathogen growth relative to contaminant isolates on medium amended with 0.1 μg mL−1 triticonazole or 5 μg mL−1 azoxystrobin. The growth rate of S. homoeocarpa on these three media, as determined by in vitro radial growth assays, was consistent for many isolates representing the majority of S. homoeocarpa vegetative compatibility groups. Isolation efficiency on the pH-amended media was tested against antibiotic-amended potato dextrose agar from field samples and artificially inoculated turfgrass seed. In both cases, the medium amended to pH 4 and containing 5 μg mL−1 azoxystrobin significantly decreased contaminant growth with no adverse effects on recovery of S. homoeocarpa in comparison with antibiotic-amended PDA. The enhanced specificity of this medium will be a useful tool for selective detection of S. homoeocarpa and identification of sources of initial inoculum for dollar spot development.}, number={2}, journal={CANADIAN JOURNAL OF PLANT PATHOLOGY}, author={Rioux, Renee A. and Van Ryzin, Benjamin J. and Kerns, James P.}, year={2014}, pages={235–245} }
 @article{zeng_ye_kerns_2014, title={First report and morphological and molecular characterization of Meloidogyne incognita from Radermachera sinica in China}, volume={44}, number={2}, journal={Nematropica}, author={Zeng, Y. S. and Ye, W. M. and Kerns, J.}, year={2014}, pages={118–129} }
 @article{zeng_ye_yang_huang_zhao_zhang_liang_kerns_2014, title={Morphological and molecular characterization of two isolates of Paratrichodorus porosus from Shenzhen, China}, volume={51}, ISSN={["1336-9083"]}, DOI={10.2478/s11687-014-0248-1}, abstractNote={Abstract Studies were conducted to characterize morphological and molecular profiles of two isolates of Paratrichodorus porosus (SZ1 and SZ2) which were recovered from Acacia mangium in Tianxinshan and Gleichenia linearis in Yangmeikeng environmental monitoring sites in Shenzhen, China, respectively. Analysis of morphometric, morphological and molecular characters revealed these two Shenzhen isolates are identical to P. porosus. Measurements of both study isolates lie within the ranges for P. porosus. It is typologically characterized by possessing a clearly swollen body cuticle after fixation, an onchiostyle ventrally curved, 46–58 μm long, a pharyngeal bulb usually with a well developed anterior-dorsal intestinal overlap, a secretoryexcretory pore opening between the nerve ring and anterior end of pharyngeal bulb, 90–110 μm from the anterior end, a reproductive system with didelphic, amphidelphic, without spermathecae, a pore-like vulva in ventral view and occupying 52.0 %–59.5 % of total body length from anterior end, a short and barrel-shaped vagina with small sclerotizations, a pair of ventromedian advulvar body pores located prevulvar and postvulvar, a rounded tail and a subterminal anus in females. The sequence analysis based on partial rDNA 18S gene and 28S D2/D3 expansion segment confirm its identity as P. porosus. This is the first report of P. porosus associated with A. mangium and G. linearis.}, number={4}, journal={HELMINTHOLOGIA}, author={Zeng, Y. and Ye, W. and Yang, L. and Huang, Y. and Zhao, K. and Zhang, Z. and Liang, H. and Kerns, J.}, year={2014}, month={Dec}, pages={323–330} }
 @article{rioux_shultz_garcia_willis_casler_bonos_smith_kerns_2014, title={Sclerotinia homoeocarpa Overwinters in Turfgrass and Is Present in Commercial Seed}, volume={9}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0110897}, abstractNote={Dollar spot is the most economically important disease of amenity turfgrasses in the United States, yet little is known about the source of primary inoculum for this disease. With the exception of a few isolates from the United Kingdom, Sclerotinia homoeocarpa, the causal agent of dollar spot, does not produce spores. Consequently, it was assumed that overwintering of this organism in soil, thatch, and plant debris provides primary inoculum for dollar spot epidemics. Overwintering of S. homoeocarpa in roots and shoots of symptomatic and asymptomatic creeping bentgrass turfgrass was quantified over the course of a three-year field experiment. Roots did not consistently harbor S. homoeocarpa, whereas S. homoeocarpa was isolated from 30% of symptomatic shoots and 10% of asymptomatic shoots in the spring of two out of three years. The presence of stroma-like pathogen material on leaf blades was