@article{lopez-perez_sai_sakamachi_parsons_kathariou_ninomiya-tsuji_2021, title={TAK1 inhibition elicits mitochondrial ROS to block intracellular bacterial colonization}, volume={118}, ISSN={["0027-8424"]}, DOI={10.1073/pnas.2023647118}, abstractNote={Significance We have found that bacterial inhibition of host TAK1 inflammatory signaling elicits an alternative host defense mechanism involving production of mitochondrial reactive oxygen species through caspase 8 and RIPK3. This finding allows a reinterpretation of mouse phenotypes harboring tissue-specific gene deletion of Tak1 , many of which die from tissue damage previously ascribed to impaired TAK1-dependent tissue homeostasis. We suggest that these phenotypes arise from misrecognition of compromised TAK1 as pathogen invasion.}, number={25}, journal={PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA}, author={Lopez-Perez, Wilfred and Sai, Kazuhito and Sakamachi, Yosuke and Parsons, Cameron and Kathariou, Sophia and Ninomiya-Tsuji, Jun}, year={2021}, month={Jun} }
 @article{hsieh_agarwal_cholok_loder_kaneko_huber_chung_ranganathan_habbouche_li_et al._2019, title={Coordinating Tissue Regeneration Through Transforming Growth Factor-beta Activated Kinase 1 Inactivation and Reactivation}, volume={37}, ISSN={["1549-4918"]}, DOI={10.1002/stem.2991}, abstractNote={Abstract Aberrant wound healing presents as inappropriate or insufficient tissue formation. Using a model of musculoskeletal injury, we demonstrate that loss of transforming growth factor-β activated kinase 1 (TAK1) signaling reduces inappropriate tissue formation (heterotopic ossification) through reduced cellular differentiation. Upon identifying increased proliferation with loss of TAK1 signaling, we considered a regenerative approach to address insufficient tissue production through coordinated inactivation of TAK1 to promote cellular proliferation, followed by reactivation to elicit differentiation and extracellular matrix production. Although the current regenerative medicine paradigm is centered on the effects of drug treatment (“drug on”), the impact of drug withdrawal (“drug off”) implicit in these regimens is unknown. Because current TAK1 inhibitors are unable to phenocopy genetic Tak1 loss, we introduce the dual-inducible COmbinational Sequential Inversion ENgineering (COSIEN) mouse model. The COSIEN mouse model, which allows us to study the response to targeted drug treatment (“drug on”) and subsequent withdrawal (“drug off”) through genetic modification, was used here to inactivate and reactivate Tak1 with the purpose of augmenting tissue regeneration in a calvarial defect model. Our study reveals the importance of both the “drug on” (Cre-mediated inactivation) and “drug off” (Flp-mediated reactivation) states during regenerative therapy using a mouse model with broad utility to study targeted therapies for disease. Stem Cells 2019;37:766–778}, number={6}, journal={STEM CELLS}, author={Hsieh, Hsiao Hsin Sung and Agarwal, Shailesh and Cholok, David J. and Loder, Shawn J. and Kaneko, Kieko and Huber, Amanda and Chung, Michael T. and Ranganathan, Kavitha and Habbouche, Joe and Li, John and et al.}, year={2019}, month={Jun}, pages={766–778} }
 @article{sai_parsons_house_kathariou_ninomiya-tsuji_2019, title={Necroptosis mediators RIPK3 and MLKL suppress intracellular Listeria replication independently of host cell killing}, volume={218}, ISSN={["1540-8140"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85067213651&partnerID=MN8TOARS}, DOI={10.1083/jcb.201810014}, abstractNote={RIPK3, a key mediator of necroptosis, has been implicated in the host defense against viral infection primary in immune cells. However, gene expression analysis revealed that RIPK3 is abundantly expressed not only in immune organs but also in the gastrointestinal tract, particularly in the small intestine. We found that orally inoculated Listeria monocytogenes, a bacterial foodborne pathogen, efficiently spread and caused systemic infection in Ripk3-deficient mice while almost no dissemination was observed in wild-type mice. Listeria infection activated the RIPK3-MLKL pathway in cultured cells, which resulted in suppression of intracellular replication of Listeria. Surprisingly, Listeria infection–induced phosphorylation of MLKL did not result in host cell killing. We found that MLKL directly binds to Listeria and inhibits their replication in the cytosol. Our findings have revealed a novel functional role of the RIPK3-MLKL pathway in nonimmune cell-derived host defense against Listeria invasion, which is mediated through cell death–independent mechanisms.}, number={6}, journal={JOURNAL OF CELL BIOLOGY}, publisher={Rockefeller University Press}, author={Sai, Kazuhito and Parsons, Cameron and House, John S. and Kathariou, Sophia and Ninomiya-Tsuji, Jun}, year={2019}, month={Jun}, pages={1994–2005} }
 @article{liu_hayano_pan_inagaki_ninomiya-tsuji_sun_mishina_2018, title={Compound mutations in Bmpr1a and Tak1 synergize facial deformities via increased cell death}, volume={56}, ISSN={["1526-968X"]}, DOI={10.1002/dvg.23093}, abstractNote={BMP signaling plays a critical role in craniofacial development. Augmentation of BMPR1A signaling through neural crest-specific expression of constitutively active Bmpr1a (caBmpr1a) results in craniofacial deformities in mice. To investigate whether deletion of Tak1 may rescue the craniofacial deformities caused by enhanced Smad-dependent signaling through caBMPR1A, we generated embryos to activate transcription of caBmpr1a transgene and ablate Tak1 in neural crest derivatives at the same time. We found that deformities of the double mutant mice showed more severe than those with each single mutation, including median facial cleft and cleft palate. We found higher levels of cell death in the medial nasal and the lateral nasal processes at E10.5 in association with higher levels of p53 in the double mutant embryos. We also found higher levels of pSmad1/5/9 in the lateral nasal processes at E10.5 in the double mutant embryos. Western analyses revealed that double mutant embryos showed similar degrees of upregulation of pSmad1/5/9 with caBmpr1a or Tak1-cKO embryos while the double mutant embryos showed higher levels of phospho-p38 than caBmpr1a or Tak1-cKO embryos at E17.5, but not at E10.5. It suggested that deletion of Tak1 aggravates the craniofacial deformities of the caBmpr1a mutants by increasing p53 and phospho-p38 at different stage of embryogenesis.}, number={3}, journal={GENESIS}, author={Liu, Xia and Hayano, Satoru and Pan, Haichun and Inagaki, Maiko and Ninomiya-Tsuji, Jun and Sun, Hongchen and Mishina, Yuji}, year={2018}, month={Mar} }
 @article{mihaly_sakamachi_ninomiya-tsuji_morioka_2017, title={Erratum: Noncanonical cell death program independent of caspase activation cascade and necroptotic modules is elicited by loss of TGFβ-activated kinase 1}, volume={7}, ISSN={2045-2322}, url={http://dx.doi.org/10.1038/S41598-017-09609-Z}, DOI={10.1038/S41598-017-09609-Z}, abstractNote={A correction to this article has been published and is linked from the HTML version of this paper. The error has been fixed in the paper.}, number={1}, journal={Scientific Reports}, publisher={Springer Nature}, author={Mihaly, September R. and Sakamachi, Yosuke and Ninomiya-Tsuji, Jun and Morioka, Sho}, year={2017}, month={Sep} }
 @article{mihaly_sakamachi_ninomiya-tsuji_morioka_2017, title={Noncanocial cell death program independent of caspase activation cascade and necroptotic modules is elicited by loss of TGF beta-activated kinase 1}, volume={7}, ISSN={["2045-2322"]}, DOI={10.1038/s41598-017-03112-1}, abstractNote={Abstract Programmed cell death (PCD) occurs in several forms including apoptosis and necroptosis. Apoptosis is executed by the activation of caspases, while necroptosis is dependent on the receptor interacting protein kinase 3 (RIPK3). Precise control of cell death is crucial for tissue homeostasis. Indeed, necroptosis is triggered by caspase inhibition to ensure cell death. Here we identified a previously uncharacterized cell death pathway regulated by TAK1, which is unexpectedly provoked by inhibition of caspase activity and necroptosis cascades. Ablation of TAK1 triggers spontaneous death in macrophages. Simultaneous inhibition of caspases and RIPK3 did not completely restore cell viability. Previous studies demonstrated that loss of TAK1 in fibroblasts causes TNF-induced apoptosis and that additional inhibition of caspase leads to necroptotic cell death. However, we surprisingly found that caspase and RIPK3 inhibitions do not completely suppress cell death in Tak1 -deficient cells. Mechanistically, the execution of the third cell death pathway in Tak1 -deficient macrophages and fibroblasts were mediated by RIPK1-dependent rapid accumulation of reactive oxygen species (ROS). Conversely, activation of RIPK1 was sufficient to induce cell death. Therefore, loss of TAK1 elicits noncanonical cell death which is mediated by RIPK1-induced oxidative stress upon caspase and necroptosis inhibition to further ensure induction of cell death.}, journal={SCIENTIFIC REPORTS}, author={Mihaly, September R. and Sakamachi, Yosuke and Ninomiya-Tsuji, Jun and Morioka, Sho}, year={2017}, month={Jun} }
 @article{sakamachi_morioka_mihaly_takaesu_foley_fessler_ninomiya-tsuji_2017, title={TAK1 regulates resident macrophages by protecting lysosomal integrity}, volume={8}, ISSN={["2041-4889"]}, DOI={10.1038/cddis.2017.23}, abstractNote={Abstract Hematopoietic cell survival and death is critical for development of a functional immune system. Here, we report that a protein kinase, TAK1, is selectively required for resident macrophage integrity during embryogenesis. Hematopoietic lineage-specific deletion of Tak1 gene (Tak1 HKO ) caused accumulation of cellular debris in the thymus in perinatal mice. Although no overt alteration in thymocytes and blood myeloid populations was observed in Tak1 HKO mice, we found that thymic and lung macrophages were diminished. In the in vitro setting, Tak1 deficiency caused profound disruption of lysosomes and killed bone marrow-derived macrophages (BMDMs) without any exogenous stressors. Inhibition of the lysosomal protease, cathepsin B, partially blocked Tak1 -deficient BMDM death, suggesting that leakage of the lysosomal contents is in part the cause of cell death. To identify the trigger of this cell death, we examined involvement of TNF and Toll-like receptor pathways. Among them, we found that deletion of Tnfr1 partially rescued cell death. Finally, we show that Tnfr1 deletion partially restored thymic and lung macrophages in vivo . These results suggest that autocrine and potentially paracrine TNF kills Tak1 -deficient macrophages during development. Our results reveal that TAK1 signaling maintains proper macrophage populations through protecting lysosomal integrity.}, journal={CELL DEATH & DISEASE}, author={Sakamachi, Yosuke and Morioka, Sho and Mihaly, September R. and Takaesu, Giichi and Foley, Julie F. and Fessler, Michael B. and Ninomiya-Tsuji, Jun}, year={2017}, month={Feb} }
 @article{hashimoto_simmons_kajino-sakamoto_tsuji_ninomiya-tsuji_2016, title={TAK1 Regulates the Nrf2 Antioxidant System Through Modulating p62/SQSTM1}, volume={25}, ISSN={["1557-7716"]}, DOI={10.1089/ars.2016.6663}, abstractNote={Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2) is the master transcriptional regulator of antioxidant gene expression. On increased oxidative stress, an adaptor for Nrf2 degradation, Kelch-like ECH-associated protein 1 (Keap1), is directly modulated by oxidants in the cytoplasm, which results in stabilization and activation of Nrf2. Nrf2 is also constitutively active, to some extent, in the absence of exogenous oxidative stress. We have previously demonstrated that intestinal epithelium-specific TGF-β-activated kinase 1 (TAK1) deletion downregulates the level of Nrf2 protein, resulting in an increase of reactive oxygen species (ROS) in a mouse model. We aim at determining the mechanism by which TAK1 modulates the level of Nrf2.We found that TAK1 upregulated serine 351 phosphorylation of an autophagic adaptor protein, p62/Sequestosome-1 (SQSTM1), which facilitates interaction between p62/SQSTM1 and Keap1 and subsequent Keap1 degradation. This, ultimately, causes increased Nrf2. Tak1 deficiency reduced the phosphorylation of p62/SQSTM1, resulting in decreased steady-state levels of Nrf2 along with increased Keap1. We also found that this regulation is independent of the canonical redox-mediated Nrf2 activation mechanism. In Tak1-deficient intestinal epithelium, a synthetic phenolic electrophile, butylated hydroxyanisole still effectively upregulated Nrf2 and reduced ROS.Our results identify for the first time that TAK1 is a modulator of p62/SQSTM1-dependent Keap1 degradation and maintains the steady state-level of Nrf2.TAK1 regulates Nrf2 through modulation of Keap-p62/SQSTM1 interaction. This regulation is important for homeostatic antioxidant protection in the intestinal epithelium. Antioxid. Redox Signal. 25, 953-964.}, number={17}, journal={ANTIOXIDANTS & REDOX SIGNALING}, author={Hashimoto, Kazunori and Simmons, Alicia N. and Kajino-Sakamoto, Rie and Tsuji, Yoshiaki and Ninomiya-Tsuji, Jun}, year={2016}, month={Dec}, pages={953–964} }
 @article{sai_morioka_takaesu_muthusamy_ghashghaei_hanafusa_matsumoto_ninomiya-tsuji_2016, title={TAK1 determines susceptibility to endoplasmic reticulum stress and leptin resistance in the hypothalamus}, volume={129}, ISSN={0021-9533 1477-9137}, url={http://dx.doi.org/10.1242/jcs.180505}, DOI={10.1242/jcs.180505}, abstractNote={Sustained endoplasmic reticulum (ER) stress disrupts normal cellular homeostasis and leads to the development of many types of human diseases including metabolic disorders. TAK1 is a member of the mitogen-activated protein kinase kinase kinase (MAP3K) family, and is activated by a diverse set of inflammatory stimuli. Here we demonstrate that TAK1 regulates ER stress and metabolic signaling through modulation of lipid biogenesis. We found that deletion of Tak1 increased ER volume and facilitated ER stress tolerance in cultured cells, which was mediated by upregulation of sterol-regulatory element binding proteins (SREBPs)-dependent lipogenesis. In the in vivo setting, central nervous system (CNS)-specific Tak1 deletion upregulated SREBP target lipogenic genes and blocked ER stress in the hypothalamus. Furthermore, CNS-specific Tak1 deletion prevented ER stress-induced hypothalamic leptin resistance and hyperphagic obesity under high fat diet (HFD). Thus, TAK1 is a critical regulator of ER stress in vivo, which could be a target for alleviation of ER stress and its associated disease conditions.}, number={9}, journal={Journal of Cell Science}, publisher={The Company of Biologists}, author={Sai, Kazuhito and Morioka, Sho and Takaesu, Giichi and Muthusamy, Nagendran and Ghashghaei, H. Troy and Hanafusa, Hiroshi and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2016}, month={Mar}, pages={1855–1865} }
 @article{simmons_kajino-sakamoto_ninomiya-tsuji_2016, title={TAK1 regulates Paneth cell integrity partly through blocking necroptosis}, volume={7}, ISSN={["2041-4889"]}, DOI={10.1038/cddis.2016.98}, abstractNote={Abstract Paneth cells reside at the base of crypts of the small intestine and secrete antimicrobial factors to control gut microbiota. Paneth cell loss is observed in the chronically inflamed intestine, which is often associated with increased reactive oxygen species (ROS). However, the relationship between Paneth cell loss and ROS is not yet clear. Intestinal epithelial-specific deletion of a protein kinase Tak1 depletes Paneth cells and highly upregulates ROS in the mouse model. We found that depletion of gut bacteria or myeloid differentiation factor 88 ( Myd88 ), a mediator of bacteria-derived cell signaling, reduced ROS but did not block Paneth cell loss, suggesting that gut bacteria are the cause of ROS accumulation but bacteria-induced ROS are not the cause of Paneth cell loss. In contrast, deletion of the necroptotic cell death signaling intermediate, receptor-interacting protein kinase 3 ( Ripk3 ), partially blocked Paneth cell loss. Thus, Tak1 deletion causes Paneth cell loss in part through necroptotic cell death. These results suggest that TAK1 participates in intestinal integrity through separately modulating bacteria-derived ROS and RIPK3-dependent Paneth cell loss.}, journal={CELL DEATH & DISEASE}, author={Simmons, A. N. and Kajino-Sakamoto, R. and Ninomiya-Tsuji, J.}, year={2016}, month={Apr} }
 @article{morioka_sai_omori_ikeda_matsumoto_ninomiya-tsuji_2016, title={TAK1 regulates hepatic lipid homeostasis through SREBP}, volume={35}, ISSN={["1476-5594"]}, DOI={10.1038/onc.2015.453}, abstractNote={Sterol-regulatory element-binding proteins (SREBPs) are key transcription factors regulating cholesterol and fatty acid biosynthesis. SREBP activity is tightly regulated to maintain lipid homeostasis, and is modulated upon extracellular stimuli such as growth factors. While the homeostatic SREBP regulation is well studied, stimuli-dependent regulatory mechanisms are still elusive. Here we demonstrate that SREBPs are regulated by a previously uncharacterized mechanism through transforming growth factor-β activated kinase 1 (TAK1), a signaling molecule of inflammation. We found that TAK1 binds to and inhibits mature forms of SREBPs. In an in vivo setting, hepatocyte-specific Tak1 deletion upregulates liver lipid deposition and lipogenic enzymes in the mouse model. Furthermore, hepatic Tak1 deficiency causes steatosis pathologies including elevated blood triglyceride and cholesterol levels, which are established risk factors for the development of hepatocellular carcinoma (HCC) and are indeed correlated with Tak1-deficiency-induced HCC development. Pharmacological inhibition of SREBPs alleviated the steatosis and reduced the expression level of the HCC marker gene in the Tak1-deficient liver. Thus, TAK1 regulation of SREBP critically contributes to the maintenance of liver homeostasis to prevent steatosis, which is a potentially important mechanism to prevent HCC development.}, number={29}, journal={ONCOGENE}, author={Morioka, S. and Sai, K. and Omori, E. and Ikeda, Y. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2016}, month={Jul}, pages={3829–3838} }
 @article{lane_yumoto_azhar_ninomiya-tsuji_inagaki_hu_deng_kim_mishina_kaartinen_2015, title={Tak1, Smad4 and Trim33 redundantly mediate TGF-beta 3 signaling during palate development}, volume={398}, ISSN={["1095-564X"]}, DOI={10.1016/j.ydbio.2014.12.006}, abstractNote={Transforming growth factor-beta3 (TGF-β3) plays a critical role in palatal epithelial cells by inducing palatal epithelial fusion, failure of which results in cleft palate, one of the most common birth defects in humans. Recent studies have shown that Smad-dependent and Smad-independent pathways work redundantly to transduce TGF-β3 signaling in palatal epithelial cells. However, detailed mechanisms by which this signaling is mediated still remain to be elucidated. Here we show that TGF-β activated kinase-1 (Tak1) and Smad4 interact genetically in palatal epithelial fusion. While simultaneous abrogation of both Tak1 and Smad4 in palatal epithelial cells resulted in characteristic defects in the anterior and posterior secondary palate, these phenotypes were less severe than those seen in the corresponding Tgfb3 mutants. Moreover, our results demonstrate that Trim33, a novel chromatin reader and regulator of TGF-β signaling, cooperates with Smad4 during palatogenesis. Unlike the epithelium-specific Smad4 mutants, epithelium-specific Tak1:Smad4- and Trim33:Smad4-double mutants display reduced expression of Mmp13 in palatal medial edge epithelial cells, suggesting that both of these redundant mechanisms are required for appropriate TGF-β signal transduction. Moreover, we show that inactivation of Tak1 in Trim33:Smad4 double conditional knockouts leads to the palatal phenotypes which are identical to those seen in epithelium-specific Tgfb3 mutants. To conclude, our data reveal added complexity in TGF-β signaling during palatogenesis and demonstrate that functionally redundant pathways involving Smad4, Tak1 and Trim33 regulate palatal epithelial fusion.}, number={2}, journal={DEVELOPMENTAL BIOLOGY}, author={Lane, Jamie and Yumoto, Kenji and Azhar, Mohamad and Ninomiya-Tsuji, Jun and Inagaki, Maiko and Hu, Yingling and Deng, Chu-Xia and Kim, Jieun and Mishina, Yuji and Kaartinen, Vesa}, year={2015}, month={Feb}, pages={231–241} }
 @article{mihaly_morioka_ninomiya-tsuji_takaesu_2014, title={Activated Macrophage Survival Is Coordinated by TAK1 Binding Proteins}, volume={9}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0094982}, abstractNote={Macrophages play diverse roles in tissue homeostasis and immunity, and canonically activated macrophages are critically associated with acute inflammatory responses. It is known that activated macrophages undergo cell death after transient activation in some settings, and the viability of macrophages impacts on inflammatory status. Here we report that TGFβ- activated kinase (TAK1) activators, TAK1-binding protein 1 (TAB1) and TAK1-binding protein 2 (TAB2), are critical molecules in the regulation of activated macrophage survival. While deletion of Tak1 induced cell death in bone marrow derived macrophages even without activation, Tab1 or Tab2 deletion alone did not profoundly affect survival of naïve macrophages. However, in lipopolysaccharide (LPS)-activated macrophages, even single deletion of Tab1 or Tab2 resulted in macrophage death with both necrotic and apoptotic features. We show that TAB1 and TAB2 were redundantly involved in LPS-induced TAK1 activation in macrophages. These results demonstrate that TAK1 activity is the key to activated macrophage survival. Finally, in an in vivo setting, Tab1 deficiency impaired increase of peritoneal macrophages upon LPS challenge, suggesting that TAK1 complex regulation of macrophages may participate in in vivo macrophage homeostasis. Our results demonstrate that TAB1 and TAB2 are required for activated macrophages, making TAB1 and TAB2 effective targets to control inflammation by modulating macrophage survival.}, number={4}, journal={PLOS ONE}, author={Mihaly, September R. and Morioka, Sho and Ninomiya-Tsuji, Jun and Takaesu, Giichi}, year={2014}, month={Apr} }
 @article{ikeda_morioka_matsumoto_ninomiya-tsuji_2014, title={TAK1 Binding Protein 2 Is Essential for Liver Protection from Stressors}, volume={9}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0088037}, abstractNote={The liver is the first line of defense from environmental stressors in that hepatocytes respond to and metabolize them. Hence, hepatocytes can be damaged by stressors. Protection against hepatic cell damage and cell death is important for liver function and homeostasis. TAK1 (MAP3K7) is an intermediate of stressors such as bacterial moieties-induced signal transduction pathways in several cell types. Tak1 deficiency has been reported to induce spontaneous hepatocellular carcinoma. However, the regulatory mechanism of TAK1 activity in liver stress response has not yet been defined. Here we report that activation of TAK1 through TAK1 binding protein 2 (TAB2) is required for liver protection from stressors. We found that a bacterial moiety, lipopolysaccharides (LPS), activated TAK1 in primary hepatocytes, which was diminished by deletion of TAB2. Mice having hepatocyte-specific deletion of the Tab2 gene exhibited only late-onset moderate liver lesions but were hypersensitive to LPS-induced liver injury. Furthermore, we show that a chemical stressor induced greatly exaggerated liver injury in hepatocyte-specific Tab2-deficient mice. These results demonstrate that TAB2 is a sensor of stress conditions in the liver and functions to protect the liver by activating the TAK1 pathway.}, number={2}, journal={PLOS ONE}, author={Ikeda, Yuka and Morioka, Sho and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2014}, month={Feb} }