associated with an increase in S. homoeocarpa isolation and colony diameter at 48 hpi. Commercial seed has also been hypothesized to be a potential source of initial inoculum for S. homoeocarpa. Two or more commercial seed lots of six creeping bentgrass cultivars were tested for contamination with S. homoeocarpa using culture-based and molecular detection methods. A viable, pathogenic isolate of S. homoeocarpa was isolated from one commercial seed lot and contamination of this lot was confirmed with nested PCR using S. homoeocarpa specific primers. A sensitive nested PCR assay detected S. homoeocarpa contamination in eight of twelve (75%) commercial seed lots. Seed source, but not cultivar or resistance to dollar spot, influenced contamination by S. homoeocarpa. Overall, this research suggests that seeds are a potential source of initial inoculum for dollar spot epidemics and presents the need for further research in this area.}, number={10}, journal={PLOS ONE}, author={Rioux, Renee A. and Shultz, Jeanette and Garcia, Michelle and Willis, David Kyle and Casler, Michael and Bonos, Stacy and Smith, Damon and Kerns, James}, year={2014}, month={Oct} }
 @article{koch_stier_senseman_sobek_kerns_2013, title={Modification of a commercially-available ELISA kit to determine chlorothalonil and iprodione concentration on golf course turfgrass}, volume={54}, ISSN={["1873-6904"]}, DOI={10.1016/j.cropro.2013.07.017}, abstractNote={Abstract Repeated fungicide applications are often required for successful management of diseases on golf course turfgrass. Modification of existing commercially-available enzyme-linked immunosorbent assays (ELISA) for analyzing fungicide concentration on turfgrass would allow for more direct research of fungicide fate under varying environmental conditions. Our objective was to modify Horiba SmartAssay ® ELISA kit procedures to increase their efficiency and practicality for analyzing iprodione and chlorothalonil from large numbers of turfgrass samples. Both fungicides were applied to creeping bentgrass ( Agrostis stolonifera L.) turfgrass maintained under fairway conditions. The ELISA results were compared to fungicide concentrations obtained using gas chromatography/electron capture detection (GC/ECD). Iprodione concentrations from turfgrass 1 h following application using ELISA averaged 371.3 μg g −1 turfgrass, whereas GC/ECD averaged 151.2 μg g −1 . Chlorothalonil concentrations from turfgrass 1 h following application using ELISA averaged 1883.7 μg g −1 , compared to average concentrations of 553.1 μg g −1 using GC/ECD. Despite the higher fungicide concentrations observed using the ELISA method, the modified Horiba SmartAssay ® kits yielded consistent results at a fraction of the cost, time, and skill set of using gas chromatographic methods. The modified ELISA protocol could be used to gain a further understanding of fungicide fate in turfgrass systems under varying environmental conditions, potentially improving the efficiency of future fungicide applications.}, journal={CROP PROTECTION}, author={Koch, P. L. and Stier, J. C. and Senseman, S. A. and Sobek, S. and Kerns, J. P.}, year={2013}, month={Dec}, pages={35–42} }
 @article{kerns_soika_tredway_2009, title={Preventive Control of Pythium Root Dysfunction in Creeping Bentgrass Putting Greens and Sensitivity of Pythium volutum to Fungicides}, volume={93}, ISSN={["1943-7692"]}, DOI={10.1094/PDIS-93-12-1275}, abstractNote={Pythium root dysfunction (PRD), caused by Pythium volutum, has been observed on golf course putting greens established with creeping bentgrass in the southeastern United States since 2002. To evaluate preventative strategies for management of this disease, a 3-year field experiment was conducted in Pinehurst, NC on a ‘G-2’ creeping bentgrass putting green. Fungicide treatments were applied twice in the fall (September and October) and three times in the spring (March, April, and May) in each of the 3 years. Applications of pyraclostrobin provided superior preventative control compared with the other fungicides tested. Azoxystrobin and cyazofamid provided moderate control of PRD in two of three seasons. Experiments were conducted to determine whether the disease suppression provided by pyraclostrobin was due to fungicidal activity or physiological effects on the host. In vitro sensitivity to