 @misc{mihaly_ninomiya-tsuji_morioka_2014, title={TAK1 control of cell death}, volume={21}, ISSN={["1476-5403"]}, DOI={10.1038/cdd.2014.123}, abstractNote={Programmed cell death, a physiologic process for removing cells, is critically important in normal development and for elimination of damaged cells. Conversely, unattended cell death contributes to a variety of human disease pathogenesis. Thus, precise understanding of molecular mechanisms underlying control of cell death is important and relevant to public health. Recent studies emphasize that transforming growth factor-β-activated kinase 1 (TAK1) is a central regulator of cell death and is activated through a diverse set of intra- and extracellular stimuli. The physiologic importance of TAK1 and TAK1-binding proteins in cell survival and death has been demonstrated using a number of genetically engineered mice. These studies uncover an indispensable role of TAK1 and its binding proteins for maintenance of cell viability and tissue homeostasis in a variety of organs. TAK1 is known to control cell viability and inflammation through activating downstream effectors such as NF-κB and mitogen-activated protein kinases (MAPKs). It is also emerging that TAK1 regulates cell survival not solely through NF-κB but also through NF-κB-independent pathways such as oxidative stress and receptor-interacting protein kinase 1 (RIPK1) kinase activity-dependent pathway. Moreover, recent studies have identified TAK1's seemingly paradoxical role to induce programmed necrosis, also referred to as necroptosis. This review summarizes the consequences of TAK1 deficiency in different cell and tissue types from the perspective of cell death and also focuses on the mechanism by which TAK1 complex inhibits or promotes programmed cell death. This review serves to synthesize our current understanding of TAK1 in cell survival and death to identify promising directions for future research and TAK1's potential relevance to human disease pathogenesis.}, number={11}, journal={CELL DEATH AND DIFFERENTIATION}, author={Mihaly, S. R. and Ninomiya-Tsuji, J. and Morioka, S.}, year={2014}, month={Nov}, pages={1667–1676} }
 @article{morioka_broglie_omori_ikeda_takaesu_matsumoto_ninomiya-tsuji_2014, title={TAK1 kinase switches cell fate from apoptosis to necrosis following TNF stimulation}, volume={204}, ISSN={1540-8140 0021-9525}, url={http://dx.doi.org/10.1083/JCB.201305070}, DOI={10.1083/JCB.201305070}, abstractNote={TNF activates three distinct intracellular signaling cascades leading to cell survival, caspase-8-mediated apoptosis, or receptor interacting protein kinase 3 (RIPK3)-dependent necrosis, also called necroptosis. Depending on the cellular context, one of these pathways is activated upon TNF challenge. When caspase-8 is activated, it drives the apoptosis cascade and blocks RIPK3-dependent necrosis. Here we report the biological event switching to activate necrosis over apoptosis. TAK1 kinase is normally transiently activated upon TNF stimulation. We found that prolonged and hyperactivation of TAK1 induced phosphorylation and activation of RIPK3, leading to necrosis without caspase activation. In addition, we also demonstrated that activation of RIPK1 and RIPK3 promoted TAK1 activation, suggesting a positive feedforward loop of RIPK1, RIPK3, and TAK1. Conversely, ablation of TAK1 caused caspase-dependent apoptosis, in which Ripk3 deletion did not block cell death either in vivo or in vitro. Our results reveal that TAK1 activation drives RIPK3-dependent necrosis and inhibits apoptosis. TAK1 acts as a switch between apoptosis and necrosis.}, number={4}, journal={The Journal of Cell Biology}, publisher={Rockefeller University Press}, author={Morioka, Sho and Broglie, Peter and Omori, Emily and Ikeda, Yuka and Takaesu, Giichi and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2014}, month={Feb}, pages={607–623} }
 @article{moreno-garcia_sommer_rincon-arano_brault_ninomiya-tsuji_matesic_rawlings_2013, title={Kinase-Independent Feedback of the TAK1/TAB1 Complex on BCL10 Turnover and NF-kappa B Activation}, volume={33}, ISSN={["1098-5549"]}, DOI={10.1128/mcb.06407-11}, abstractNote={ABSTRACT Antigen receptors activate pathways that control cell survival, proliferation, and differentiation. Two important targets of antigen receptors, NF-κB and Jun N-terminal kinase (JNK), are activated downstream of CARMA1, a scaffolding protein that nucleates a complex including BCL10, MALT1, and other IκB kinase (IKK)-signalosome components. Somatic mutations that constitutively activate CARMA1 occur frequently in diffuse large B cell lymphoma (DLBCL) and mediate essential survival signals. Mechanisms that downregulate this pathway might thus yield important therapeutic targets. Stimulation of antigen receptors induces not only BCL10 activation but also its degradation downstream of CARMA1, thereby ultimately limiting signals to its downstream targets. Here, using lymphocyte cell models, we identify a kinase-independent requirement for TAK1 and its adaptor, TAB1, in antigen receptor-induced BCL10 degradation. We show that TAK1 acts as an adaptor for E3 ubiquitin ligases that target BCL10 for degradation. Functionally, TAK1 overexpression restrains CARMA1-dependent activation of NF-κB by reducing BCL10 levels. TAK1 also promotes counterselection of NF-κB-addicted DLBCL lines by a dual mechanism involving kinase-independent degradation of BCL10 and kinase-dependent activation of JNK. Thus, by directly promoting BCL10 degradation, TAK1 counterbalances NF-κB and JNK signals essential for the activation and survival of lymphocytes and CARMA1-addicted lymphoma types.}, number={6}, journal={MOLECULAR AND CELLULAR BIOLOGY}, author={Moreno-Garcia, Miguel E. and Sommer, Karen and Rincon-Arano, Hector and Brault, Michelle and Ninomiya-Tsuji, Jun and Matesic, Lydia E. and Rawlings, David J.}, year={2013}, month={Mar}, pages={1149–1163} }
 @article{yumoto_thomas_lane_matsuzaki_inagaki_ninomiya-tsuji_scott_ray_ishii_maxson_et al._2013, title={TGF-beta-activated Kinase 1 (Tak1) Mediates Agonist-induced Smad Activation and Linker Region Phosphorylation in Embryonic Craniofacial Neural Crest-derived Cells}, volume={288}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.m112.431775}, abstractNote={The role of Smad-independent TGF-β signaling in craniofacial development is poorly elucidated.In craniofacial mesenchymal cells, Tak1 regulates both R-Smad C-terminal and linker region phosphorylation in TGF-β signaling.Tak1 plays an irreplaceable role in craniofacial ecto-mesenchyme during embryogenesis.Understanding the mechanisms of TGF-β signaling contributes to knowledge of pathogenetic mechanisms underlying common craniofacial birth defects. Although the importance of TGF-β superfamily signaling in craniofacial growth and patterning is well established, the precise details of its signaling mechanisms are still poorly understood. This is in part because of the concentration of studies on the role of the Smad-dependent (so-called "canonical") signaling pathways relative to the Smad-independent ones in many biological processes. Here, we have addressed the role of TGF-β-activated kinase 1 (Tak1, Map3k7), one of the key mediators of Smad-independent (noncanonical) TGF-β superfamily signaling in craniofacial development, by deleting Tak1 specifically in the neural crest lineage. Tak1-deficient mutants display a round skull, hypoplastic maxilla and mandible, and cleft palate resulting from a failure of palatal shelves to appropriately elevate and fuse. Our studies show that in neural crest-derived craniofacial ecto-mesenchymal cells, Tak1 is not only required for TGF-β- and bone morphogenetic protein-induced p38 Mapk activation but also plays a role in agonist-induced C-terminal and linker region phosphorylation of the receptor-mediated R-Smads. Specifically, we demonstrate that the agonist-induced linker region phosphorylation of Smad2 at Thr-220, which has been shown to be critical for full transcriptional activity of Smad2, is dependent on Tak1 activity and that in palatal mesenchymal cells TGFβRI and Tak1 kinases mediate both overlapping and distinct TGF-β2-induced transcriptional responses. To summarize, our results suggest that in neural crest-derived ecto-mesenchymal cells, Tak1 provides a critical point of intersection in a complex dialogue between the canonical and noncanonical arms of TGF-β superfamily signaling required for normal craniofacial development.}, number={19}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Yumoto, Kenji and Thomas, Penny S. and Lane, Jamie and Matsuzaki, Kouichi and Inagaki, Maiko and Ninomiya-Tsuji, Jun and Scott, Gregory J. and Ray, Manas K. and Ishii, Mamoru and Maxson, Robert and et al.}, year={2013}, month={May}, pages={13467–13480} }
 @article{omori_inagaki_mishina_matsumoto_ninomiya-tsuji_2012, title={Epithelial transforming growth factor  -activated kinase 1 (TAK1) is activated through two independent mechanisms and regulates reactive oxygen species}, volume={109}, ISSN={0027-8424 1091-6490}, url={http://dx.doi.org/10.1073/pnas.1116188109}, DOI={10.1073/pnas.1116188109}, abstractNote={Dysregulation in cellular redox systems results in accumulation of reactive oxygen species (ROS), which are causally associated with a number of disease conditions. Transforming growth factor β-activated kinase 1 (TAK1) is a signaling intermediate of innate immune signaling pathways and is critically involved in the redox regulation in vivo. Ablation of TAK1 causes accumulation of ROS, resulting in epithelial cell death and inflammation. Here we determine the mechanism by which TAK1 kinase is activated in epithelial tissues. TAB1 and TAB2 are structurally unrelated TAK1 binding protein partners. TAB2 is known to mediate polyubiquitin chain-dependent TAK1 activation in innate immune signaling pathways, whereas the role of TAB1 is not defined. We found that epithelial-specific TAB1 and TAB2 double- but not TAB1 or TAB2 single-knockout mice phenocopied epithelial-specific TAK1 knockout mice. We demonstrate that phosphorylation-dependent basal activity of TAK1 is dependent on TAB1. Ablation of both TAB1 and TAB2 diminished the activity of TAK1 in vivo and causes accumulation of ROS in the epithelial tissues. These results demonstrate that epithelial TAK1 activity is regulated through two unique, TAB1-dependent basal and TAB2-mediated stimuli-dependent mechanisms.}, number={9}, journal={Proceedings of the National Academy of Sciences}, publisher={Proceedings of the National Academy of Sciences}, author={Omori, E. and Inagaki, M. and Mishina, Y. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2012}, month={Feb}, pages={3365–3370} }
 @article{takaesu_inagaki_takubo_mishina_hess_dean_yoshimura_matsumoto_suda_ninomiya-tsuji_et al._2012, title={TAK1 (MAP3K7) Signaling Regulates Hematopoietic Stem Cells through TNF-Dependent and -Independent Mechanisms}, volume={7}, ISSN={1932-6203}, url={http://dx.doi.org/10.1371/journal.pone.0051073}, DOI={10.1371/journal.pone.0051073}, abstractNote={A cytokine/stress signaling kinase Tak1 (Map3k7) deficiency is known to impair hematopoietic progenitor cells. However, the role of TAK1 signaling in the stem cell function of the hematopoietic system is not yet well defined. Here we characterized hematopoietic stem cells (HSCs) harboring deletion of Tak1 and its activators, Tak1 binding proteins 1 and 2 (Tab1 and Tab2) using a competitive transplantation assay in a mouse model. Tak1 single or Tab1/Tab2 double deletions completely eliminated the reconstitution activity of HSCs, whereas Tab1 or Tab2 single deletion did not cause any abnormality. Tak1 single or Tab1/Tab2 double deficient lineage-negative, Sca-1(+), c-Kit(+) (LSK) cells did not proliferate and underwent cell death. We found that Tnfr1 deficiency restored the reconstitution activity of Tak1 deficient bone marrow cells for 6-18 weeks. However, the reconstitution activity of Tak1- and Tnfr1-double deficient bone marrow cells declined over the long term, and the number of phenotypically identified long-term hematopoietic stem cells were diminished. Our results indicate that TAB1- or TAB2-dependent activation of TAK1 is required for maintenance of the hematopoietic system through two mechanisms: one is prevention of TNF-dependent cell death and the other is TNF-independent maintenance of long-term HSC.}, number={11}, journal={PLoS ONE}, publisher={Public Library of Science (PLoS)}, author={Takaesu, Giichi and Inagaki, Maiko and Takubo, Keiyo and Mishina, Yuji and Hess, Paul R. and Dean, Gregg A. and Yoshimura, Akihiko and Matsumoto, Kunihiro and Suda, Toshio and Ninomiya-Tsuji, Jun and et al.}, editor={Tjwa, MarcEditor}, year={2012}, month={Nov}, pages={e51073} }
 @article{criollo_niso-santano_malik_michaud_morselli_marino_lachkar_arkhipenko_harper_pierron_et al._2011, title={Inhibition of autophagy by TAB2 and TAB3}, volume={30}, ISSN={["1460-2075"]}, DOI={10.1038/emboj.2011.413}, abstractNote={Article11 November 2011free access Inhibition of autophagy by TAB2 and TAB3 Alfredo Criollo Alfredo Criollo INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Mireia Niso-Santano Mireia Niso-Santano INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Shoaib Ahmad Malik Shoaib Ahmad Malik INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Mickael Michaud Mickael Michaud INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Eugenia Morselli Eugenia Morselli INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Guillermo Mariño Guillermo Mariño INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Sylvie Lachkar Sylvie Lachkar INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Alexander V Arkhipenko Alexander V Arkhipenko INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Search for more papers by this author Francis Harper Francis Harper Institut Gustave Roussy, Villejuif, France CNRS, UMR8122, Villejuif, France Search for more papers by this author Gérard Pierron Gérard Pierron Institut Gustave Roussy, Villejuif, France CNRS, UMR8122, Villejuif, France Search for more papers by this author Jean-Christophe Rain Jean-Christophe Rain Hybrigenics SA, Paris, France Search for more papers by this author Jun Ninomiya-Tsuji Jun Ninomiya-Tsuji Environmental and Molecular Toxicology, North Carolina State University, Raleigh, NC, USA Search for more papers by this author José M Fuentes José M Fuentes CIBERNED, Departamento de Bioquımica y Biologıa Molecular y Genética, EU Enfermería y TO, Universidad de Extremadura, Cacéres, Spain Search for more papers by this author Sergio Lavandero Sergio Lavandero Center Molecular Study of the Cell, Pharmaceutical and Chemical Science Faculty and Medicine Faculty, University of Chile, Santiago, Chile Cardiology Division, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX, USA Search for more papers by this author Lorenzo Galluzzi Lorenzo Galluzzi INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Maria Chiara Maiuri Corresponding Author Maria Chiara Maiuri INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, FranceThese authors share senior co-authorship Search for more papers by this author Guido Kroemer Corresponding Author Guido Kroemer INSERM, U848, Villejuif, France Metabolomics Platform, Institut Gustave Roussy, Villejuif, France Centre de Recherche des Cordeliers, Paris, France Pôle de Biologie, Hôpital Européen Georges Pompidou, AP-HP, Paris, France Université Paris Descartes, Sorbonne Paris Cité, Paris, FranceThese authors share senior co-authorship Search for more papers by this author Alfredo Criollo Alfredo Criollo INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Mireia Niso-Santano Mireia Niso-Santano INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Shoaib Ahmad Malik Shoaib Ahmad Malik INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Mickael Michaud Mickael Michaud INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Eugenia Morselli Eugenia Morselli INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Guillermo Mariño Guillermo Mariño INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Sylvie Lachkar Sylvie Lachkar INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Alexander V Arkhipenko Alexander V Arkhipenko INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Search for more papers by this author Francis Harper Francis Harper Institut Gustave Roussy, Villejuif, France CNRS, UMR8122, Villejuif, France Search for more papers by this author Gérard Pierron Gérard Pierron Institut Gustave Roussy, Villejuif, France CNRS, UMR8122, Villejuif, France Search for more papers by this author Jean-Christophe Rain Jean-Christophe Rain Hybrigenics SA, Paris, France Search for more papers by this author Jun Ninomiya-Tsuji Jun Ninomiya-Tsuji Environmental and Molecular Toxicology, North Carolina State University, Raleigh, NC, USA Search for more papers by this author José M Fuentes José M Fuentes CIBERNED, Departamento de Bioquımica y Biologıa Molecular y Genética, EU Enfermería y TO, Universidad de Extremadura, Cacéres, Spain Search for more papers by this author Sergio Lavandero Sergio Lavandero Center Molecular Study of the Cell, Pharmaceutical and Chemical Science Faculty and Medicine Faculty, University of Chile, Santiago, Chile Cardiology Division, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX, USA Search for more papers by this author Lorenzo Galluzzi Lorenzo Galluzzi INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Maria Chiara Maiuri Corresponding Author Maria Chiara Maiuri INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, FranceThese authors share senior co-authorship Search for more papers by this author Guido Kroemer Corresponding Author Guido Kroemer INSERM, U848, Villejuif, France Metabolomics Platform, Institut Gustave Roussy, Villejuif, France Centre de Recherche des Cordeliers, Paris, France Pôle de Biologie, Hôpital Européen Georges Pompidou, AP-HP, Paris, France Université Paris Descartes, Sorbonne Paris Cité, Paris, FranceThese authors share senior co-authorship Search for more papers by this author Author Information Alfredo Criollo1,2,3,‡, Mireia Niso-Santano1,2,3,‡, Shoaib Ahmad Malik1,2,3, Mickael Michaud1,2,3, Eugenia Morselli1,2,3, Guillermo Mariño1,2,3, Sylvie Lachkar1,2,3, Alexander V Arkhipenko1,2, Francis Harper2,4, Gérard Pierron2,4, Jean-Christophe Rain5, Jun Ninomiya-Tsuji6, José M Fuentes7, Sergio Lavandero8,9, Lorenzo Galluzzi1,2,3, Maria Chiara Maiuri 1,2,3 and Guido Kroemer 1,10,11,12,13 1INSERM, U848, Villejuif, France 2Institut Gustave Roussy, Villejuif, France 3Université Paris Sud, Paris 11, Villejuif, France 4CNRS, UMR8122, Villejuif, France 5Hybrigenics SA, Paris, France 6Environmental and Molecular Toxicology, North Carolina State University, Raleigh, NC, USA 7CIBERNED, Departamento de Bioquımica y Biologıa Molecular y Genética, EU Enfermería y TO, Universidad de Extremadura, Cacéres, Spain 8Center Molecular Study of the Cell, Pharmaceutical and Chemical Science Faculty and Medicine Faculty, University of Chile, Santiago, Chile 9Cardiology Division, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX, USA 10Metabolomics Platform, Institut Gustave Roussy, Villejuif, France 11Centre de Recherche des Cordeliers, Paris, France 12Pôle de Biologie, Hôpital Européen Georges Pompidou, AP-HP, Paris, France 13Université Paris Descartes, Sorbonne Paris Cité, Paris, France ‡These authors contributed equally to this work *Corresponding authors: INSERM, U848, Institut Gustave Roussy, Pavillon de Recherche 1, 39 rue Camille Desmoulins, F–94805 Villejuif, France. Tel.: +33 1 4211 5216; Fax: +33 1 4211 6665; E-mail: [email protected] or Tel.: +33 1 4211 6046; Fax: +33 1 4211 6047; E-mail: [email protected] The EMBO Journal (2011)30:4908-4920https://doi.org/10.1038/emboj.2011.413 PDFDownload PDF of article text and main figures. Peer ReviewDownload a summary of the editorial decision process including editorial decision letters, reviewer comments and author responses to feedback. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Autophagic responses are coupled to the activation of the inhibitor of NF-κB kinase (IKK). Here, we report that the essential autophagy mediator Beclin 1 and TGFβ-activated kinase 1 (TAK1)-binding proteins 2 and 3 (TAB2 and TAB3), two upstream activators of the TAK1-IKK signalling axis, constitutively interact with each other via their coiled-coil domains (CCDs). Upon autophagy induction, TAB2 and TAB3 dissociate from Beclin 1 and bind TAK1. Moreover, overexpression of TAB2 and TAB3 suppresses, while their depletion triggers, autophagy. The expression of the C-terminal domain of TAB2 or TAB3 or that of the CCD of Beclin 1 competitively disrupts the interaction between endogenous Beclin 1, TAB2 and TAB3, hence stimulating autophagy through a pathway that requires endogenous Beclin 1, TAK1 and IKK to be optimally efficient. These results point to the existence of an autophagy-stimulatory ‘switch’ whereby TAB2 and TAB3 abandon inhibitory interactions with Beclin 1 to engage in a stimulatory liaison with TAK1. Introduction Macroautophagy (hereafter referred to as ‘autophagy’) is a catabolic pathway involving the sequestration of cytoplasmic material in double-membraned vesicles, the autophagosomes. Upon fusion with lysosomes, autophagosomes become autophagolysosomes and their content gets degraded by acidic hydrolases, allowing nutrients and macromolecules to fuel cellular metabolism or sustain stress responses (Klionsky, 2004; Mizushima et al, 2008). Multiple distinct perturbations of the cellular physiology can induce autophagy through a complex signalling network that crosstalks with several stress-response pathways (Kroemer et al, 2010; Green et al, 2011), including molecular cascades that are ignited by organellar damage as well as pathways leading to the activation of prominent transcription factors such as p53 (Tasdemir et al, 2008b; Scherz-Shouval et al, 2010) and NF-κB (Herrero-Martin et al, 2009; Criollo et al, 2010; Comb et al, 2011). Beclin 1 has been the first mammalian protein shown to play a critical role in the initiation of autophagy (Liang et al, 1999). Its complex interactome has a major influence on the positive and negative regulation of autophagy (Kang et al, 2011). One of the decisive events that ignites the autophagic machinery is the activation of the class III phosphatidylinositol 3-kinase (PI3KC3), also called VPS34, to generate phosphatidylinositol-3-phosphate, which is required for the initial steps of vesicle nucleation (Axe et al, 2008). Beclin 1 is an obligatory allosteric activator of VPS34, operating within the so-called ‘Beclin 1 core complex’ that involves Beclin 1, VPS15, VPS34 and, likely, AMBRA1 (He and Levine, 2010). Numerous additional proteins interact with Beclin 1. Pro-autophagic Beclin 1 interactors include ATG14 (also called ATG14L or BARKOR), UV radiation resistance-associated gene (UVRAG) and Bif-1/endophilin B1, which interacts with Beclin 1 via UVRAG. Autophagy-inhibitory interactors of Beclin 1 include RUN