pyraclostrobin, azoxystrobin, fluoxastrobin, cyazofamid, mefenoxam, propamocarb, and fluopicolide was determined for 11 P. volutum isolates and 1 P. aphanidermatum isolate. Isolates of P. volutum were most sensitive to pyraclostrobin (50% effective concentration [EC 50 ] value = 0.005), cyazofamid (EC 50 = 0.004), and fluoxastrobin (EC 50 = 0.010), followed by azoxystrobin (EC 50 = 0.052), and mefenoxam (EC 50 = 0.139). P. volutum isolates were not sensitive to fluopicolide or propamocarb. Applications of pyraclostrobin did not increase the foliar growth rate or visual quality of creeping bentgrass in growth-chamber experiments. This work demonstrates that fall and spring applications of pyraclostrobin, azoxystrobin, and cyazofamid suppress the expression of PRD symptoms during summer and that field efficacy is related to the sensitivity of P. volutum to these fungicides.}, number={12}, journal={PLANT DISEASE}, author={Kerns, J. P. and Soika, M. D. and Tredway, L. P.}, year={2009}, month={Dec}, pages={1275–1280} }
 @article{kerns_tredway_2008, title={Influence of Temperature on Pathogenicity of Pythium volutum Toward Creeping Bentgrass}, volume={92}, ISSN={["1943-7692"]}, DOI={10.1094/PDIS-92-12-1669}, abstractNote={Symptoms of Pythium root dysfunction (PRD) in creeping bentgrass (Agrostis stolonifera) are most common in the summer during periods of heat and drought stress. However, recent observations in North Carolina indicate that Pythium volutum, a causal agent of PRD, is most active during the fall and spring. Soil temperature thresholds for this pathogen are needed so that preventive fungicide applications can be timed accurately. A mycelial growth assay was performed by incubating 11 P. volutum isolates at 10 temperatures ranging from 10 to 31°C. To determine the optimal temperature range for infection by P. volutum, five isolates of P. volutum were used to inoculate 5-week-old ‘Penn A-1’ creeping bentgrass plants. Inoculated plants were transferred to growth chambers at constant 12, 16, 20, 24, 28, or 32°C (12-h day/night cycles) for 4 weeks to permit root infection, then the temperature in all chambers was increased to 32/26°C day/night to induce foliar symptoms. P. volutum grew most rapidly in vitro when temperatures were between 18 and 26°C. Typical PRD foliar symptoms developed in the 12, 16, 20, and 24°C treatments 2 weeks after the temperature was elevated to 32/26°C day/night. Disease severity was greatest when plants were incubated at 16°C after inoculation. Reductions in root depth and/or root mass were observed prior to raising the temperature to 32/26°C in the 12, 16, and 20°C temperature treatments. Once exposed to 4 weeks of heat treatment, extensive root dieback occurred in the 12, 16, 20, and 24°C treatments. These results demonstrate that P. volutum is most active at temperatures prevalent during the fall and spring in North Carolina, supporting the hypothesis that the majority of root infection occurs during this time and that fungicides should be applied when soil temperatures are between 12 and 24°C to achieve preventative control of PRD symptoms in the summer.}, number={12}, journal={PLANT DISEASE}, author={Kerns, J. P. and Tredway, L. P.}, year={2008}, month={Dec}, pages={1669–1673} }
 @article{kerns_tredway_2008, title={Pathogenicity of Pythium species associated with Pythium root dysfunction of creeping bentgrass and their impact on root growth and survival}, volume={92}, ISSN={["1943-7692"]}, DOI={10.1094/PDIS-92-6-0862}, abstractNote={Symptoms resembling Pythium root dysfunction have been observed on golf course putting greens established with creeping bentgrass across the southeastern United States since 2002. Root isolations from 14 golf courses yielded 59 isolates of Pythium volutum and 16 isolates of Pythium torulosum. Pathogenicity of five isolates of P. volutum, two isolates of P. torulosum, and a combination of the two species was determined by inoculating mature ‘A-1’ creeping bentgrass plants. Inoculated plants were incubated for 4 weeks at 24/16°C (day/night) to permit root infection, then temperatures were increased to 32/26°C to induce foliar symptoms. No isolates impacted root depth, root mass, or foliar disease severity after 4 weeks at 24/16°C. After increasing the temperature to 32/26°C, isolates of P. volutum induced foliar disease severity ranging from 60 to 84%, whereas isolates of P. torulosum induced only 14 to 35% disease. Isolates of P. volutum consistently reduced root mass and root depth after 4 weeks at 32/26°C, but P. torulosum exhibited no effect. These results demonstrate that P. volutum is a pathogen of mature creeping bentgrass plants. Infections that occur during cool weather reduce the growth and survival of creeping bentgrass roots during hot weather and give rise to foliar symptoms.}, number={6}, journal={PLANT DISEASE}, author={Kerns, J. P. and Tredway, L. P.}, year={2008}, month={Jun}, pages={862–869} }