domain protein as Beclin 1 interacting and cysteine-rich containing (RUBICON), anti-apoptotic proteins from the BCL-2 family (BCL-2, BCL-XL and MCL-1) and the inositol-1,4,5 trisphosphate receptor, which interacts with Beclin 1 indirectly via BCL-2 (He and Levine, 2010; Kang et al, 2011). Beclin 1 possesses a BH3 domain (residues 114–123) through which it constitutively interacts with BCL-2-like proteins (Maiuri et al, 2007), and autophagy induction requires the dissociation of Beclin 1 from such inhibitory liaisons (He and Levine, 2010; Kang et al, 2011). The transcription factor NF-κB is activated when the inhibitor of NF-κB (IκB) is phosphorylated by the IκB kinase (IKK), a multiprotein complex that is composed by one regulatory (IKKγ, also known as NEMO) and two catalytic subunits (IKKα and IKKβ). IKK is activated in response to stressors as diverse as reactive oxygen species and DNA damage as well as by the ligation of death receptors (Baud and Karin, 2009). Frequently, the activation of IKK is mediated further upstream by yet another kinase, mitogen-activated protein kinase kinase kinase 7 (MAP3K7), better known as TGFβ-activated kinase 1 (TAK1) (Ninomiya-Tsuji et al, 1999; Takaesu et al, 2003; Landstrom, 2010). The phosphorylation of IκB by IKK stimulates IκB ubiquitination, thus targeting it for proteasomal degradation. In turn, IκB degradation allows NF-κB to translocate from the cytoplasm, where it is usually retained by IκB, to the nucleus, where NF-κB then becomes active as a cytoprotective and pro-inflammatory transcription factor (Baud and Karin, 2009). In both murine and human cells, the genetic inhibition of TAK1 or any of the IKK subunits (but not that of the NF-κB subunit p65) prevents the induction of autophagy in response to a panoply of different stimuli including starvation, rapamycin, p53 inhibition and endoplasmic reticulum stress (Herrero-Martin et al, 2009; Criollo et al, 2010; Comb et al, 2011). Conversely, constitutively active IKK subunits potently stimulate autophagy through a pathway that does not necessarily involve NF-κB, yet relies on the activation of AMPK and JNK1 (Criollo et al, 2010), as well as on several essential autophagy-related proteins including Beclin 1, ATG5 and LC3 (Comb et al, 2011). Altogether, these results point to the existence of a major crosstalk between autophagy and the TAK1-IKK signalling axis, yet do not reveal the molecular mechanisms through which these pathways intersect. Here, we report the discovery that TAK1-binding protein 2 (TAB2) and TAK1-binding protein 3 (TAB3) function as tonic inhibitors of autophagy. We found that TAB2 and TAB3 constitutively interact with Beclin 1 and that this liaison is lost upon treatment with physiological inducers of autophagy, causing TAB2 and TAB3 to bind TAK1 instead of Beclin 1. Competitive disruption of the Beclin 1/TAB2/TAB3 complex suffices to induce Beclin 1- and TAK1-dependent autophagy, underscoring the importance of the inhibitory interaction between Beclin 1, TAB2 and TAB3. Results Identification of TAB2 and TAB3 as novel Beclin 1 interactors To unveil a possible intersection between autophagy and the TAK1-IKK activation pathway, we identified Beclin 1 interactors in two yeast two-hybrid saturation screens based on a complex human random-primed cDNA library. This approach led us to identify 63 Beclin 1-interacting proteins. Beyond known interactors (such as UVRAG, ATG14 and ZWINT) (Behrends et al, 2010), our screens identified 11 new proteins that would bind Beclin 1 with an elevated Predicted Biological Score (Formstecher et al, 2005) (Figure 1A, also consultable at the following website http://pim.hybrigenics.com/). Among these 11 proteins, 1 (desmoplakin) has previously been described to bind multiple autophagy-relevant proteins including PIK3C3/VPS34 (but not Beclin 1), and two have been reported to interact with one single autophagy-related protein (PLEC1 with SQSTM1/p62 and SNX4 with RABGAP1) (Behrends et al, 2010). Of note, two among the putative Beclin 1 interactors, namely TAB2 and its close homologue TAB3, are known co-activators of TAK1 (Takaesu et al, 2000; Ishitani et al, 2003). Yeast two-hybrid technology allowed us to narrow down the domains that mediate the interaction of TAB2 and TAB3 with Beclin 1 to a C-terminal region that we called ‘Beclin-binding domain’ (BBD). The BBD spans from residues 526 to 657 in TAB2 and from residues 518 to 608 in TAB3 (Figure 1B). Co-immunoprecipitation experiments involving Beclin 1 and multiple TAB2 and TAB3 deletion constructs (Figure 1C) confirmed the interaction of full-length Beclin 1 with full-length TAB2 and TAB3, as well as with TAB2 and TAB3 fragments containing the C-terminal BBD. The binding of Beclin 1 to TAB2 and TAB3 was lost upon deletion of their BBDs (Figure 1D and E). Thus, TAB2 and TAB3 constitute novel bona fide members of the Beclin 1 interactome. Figure 1.Identification of novel Beclin 1 interactors. (A) Beclin 1 (BCN1) interactors identified by yeast two-hybrid technology. Proteins binding to BCN1 are listed and their interacting domains are indicated by black bars. Numbers refer to amino-acid positions. (B) Identification of TAB2 and TAB3 fragments interacting with BCN1 in the yeast two-hybrid system. Blue lines depict the fragments of TAB2 or TAB3 that were found to interact with BCN1 (numbers on the right refer to the amount of yeast clones identified for each fragment). The minimal domain required for the interaction is referred to as Beclin-binding domain (BBD). (C) Constructs derived from TAB2 and TAB3 used in this study. (D, E) Co-immunoprecipitation of TAB2 or TAB3 with BCN1. The indicated constructs, namely HA-tagged and T7-tagged TAB2, and TAB3 constructs in (D) and (E), respectively, and Flag-tagged Beclin 1 (Flag–BCN1) were transfected into HeLa cells alone or in combination. Twenty-four hours later, TAB2 and TAB3 were immunoprecipitated with antibodies specific for HA (D) or T7 (E) and the precipitate was separated by SDS–PAGE and revealed with an antibody specific for Flag. (F) Immunoprecipitation of endogenous BCN1 with endogenous TAB2 or TAB3. HeLa cells were subjected to autophagy induction with starvation conditions, 1 μM rapamycin or 30 μM pifithrin α (PFTα) for the indicated time and then processed for TAB2 or TAB3 immunoprecipitation followed by the immunodetection of BCN1, TAK1, TAB2 and TAB3. Results in (E) and (F) are representative for three independent experiments. Download figure Download PowerPoint TAB2 and TAB3 dissociate from Beclin 1 upon autophagy induction A His-tagged version of Beclin 1 was introduced together with epitope-tagged TAB2 or TAB3 into human cervical carcinoma HeLa cells, which were then driven into autophagy by culture in serum- and nutrient-free conditions (starvation), or by the administration of the mTOR inhibitor rapamycin or of the p53 inhibitor cyclic pifithrin α (PFTα). These three pro-autophagic stimuli all led to a decrease in the amount of TAB2 of TAB3 that co-immunoprecipitated with Beclin 1, as compared with control conditions (Supplementary Figure S1). Consistently, endogenous Beclin 1 co-immunoprecipitated with TAB2 or TAB3 (but not with TAK1) in control conditions, and this interaction was rapidly lost upon autophagy induction in HeLa cells (Figure 1F), as well as in other human cell lines (non small-cell lung cancer A549 cells, colorectal carcinoma HCT 116 cells) and mouse embryonic fibroblasts (MEFs, not shown). While in physiological conditions TAB2 and TAB3 failed to co-immunoprecipitate with TAK1, after the induction of autophagy with starvation, rapamycin or PFTα, both TAB2 and TAB3 were found to engage in such an interaction. Kinetic experiments revealed that TAB2 and TAB3 bind TAK1 as soon as they dissociate from Beclin 1 (Figure 1F). Inhibition of TAK1 by overexpression of a kinase-dead dominant-negative (DN) TAK1 mutant (TAK1K63W) (Ono et al, 2003; Figure 2A and B) or by means of a specific small-interfering RNA (siRNA) (Supplementary Figure S2) prevented the relocalization of a green fluorescence protein (GFP)–LC3 chimera from a diffuse pattern to discrete cytoplasmic puncta (Tasdemir et al, 2008a) by starvation, rapamycin or PFTα (Figure 2C and D). Similarly, TAK1 depletion prevented the autophagy-associated redistribution of a red fluorescent protein (RFP)-tagged FYVE domain (FYVE–RFP) (Zhang et al, 2007) to intracellular membranes containing phosphatidylinositol-3-phosphate (Figure 2E and F). Figure 2.Reduced interaction between Beclin 1, TAB and TAB3 in conditions of autophagy induction. (A, B) Inhibition of autophagy by dominant-negative (DN) TAK1. HeLa cells were co-transfected with a GFP–LC3-encoding construct plus pcDNA3.1 (empty vector), or plasmids for the expression of WT TAK1 (TAK1WT) or the DN TAK1K63W mutant. One day later, cells were either left untreated (control) or driven into autophagy by starvation or by the administration of 1 μM rapamycin or 30 μM pifithrin α (PFTα), followed by immunoblotting for the detection of TAK1 and endogenous LC3 (A) or immunofluorescence microscopy for the quantification of cells with cytosolic GFP–LC3 puncta (GFP–LC3VAC cells) (B) (mean values±s.d., n=3; *P<0.01 versus control cells). GAPDH levels were monitored to ensure equal loading. (C, D) Inhibition of autophagy by knockdown of VPS34, Beclin 1 (BCN1) and TAK1. siRNAs that effectively deplete VPS34, BCN1 and TAK1 were co-transfected with a GFP–LC3-encoding plasmid in HeLa cells. Autophagy was then induced as in (A) and the frequency of GFP–LC3VAC cells (mean values±s.d., n=3; *P<0.01 versus control cells) was determined. (E, F) The same setting shown in (C, D) was performed with U2OS cells and FYVE–RFP (mean values±s.d., n=3; *P<0.01, **P<0.001 versus control cells). Download figure Download PowerPoint Altogether, these results support the idea that TAB2 and TAB3 dissociate from Beclin 1 to engage with TAK1 when autophagy is induced. TAB2 and TAB3 are endogenous inhibitors of autophagy Depletion of TAB2 or TAB3 by specific siRNAs induced the accumulation of GFP–LC3+ dots in HeLa and human osteosarcoma U2OS cells stably expressing GFP–LC3 (Figure 3A and B), in HeLa cells transiently transfected with a GFP–LC3-encoding plasmid as well as in HCT 116 cells (Supplementary Figure S3). Moreover, TAB2 or TAB3 knockdown stimulated the lipidation of endogenous LC3, an autophagy-associated post-translational modification that enhances its electrophoretic mobility (shift from the LC3-I to the LC3-II form), and reduced the abundance of the autophagic substrate SQSTM1/p62 (Figure 3C), suggesting that TAB2 and TAB3 act as endogenous inhibitors of autophagy. Accordingly, the depletion of TAB2 or TAB3 led to the accumulation of bona fide autophagosomes and autophagolysosomes, as determined by transmission electron microscopy (Figure 3D and E). Epistatic experiments revealed that the simultaneous knockdown of TAB2 and TAB3 induced only slightly more GFP–LC3+ puncta than the depletion of each of these proteins alone. Moreover, the induction of autophagy by TAB2 depletion was inhibited by transfection of non-interferable TAB2 or wild-type (WT) TAB3 (and vice versa TAB2 transfection antagonized autophagy induction by TAB3 depletion), suggesting that both proteins inhibit the formation of autophagic puncta in a similar, overlapping manner (Figure 3F). Moreover, the depletion of either TAB induced the formation of FYVE–RFP+ puncta to similar extents (Figure 3G), suggesting that both TAB2 and TAB3 usually restrain the lipid kinase activity of the Beclin 1 complex. Figure 3.Induction of autophagosomes by depletion of TAB2 or TAB3. (A, B) Detection of autophagic GFP–LC3+ puncta. HeLa or U2OS cells stably expressing GFP–LC3 were transfected with siRNAs targeting TAK1, TAB1, TAB2 or TAB3 or with a control siRNA (siUNR). One day later, the subcellular localization and abundance of GFP–LC3 or immunostained TAB2 or TAB3 was determined by epifluorescence microscopy. Representative images are shown in (A) (HeLa cells) and quantitative results (mean values±s.d., n=3; *P<0.01 versus siUNR-transfected cells) are depicted in (B) (U2OS cells). (C) Lipidation of LC3 induced by TAB2 or TAB3 knockdown. Representative immunoblots showing the conversion of non-lipidated LC3 (LC3-I) to its lipidated variant (LC3-II) as well as SQSTM1/p62 protein levels are shown. GAPDH levels were monitored to ensure equal loading. (D, E) Quantification of autophagosomes and autophagolysosomes by transmission electron microscopy. Representative images of HeLa cells transfected with siUNR or with TAB2- or TAB3-targeting siRNAs are shown in (D), and quantitative results are depicted in (E) (mean values±s.d., n=3; *P<0.01 versus siUNR-transfected cells). (F) Epistatic analysis of the effects of TAB2 and TAB3 depletion on autophagy. HeLa cells stably expressing GFP–LC3 were transfected with siRNAs specific for TAB2 or TAB3 and/or with cDNAs coding for full-length HA-tagged TAB2 (HA–TAB2) or TAB3 (HA–TAB3). Twenty-four hours later, the frequency of cells exhibiting >5 GFP–LC3+ cytosolic puncta (GFP–LC3VAC cells) was determined. Results are mean values±s.d. (n=3; *P<0.01 versus siUNR-transfected cells). (G) U2OS cells stably expressing FYVE–RFP were transfected with siUNR, or with siRNAs specific for TAB2, TAB3, VPS34, Beclin 1 (BCN1) and TAK1, in the indicated combinations. Forty-eight hours later, the percentage of cells with RFP–FYVE+ puncta cells was determined. Results are mean values±s.d. (n=3; *P<0.01 versus siUNR-transfected cells). Download figure Download PowerPoint The accumulation of autophagosomes may result from enhanced sequestration of cytoplasmic material (increased on-rate) as well as from reduced removal of autophagosomes by fusion with lysosomes (reduced off-rate). Therefore, we measured autophagosome formation induced by TAB depletion in the absence or presence of bafilomycin A1 (BafA1), which inhibited the colocalization of the autophagic marker GFP–LC3 and the lysosomal marker LAMP2, in accord with its known capacity to block the autophagosome–lysosome fusion (Mizushima et al, 2010) (Figure 4A–C). In the presence of BafA1, the depletion of TAB2 and TAB3 resulted in more GFP–LC3+ puncta than in its absence (Figure 4D). Similar flux determinations were performed in the presence of an alternative lysosomal inhibitor, ammonium chloride, or protease inhibitors (E64d plus pepstatin A) (Supplementary Figure S4). Also, MEFs lacking TAB2 expression due to homologous recombination (Tab2−/−), but neither WT MEFs nor their Tab1−/− counterparts, manifested increased LC3 lipidation, both in the absence and in the presence of BafA1 (Figure 4E). Autophagy induced by TAB2 or TAB3 knockdown followed the canonical pathway, as it was reduced upon depletion of essential autophagy proteins such as Beclin 1, its associated phosphatidylinositol 3-kinase VPS34, ATG5 and ATG7 (Figure 4F). Moreover, it involved the obligatory contribution of TAK1 and that of the three subunits of the IKK complex, as shown by additional experiments of siRNA-mediated knockdown (Figure 4G) or transfection with DN TAK1 (Figure 4H). In conclusion, TAB2 and TAB3 are endogenous inhibitors of the canonical autophagic pathway, which requires the action of kinases from the TAK1-IKK signalling axis. Figure 4.Mechanisms of autophagy induced by depletion of TAB2 or TAB3. (A–D) Impact of bafilomycin A1 (BafA1) on the induction of GFP–LC3+ puncta by TAB2 and TAB3 depletion. HeLa cells stably expressing GFP–LC3 were transfected with a control siRNA (siUNR) or with siRNAs targeting TAB2 and TAB3 for 24 h. During the last 12 h of this period, BafA1 was optionally added. After fixation and permeabilization, LAMP2 was detected by immunofluorescence. Representative confocal microphotographs for the TAB2 siRNA are shown (A), together with the profiles of colocalization of fluorescent signals (B) along the indicated direction (α–ω). Columns in (C) represent the percentage of colocalization of GFP–LC3 and LAMP2 (mean values±s.d.; *P<0.01 versus siUNR-transfected cells), as quantified in at least 50 cells for each condition. The frequency (mean±s.d.) of cells with >5 GFP–LC3+ cytosolic puncta (GFP–LC3VAC cells) is plotted in (D). (E) Impact of BafA1 on LC3 lipidation. MEFs with the indicated genotypes were cultured in complete medium supplemented with BafA1 for 12 h and the proportion of LC3-I/LC3-II was determined by immunoblotting. GAPDH levels were monitored to ensure equal loading. (F, G) Impact of autophagy-relevant proteins and of the TAK1-IKK signalling axis on GFP–LC3 aggregation induced by the depletion of TAB2 or TAB3. HeLa cells stably expressing GFP–LC3 were transfected with siUNR or with siRNAs targeting the indicated proteins, alone or in combination, and 48 h later GFP–LC3VAC cells were quantified (mean values±s.d., n=4; *P<0.01 versus siUNR-transfected cells). (H) Inhibition of autophagy by dominant-negative (DN) TAK1. HeLa cells stably expressing GFP–LC3 were co-transfected with pcDNA3.1 (empty vector) or with plasmids encoding WT (TAK1WT) or a DN TAK1 variant (TAK1K63W) together with the indicated siRNAs for 24 h, followed by the quantification of GFP–LC3VAC cells (mean values±s.d., n=3, *P<0.01 versus siUNR-, pcDNA3.1-transfected cells). Download figure Download PowerPoint Dissociation of TAB2 and TAB3 from Beclin 1 induces autophagy Overexpression of full-length TAB2 or TAB3 inhibited starvation-, rapamycin-}, number={24}, journal={EMBO JOURNAL}, author={Criollo, Alfredo and Niso-Santano, Mireia and Malik, Shoaib Ahmad and Michaud, Mickael and Morselli, Eugenia and Marino, Guillermo and Lachkar, Sylvie and Arkhipenko, Alexander V. and Harper, Francis and Pierron, Gerard and et al.}, year={2011}, month={Dec}, pages={4908–4920} }
 @article{omori_matsumoto_ninomiya-tsuji_2011, title={Non-canonical beta-catenin degradation mediates reactive oxygen species-induced epidermal cell death}, volume={30}, ISSN={["0950-9232"]}, DOI={10.1038/onc.2011.49}, abstractNote={β-Catenin is constantly degraded through the ubiquitin-proteasomal pathway. In this study, we report that a different type of β-catenin degradation is causally involved in epidermal cell death. We observed that reactive oxygen species (ROS) caused β-catenin degradation in the epidermal cells through a caspase-dependent mechanism, which results in disruption of cell adhesion. Disruption of cell adhesion increased ROS and activated caspases. Upregulation of the intact β-catenin blocked ROS accumulation and caspase activation. These results indicate that a feed-forward loop consisting of ROS, caspases activation and β-catenin degradation induces epidermal cell death.}, number={30}, journal={ONCOGENE}, author={Omori, E. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2011}, month={Jul}, pages={3336–3344} }
 @article{omori_matsumoto_zhu_smart_ninomiya-tsuji_2010, title={Ablation of TAK1 Upregulates Reactive Oxygen Species and Selectively Kills Tumor Cells}, volume={70}, ISSN={0008-5472 1538-7445}, url={http://dx.doi.org/10.1158/0008-5472.can-10-1227}, DOI={10.1158/0008-5472.can-10-1227}, abstractNote={Abstract TAK1 kinase activates multiple transcription factors and regulates the level of reactive oxygen species (ROS). We have previously reported that ablation of TAK1 in keratinocytes causes hypersensitivity to ROS-induced cell apoptosis. It is known that some tumor cells produce ROS at higher levels compared with normal cells. We used inducible epidermal-specific TAK1 knockout mice and examined whether ablation of TAK1 in preexisting skin tumors could cause an increase in ROS and result in tumor cell death. Deletion of tak1 gene in skin tumors caused the accumulation of ROS and increased apoptosis, and skin tumors totally regressed within 5 to 10 days. Normal skin did not exhibit any significant abnormality on tak1 gene deletion. Thus, TAK1 kinase could be a new and effective molecular target for ROS-based tumor killing. Cancer Res; 70(21); 8417–25. ©2010 AACR.}, number={21}, journal={Cancer Research}, publisher={American Association for Cancer Research (AACR)}, author={Omori, Emily and Matsumoto, Kunihiro and Zhu, Songyun and Smart, Robert C. and Ninomiya-Tsuji, Jun}, year={2010}, month={Oct}, pages={8417–8425} }
 @article{sakamoto_huang_iwasaki_hailemariam_ninomiya-tsuji_tsuji_2010, title={Regulation of Genotoxic Stress Response by Homeodomain-interacting Protein Kinase 2 through Phosphorylation of Cyclic AMP Response Element-binding Protein at Serine 271}, volume={21}, ISSN={["1939-4586"]}, DOI={10.1091/mbc.e10-01-0015}, abstractNote={CREB (cyclic AMP response element-binding protein) is a stimulus-induced transcription factor that plays pivotal roles in cell survival and proliferation. The transactivation function of CREB is primarily regulated through Ser-133 phosphorylation by cAMP-dependent protein kinase A (PKA) and related kinases. Here we found that homeodomain-interacting protein kinase 2 (HIPK2), a DNA-damage responsive nuclear kinase, is a new CREB kinase for phosphorylation at Ser-271 but not Ser-133, and activates CREB transactivation function including brain-derived neurotrophic factor (BDNF) mRNA expression. Ser-271 to Glu-271 substitution potentiated the CREB transactivation function. ChIP assays in SH-SY5Y neuroblastoma cells demonstrated that CREB Ser-271 phosphorylation by HIPK2 increased recruitment of a transcriptional coactivator CBP (CREB binding protein) without modulation of CREB binding to the BDNF CRE sequence. HIPK2−/− MEF cells were more susceptible to apoptosis induced by etoposide, a DNA-damaging agent, than HIPK2+/+ cells. Etoposide activated CRE-dependent transcription in HIPK2+/+ MEF cells but not in HIPK2−/− cells. HIPK2 knockdown in SH-SY5Y cells decreased etoposide-induced BDNF mRNA expression. These results demonstrate that HIPK2 is a new CREB kinase that regulates CREB-dependent transcription in genotoxic stress.}, number={16}, journal={MOLECULAR BIOLOGY OF THE CELL}, author={Sakamoto, Kensuke and Huang, Bo-Wen and Iwasaki, Kenta and Hailemariam, Kiros and Ninomiya-Tsuji, Jun and Tsuji, Yoshiaki}, year={2010}, month={Aug}, pages={2966–2974} }
 @article{kajino-sakamoto_omori_nighot_blikslager_matsumoto_ninomiya-tsuji_2010, title={TGF-β–Activated Kinase 1 Signaling Maintains Intestinal Integrity by Preventing Accumulation of Reactive Oxygen Species in the Intestinal Epithelium}, volume={185}, ISSN={0022-1767 1550-6606}, url={http://dx.doi.org/10.4049/jimmunol.0903587}, DOI={10.4049/jimmunol.0903587}, abstractNote={The intestinal epithelium is constantly exposed to inducers of reactive oxygen species (ROS), such as commensal microorganisms. Levels of ROS are normally maintained at nontoxic levels, but dysregulation of ROS is involved in intestinal inflammatory diseases. In this article, we report that TGF-β-activated kinase 1 (TAK1) is a key regulator of ROS in the intestinal epithelium. tak1 gene deletion in the mouse intestinal epithelium caused tissue damage involving enterocyte apoptosis, disruption of tight junctions, and inflammation. Disruption of TNF signaling, which is a major intestinal damage inducer, rescued the inflammatory conditions but not apoptosis or disruption of tight junctions in the TAK1-deficient intestinal epithelium, suggesting that TNF is not a primary inducer of the damage noted in TAK1-deficient intestinal epithelium. We found that TAK1 deficiency resulted in reduced expression of several antioxidant-responsive genes and reduced the protein level of a key antioxidant transcription factor NF-E2-related factor 2, which resulted in accumulation of ROS. Exogenous antioxidant treatment reduced apoptosis and disruption of tight junctions in the TAK1-deficient intestinal epithelium. Thus, TAK1 signaling regulates ROS through transcription factor NF-E2-related factor 2, which is important for intestinal epithelial integrity.}, number={8}, journal={The Journal of Immunology}, publisher={The American Association of Immunologists}, author={Kajino-Sakamoto, Rie and Omori, Emily and Nighot, Prashant K. and Blikslager, Anthony T. and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2010}, month={Sep}, pages={4729–4737} }