 @article{kerns_tredway_2007, title={First report of pythimn root dysfunction of creeping bentgrass caused by Pythium volutum in North Carolina}, volume={91}, ISSN={["1943-7692"]}, DOI={10.1094/PDIS-91-5-0632C}, abstractNote={In July and August of 2002 and 2003, a disease of unknown etiology was observed in Charlotte, NC on ‘A-1’ creeping bentgrass (CRB; Agrostis stolonifera L.) putting greens that were constructed in 2000. Symptoms appeared in irregular patches ranging from 15 to 30 cm in diameter. Grass in the affected areas was initially wilted and chlorotic, but later exhibited a yellow-to-orange foliar decline. Similar symptoms were observed in Durham, NC in July and August of 2003 on CRB greens established in 2001 with a 1:1 blend of ‘A-1’ and ‘A-4’. The disease was initially diagnosed as take-all patch, but attempts to isolate Gaeumannomyces graminis var. avenae and other ectotrophic root pathogens were unsuccessful. Symptoms of the disease reappeared during periods of warm, dry weather in the fall of 2003 and spring of 2004. At that time, examination of affected root tissue revealed bulbous root tips, loose cortical structure, absence of root hairs, and abundant Pythium oospores and hyphae. These signs and symptoms are typical of Pythium root dysfunction (PRD) as described by Hodges and Coleman (2) in 1985 and Feng and Dernoeden (3) in 1999. Isolation of Pythium spp. was performed by plating directly on V8 agar (4) or baiting with ‘A-4’ CRB seedlings. Eleven Pythium isolates were obtained from Charlotte (seven via baiting) and 10 were obtained from Durham (all via baiting). All isolates were transferred to grass leaf-blade cultures (4) to induce development of sporangia, oospores, and antheridia for identification using the keys and descriptions of Dick (1). All isolates produced lobate sporangia, large oospores (27 to 33 ± 2.8 μm), and three to nine diclinous antheridia typical of Pythium volutum. Cone-Tainers (3.8 × 20 cm) containing sand meeting USGA specifications were seeded with ‘A-1’ CRB and grown for 6 weeks in the greenhouse. Each Cone-Tainer was inoculated by cutting the root system at a 5 cm depth, placing five to seven infested grass blades onto the surface of fresh sand, and then replacing the turf. Cone-Tainers inoculated with one of three P. volutum isolates and an uninoculated control (six reps each) were placed in a growth chamber with 12 h of light/dark periods at 24/16°C for 4 weeks to allow pathogen infection and disease development. After 4 weeks, the chamber temperature was raised to 32/26°C to induce symptom development. Two weeks after raising the temperature, all P. volutum isolates caused significant (P = <0.0001) foliar chlorosis and dieback (70 to 100% disease) and reduced root depth and mass by 25 to 65% compared with the uninoculated control. Roots of inoculated plants were colonized with Pythium hyphae, contained numerous oospores, and consistently yielded P. volutum in isolations. To our knowledge, this is the first reported occurrence of PRD in North Carolina and provides further support for the importance of P. volutum as a pathogen of creeping bentgrass. On the basis of our observations, the majority of pathogen activity and disease development occurs in the fall and spring, with foliar symptoms being induced by heat or other stresses. References: (1) M. W. Dick. Keys to Pythium. University of Reading Press, Reading, UK, 1990. (2) C. F. Hodges and L. W. Coleman. Plant Dis. 69:336, 1985. (3) Y. Feng and P. H. Dernoeden. Plant Dis. 83:516, 1999. (4) F. N. Martin. Pythium. Pages 39–49 in: Methods for Research on Soilborne Phytopathogenic Fungi. L. L. Singleton et al., eds. The American Phytopathological Society, St. Paul, MN, 1992.}, number={5}, journal={PLANT DISEASE}, author={Kerns, J. P. and Tredway, L. P.}, year={2007}, month={May}, pages={632–632} }