 @article{broglie_matsumoto_akira_brautigan_ninomiya-tsuji_2010, title={Transforming Growth Factor beta-activated Kinase 1 (TAK1) Kinase Adaptor, TAK1-binding Protein 2, Plays Dual Roles in TAK1 Signaling by Recruiting Both an Activator and an Inhibitor of TAK1 Kinase in Tumor Necrosis Factor Signaling Pathway}, volume={285}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M109.090522}, abstractNote={Transforming growth factor beta-activated kinase 1 (TAK1) kinase is an indispensable signaling intermediate in tumor necrosis factor (TNF), interleukin 1, and Toll-like receptor signaling pathways. TAK1-binding protein 2 (TAB2) and its closely related protein, TAB3, are binding partners of TAK1 and have previously been identified as adaptors of TAK1 that recruit TAK1 to a TNF receptor signaling complex. TAB2 and TAB3 redundantly mediate activation of TAK1. In this study, we investigated the role of TAB2 by analyzing fibroblasts having targeted deletion of the tab2 gene. In TAB2-deficient fibroblasts, TAK1 was associated with TAB3 and was activated following TNF stimulation. However, TAB2-deficient fibroblasts displayed a significantly prolonged activation of TAK1 compared with wild type control cells. This suggests that TAB2 mediates deactivation of TAK1. We found that a TAK1-negative regulator, protein phosphatase 6 (PP6), was recruited to the TAK1 complex in wild type but not in TAB2-deficient fibroblasts. Furthermore, we demonstrated that both PP6 and TAB2 interacted with the polyubiquitin chains and this interaction mediated the assembly with TAK1. Our results indicate that TAB2 not only activates TAK1 but also plays an essential role in the deactivation of TAK1 by recruiting PP6 through a polyubiquitin chain-dependent mechanism.}, number={4}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Broglie, Peter and Matsumoto, Kunihiro and Akira, Shizuo and Brautigan, David L. and Ninomiya-Tsuji, Jun}, year={2010}, month={Jan}, pages={2333–2339} }
 @article{kim_kajino-sakamoto_omori_jobin_ninomiya-tsuji_2009, title={Intestinal Epithelial-Derived TAK1 Signaling Is Essential for Cytoprotection against Chemical-Induced Colitis}, volume={4}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0004561}, abstractNote={Background We have previously reported that intestinal epithelium-specific TAK1 deleted mice exhibit severe inflammation and mortality at postnatal day 1 due to TNF-induced epithelial cell death. Although deletion of TNF receptor 1 (TNFR1) can largely rescue those neonatal phenotypes, mice harboring double deletion of TNF receptor 1 (TNFR1) and intestinal epithelium-specific deletion of TAK1 (TNFR1KO/TAK1IEKO) still occasionally show increased inflammation. This indicates that TAK1 is important for TNF-independent regulation of intestinal integrity. Methodology/Principal Findings In this study, we investigated the TNF-independent role of TAK1 in the intestinal epithelium. Because the inflammatory conditions were sporadically developed in the double mutant TNFR1KO/TAK1IEKO mice, we hypothesize that epithelial TAK1 signaling is important for preventing stress-induced barrier dysfunction. To test this hypothesis, the TNFR1KO/TAK1IEKO mice were subjected to acute colitis by administration of dextran sulfate sodium (DSS). We found that loss of TAK1 significantly augments DSS-induced experimental colitis. DSS induced weight loss, intestinal damages and inflammatory markers in TNFR1KO/TAK1IEKO mice at higher levels compared to the TNFR1KO control mice. Apoptosis was strongly induced and epithelial cell proliferation was decreased in the TAK1-deficient intestinal epithelium upon DSS exposure. These suggest that epithelial-derived TAK1 signaling is important for cytoprotection and repair against injury. Finally, we showed that TAK1 is essential for interleukin 1- and bacterial components-induced expression of cytoprotective factors such as interleukin 6 and cycloxygenase 2. Conclusions Homeostatic cytokines and microbes-induced intestinal epithelial TAK1 signaling regulates cytoprotective factors and cell proliferation, which is pivotal for protecting the intestinal epithelium against injury.}, number={2}, journal={PLOS ONE}, author={Kim, Jae-Young and Kajino-Sakamoto, Rie and Omori, Emily and Jobin, Christian and Ninomiya-Tsuji, Jun}, year={2009}, month={Feb} }
 @article{morioka_omori_kajino_kajino-sakamoto_matsumoto_ninomiya-tsuji_2009, title={TAK1 kinase determines TRAIL sensitivity by modulating reactive oxygen species and cIAP}, volume={28}, ISSN={["1476-5594"]}, DOI={10.1038/onc.2009.110}, abstractNote={TNF-related apoptosis-inducing ligand (TRAIL) is a potent inducer of cell death in several cancer cells, but many cells are resistant to TRAIL. The mechanism that determines sensitivity to TRAIL-killing is still elusive. Here we report that deletion of TAK1 kinase greatly increased activation of caspase-3 and cell death after TRAIL stimulation in keratinocytes, fibroblasts and cancer cells. Although TAK1 kinase is involved in NF-κB pathway, ablation of NF-κB did not alter sensitivity to TRAIL. We found that TRAIL could induce accumulation of reactive oxygen species (ROS) when TAK1 was deleted. Furthermore, we found that TAK1 deletion induced TRAIL-dependent downregulation of cIAP, which enhanced activation of caspase-3. These results show that TAK1 deletion facilitates TRAIL-induced cell death by activating caspase through ROS and downregulation of cIAP. Thus, inhibition of TAK1 can be an effective approach to increase TRAIL sensitivity.}, number={23}, journal={ONCOGENE}, author={Morioka, S. and Omori, E. and Kajino, T. and Kajino-Sakamoto, R. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2009}, month={Jun}, pages={2257–2265} }
 @article{kajino-sakamoto_inagaki_kim_robine_matsumoto_jobin_ninomiya-tsuji_2008, title={203 TAK1 Is Essential for Intestinal Epithelial Cell Survival and Regulates Intestinal Integrity}, volume={134}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(08)60172-9}, DOI={10.1016/S0016-5085(08)60172-9}, number={4}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Kajino-Sakamoto, Rie and Inagaki, Maiko and Kim, Jae-Young and Robine, Sylvie and Matsumoto, Kunihiro and Jobin, Christian and Ninomiya-Tsuji, Jun}, year={2008}, month={Apr}, pages={A-35-A-36} }
 @article{kajino-sakamoto_inagaki_lippert_akira_robine_matsumoto_jobin_ninomiya-tsuji_2008, title={Enterocyte-derived TAK1 signaling prevents epithelium apoptosis and the development of ileitis and colitis}, volume={181}, ISSN={["1550-6606"]}, DOI={10.4049/jimmunol.181.2.1143}, abstractNote={Abstract Recent studies have revealed that TAK1 kinase is an essential intermediate in several innate immune signaling pathways. In this study, we investigated the role of TAK1 signaling in maintaining intestinal homeostasis by generating enterocyte-specific constitutive and inducible gene-deleted TAK1 mice. We found that enterocyte-specific constitutive TAK1-deleted mice spontaneously developed intestinal inflammation as observed by histological analysis and enhanced expression of IL-1β, MIP-2, and IL-6 around the time of birth, which was accompanied by significant enterocyte apoptosis. When TAK1 was deleted in the intestinal epithelium of 4-wk-old mice using an inducible knockout system, enterocytes underwent apoptosis and intestinal inflammation developed within 2–3 days following the initiation of gene deletion. We found that enterocyte apoptosis and intestinal inflammation were strongly attenuated when enterocyte-specific constitutive TAK1-deleted mice were crossed to TNF receptor 1−/− mice. However, these mice later (>14 days) developed ileitis and colitis. Thus, TAK1 signaling in enterocytes is essential for preventing TNF-dependent epithelium apoptosis and the TNF-independent development of ileitis and colitis. We propose that aberration in TAK1 signaling might disrupt intestinal homeostasis and favor the development of inflammatory disease.}, number={2}, journal={JOURNAL OF IMMUNOLOGY}, author={Kajino-Sakamoto, Rie and Inagaki, Maiko and Lippert, Elisabeth and Akira, Shizuo and Robine, Sylvie and Matsumoto, Kunihiro and Jobin, Christian and Ninomiya-Tsuji, Jun}, year={2008}, month={Jul}, pages={1143–1152} }
 @article{inagaki_komatsu_scott_yamada_ray_ninomiya-tsuji_mishina_2008, title={Generation of a conditional mutant allele for Tab1 in mouse}, volume={46}, ISSN={["1526-968X"]}, DOI={10.1002/dvg.20418}, abstractNote={TAK1 binding protein 1 (TAB1) binds and induces autophosphorylation of TGF-beta activating kinase (TAK1). TAK1, a mitogen-activated kinase kinase kinase, is involved in several distinct signaling pathways including non-Smad pathways for TGF-beta superfamily members and inflammatory responses caused by cytokines. Conventional disruption of the murine Tab1 gene results in late gestational lethality showing intraventricular septum defects and underdeveloped lung alveoli. To gain a better understanding of the roles of TAB1 in different tissues, at different stages of development, and in pathological conditions, we generated Tab1 floxed mice in which the loxP sites flank Exons 9 and 10 to remove the C-terminal region of TAB1 protein necessary for activation of TAK1. We demonstrate that Cre-mediated recombination using Sox2-Cre, a Cre line expressed in the epiblast during early embryogenesis, results in deletion of the gene and protein. These homozygous Cre-recombined null embryos display an identical phenotype to conventional null embryos. This animal model will be useful in revealing distinct roles of TAB1 in different tissues at different stages.}, number={8}, journal={GENESIS}, author={Inagaki, Maiko and Komatsu, Yoshihiro and Scott, Greg and Yamada, Gen and Ray, Manas and Ninomiya-Tsuji, Jun and Mishina, Yuji}, year={2008}, month={Aug}, pages={431–439} }
 @article{prickett_ninomiya-tsuji_broglie_muratore-schroeder_shabanowitz_hunt_brautigan_2008, title={TAB4 stimulates TAK1-TAB1 phosphorylation and binds polyubiquitin to direct signaling to NF-kappa B}, volume={283}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.m800943200}, abstractNote={Responses to transforming growth factor β and multiple cytokines involve activation of transforming growth factor β-activated kinase-1 (TAK1) kinase, which activates kinases IκB kinase (IKK) and MKK3/6, leading to the parallel activation of NF-κB and p38 MAPK. Activation of TAK1 by autophosphorylation is known to involve three different TAK1-binding proteins (TABs). Here we report a protein phosphatase subunit known as type 2A phosphatase-interacting protein (TIP) that also acts as a TAB because it co-precipitates with and directly binds to TAK1, enhances TAK1 autophosphorylation at unique sites, and promotes TAK1 phosphorylation of IKKβ and signaling to NF-κB. Mass spectrometry demonstrated that co-expression of TAB4 protein significantly increased phosphorylation of four sites in TAK1, in a linker region between the kinase and TAB2/3 binding domains, and two sites in TAB1. Recombinant GST-TAB4 bound in an overlay assay directly to inactive TAK1 and activated TAK1 but not TAK1 phosphorylated in the linker sites, suggesting a bind and release mechanism. In kinase assays using TAK1 immune complexes, added GST-TAB4 selectively stimulated IKK phosphorylation. TAB4 co-precipitated polyubiquitinated proteins dependent on a Phe-Pro motif that was required to enhance phosphorylation of TAK1. TAB4 mutated at Phe-Pro dominantly interfered with IL-1β activation of NF-κB involving IKK-dependent but not p38 MAPK-dependent signaling. The results show that TAB4 binds TAK1 and polyubiquitin chains to promote specific sites of phosphorylation in TAK1-TAB1, which activates IKK signaling to NF-κB. Responses to transforming growth factor β and multiple cytokines involve activation of transforming growth factor β-activated kinase-1 (TAK1) kinase, which activates kinases IκB kinase (IKK) and MKK3/6, leading to the parallel activation of NF-κB and p38 MAPK. Activation of TAK1 by autophosphorylation is known to involve three different TAK1-binding proteins (TABs). Here we report a protein phosphatase subunit known as type 2A phosphatase-interacting protein (TIP) that also acts as a TAB because it co-precipitates with and directly binds to TAK1, enhances TAK1 autophosphorylation at unique sites, and promotes TAK1 phosphorylation of IKKβ and signaling to NF-κB. Mass spectrometry demonstrated that co-expression of TAB4 protein significantly increased phosphorylation of four sites in TAK1, in a linker region between the kinase and TAB2/3 binding domains, and two sites in TAB1. Recombinant GST-TAB4 bound in an overlay assay directly to inactive TAK1 and activated TAK1 but not TAK1 phosphorylated in the linker sites, suggesting a bind and release mechanism. In kinase assays using TAK1 immune complexes, added GST-TAB4 selectively stimulated IKK phosphorylation. TAB4 co-precipitated polyubiquitinated proteins dependent on a Phe-Pro motif that was required to enhance phosphorylation of TAK1. TAB4 mutated at Phe-Pro dominantly interfered with IL-1β activation of NF-κB involving IKK-dependent but not p38 MAPK-dependent signaling. The results show that TAB4 binds TAK1 and polyubiquitin chains to promote specific sites of phosphorylation in TAK1-TAB1, which activates IKK signaling to NF-κB. Inflammatory cytokines tumor necrosis factor α and IL-1β activate cellular pathways involved in cell proliferation and apoptosis. IL-1β binding to its cognate receptor IL-1R induces recruitment of MyD88, IRAK1, IRAK4, and TRAF6 (1Martin M.U. Wesche H. Biochim. Biophys. Acta. 2002; 1592: 265-280Crossref PubMed Scopus (337) Google Scholar). IRAK4 functions in this complex to phosphorylate IRAK1, thereby triggering release of IRAK1 and TRAF6 into the cytoplasm and subsequent activation of IKK, 2The abbreviations used are: IKK, IκB kinase; MAPK, mitogen-activated protein kinase; TAK1, transforming growth factor β-activated kinase-1; TAB, TAK1-binding protein; TIP, type 2A phosphatase-interacting protein; GST, glutathione S-transferase; E2, ubiquitin carrier protein; E3, ubiquitin-protein isopeptide ligase; PP, protein phosphatase; HA, hemagglutinin; MOPS, 4-morpholinepropanesulfonic acid; MBP, myelin basic protein; wt, wild type; FP-AA, F254A/P255A; NF-κB, nuclear factor-κB. 2The abbreviations used are: IKK, IκB kinase; MAPK, mitogen-activated protein kinase; TAK1, transforming growth factor β-activated kinase-1; TAB, TAK1-binding protein; TIP, type 2A phosphatase-interacting protein; GST, glutathione S-transferase; E2, ubiquitin carrier protein; E3, ubiquitin-protein isopeptide ligase; PP, protein phosphatase; HA, hemagglutinin; MOPS, 4-morpholinepropanesulfonic acid; MBP, myelin basic protein; wt, wild type; FP-AA, F254A/P255A; NF-κB, nuclear factor-κB. c-Jun N-terminal kinase (JNK), and p38 MAPK (2Sakurai H. Shigemori N. Hasegawa K. Sugita T. Biochem. Biophys. Res. Commun. 1998; 243: 545-549Crossref PubMed Scopus (89) Google Scholar, 3Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar). The IKK complex consists of IKKα and IKKβ, the two catalytic subunits, and the regulatory subunit IKKγ (known as NEMO), which binds polyubiquitin chains and is ubiquitinated itself (4Pomerantz J.L. Baltimore D. Mol. Cell. 2002; 10: 693-695Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar). It is proposed that polyubiquitin chains act as a scaffold to allow for assembly of a signaling complex (5Crosetto N. Bienko M. Dikic I. Mol. Cancer Res. 2006; 4: 899-904Crossref PubMed Scopus (15) Google Scholar, 6Mukhopadhyay D. Riezman H. Science. 2007; 315: 201-205Crossref PubMed Scopus (955) Google Scholar). Genetic studies have implicated IKKβ and IKKγ in regulating activation of nuclear factor-κB (NF-κB) via phosphorylation of IκB and its subsequent degradation by the 26 S proteasome (7Perkins N.D. Nat. Rev. Mol. Cell Biol. 2007; 8: 49-62Crossref PubMed Scopus (1927) Google Scholar). Activation of IKK involves two complexes called TRIKA1 and TRIKA2 (8Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1633) Google Scholar, 9Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar). The first complex, TRIKA1, contains Ubc13/Uev1A (an E2 conjugating enzyme) and TRAF6 (an E3 ligase) (8Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1633) Google Scholar, 9Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar). The second complex, TRIKA2, contains TAK1, TAB1 (TAK1 activator), and TAB2/3 (ubiquitin-binding proteins) (8Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1633) Google Scholar, 9Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar). TRAF6 functions with Ubc13/Uev1A to catalyze the addition of polyubiquitin chains to TRAF6 and possibly other proteins via Lys63 linkages in ubiquitin (8Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1633) Google Scholar, 9Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar, 10Deng L. Wang C. Spencer E. Yang L. Braun A. You J. Slaughter C. Pickart C. Chen Z.J. Cell. 2000; 103: 351-361Abstract Full Text Full Text PDF PubMed Scopus (1504) Google Scholar). TAK1 is activated by TAK1-binding proteins (TABs). TAB1 binds TAK1 and promotes autophosphorylation of the activation loop (11Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (519) Google Scholar, 12Sakurai H. Miyoshi H. Mizukami J. Sugita T. FEBS Lett. 2000; 474: 141-145Crossref PubMed Scopus (141) Google Scholar, 13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar, 14Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). TAB2 and TAB3 activate TAK1 indirectly by binding polyubiquitinated proteins, possibly stabilizing a larger complex (15Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar, 16Kishida S. Sanjo H. Akira S. Matsumoto K. Ninomiya-Tsuji J. Genes Cells. 2005; 10: 447-454Crossref PubMed Scopus (72) Google Scholar, 17Kanayama A. Seth R.B. Sun L. Ea C.K. Hong M. Shaito A. Chiu Y.H. Deng L. Chen Z.J. Mol. Cell. 2004; 15: 535-548Abstract Full Text Full Text PDF PubMed Scopus (696) Google Scholar, 18Besse A. Lamothe B. Campos A.D. Webster W.K. Maddineni U. Lin S.C. Wu H. Darnay B.G. J. Biol. Chem. 2007; 282: 3918-3928Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 19Cheung P.C. Nebreda A.R. Cohen P. Biochem. J. 2004; 378: 27-34Crossref PubMed Scopus (134) Google Scholar). TAK1 associates with and is inactivated by multiple protein-Ser/Thr phosphatases, including different isoforms of the MPP phosphatases previously called PP2C (20Li M.G. Katsura K. Nomiyama H. Komaki K. Ninomiya-Tsuji J. Matsumoto K. Kobayashi T. Tamura S. J. Biol. Chem. 2003; 278: 12013-12021Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 21Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 22Hanada M. Ninomiya-Tsuji J. Komaki K. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar) as well as by protein phosphatase 6 (PP6), which dephosphorylates Thr187 in the activation loop of TAK1 (21Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). Our interest in PP6 raised a question about inactivation of TAK1. Studies of the TOR pathway in yeast led to the discovery of Tap42, a protein that binds all of the yeast type 2A phosphatases: Sit4 (PP6), Pph3, and Pph21/22 (PP2A) (23Di Como C.J. Arndt K.T. Genes Dev. 1996; 10: 1904-1916Crossref PubMed Scopus (440) Google Scholar). However, Tap42 action on phosphatases is not understood and is controversial. One group claims Tap42 is phosphorylated directly by TOR to increase Tap42 binding to Pph21/22 or Sit4 (24Duvel K. Broach J.R. Curr. Top. Microbiol. Immunol. 2004; 279: 19-38PubMed Google Scholar, 25Jiang Y. Broach J.R. EMBO J. 1999; 18: 2782-2792Crossref PubMed Scopus (274) Google Scholar). Another group suggests that Tap42 is restricted from binding to phosphatases by instead binding a protein called Tip41 (Tap42-interacting protein of 41 kDa) and that the Tip41-Tap42 complex is disrupted by TOR phosphorylation of Tip41 (26Jacinto E. Guo B. Arndt K.T. Schmelzle T. Hall M.N. Mol. Cell. 2001; 8: 1017-1026Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar). Yet a third scenario arose when it was reported that yeast Tip41 interacted with yeast phosphatases Pph21/22 and Pph3 in a two-hybrid assay (27Gingras A.C. Caballero M. Zarske M. Sanchez A. Hazbun T.R. Fields S. Sonenberg N. Hafen E. Raught B. Aebersold R. Mol. Cell. Proteomics. 2005; 4: 1725-1740Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). While our work was in progress another group published that the human orthologue of yeast Tip41 called type 2A phosphatase-interacting protein (TIP) binds human PP2A, PP4, and PP6 (28McConnell J.L. Gomez R.J. McCorvey L.R. Law B.K. Wadzinski B.E. Oncogene. 2007; 26: 6021-6030Crossref PubMed Scopus (64) Google Scholar). Thus, type 2 phosphatases, including PP6, can bind to yeast and human orthologues of both Tap42 (α-4Pomerantz J.L. Baltimore D. Mol. Cell. 2002; 10: 693-695Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar) and Tip41 (TIP). We showed that the human version of Tap42 called α-4 acts as a targeting subunit for PP2A, binding to MEK3 to promote selective dephosphorylation of one of two sites in the activation loop in that way opposing activation of p38 MAPK by cytokines (29Prickett T.D. Brautigan D.L. Mol. Cell. Biol. 2007; 27: 4217-4227Crossref PubMed Scopus (47) Google Scholar). Here because of the relationship to PP6 we investigated the function of the human TIP protein (NP_690866) relative to TAK1 and discovered properties that qualify this protein as a TAB and led us to call it TAB4. We show that, like TAB1, TAB4 directly binds and activates TAK1 by inducing autophosphorylation of TAK1. The activated TAK1 phosphorylates TAB1 and shows specificity toward the endogenous substrate IKKβ.A Phe-Pro sequence motif found in TAB2/3 is present in the C-terminal region of TAB4. Mutation of Phe254 and Pro255 in TAB4 eliminated binding of polyubiquitinated proteins and activation and phosphorylation of TAK1 and TAB1 without reduction in PP6 binding. These mutations separate multiple functions of TAB4. We propose that TAB4 is a multifunctional protein that promotes the activation of NF-κB using separate domains that bind TAK1 and polyubiquitin chains. cDNA Constructs, Plasmids, and Antibodies—Full-length human TAB4 was cloned downstream of GST in pGEX-4T2 using BamHI and EcoRI restriction sites for production of recombinant protein in bacteria. Recombinant GST-TAB4 was used to raise polyclonal antibodies in rabbits. Antibodies were purified using a two-step procedure. 1) GST-conjugated Affi-Gel-15 was used to preclear anti-GST antibodies followed by 2) purification with GST-TAB4-conjugated Affi-Gel-15 using 0.1 m glycine elution-2 m Tris-HCl neutralization as described in the manufacturer's protocol (Bio-Rad). TAB4 was also cloned downstream of HA epitope tag (pKHA vector) and FLAG epitope tag (pcDNA3-FLAG2 vector) using BamHI and EcoRI for expression in mammalian cells. Site-directed mutagenesis of TAB4 was done following the manufacturers' protocol. FLAG-TAK1, HA-TAK1, HA-TAK1(K63W), FLAG-TAB1, and T7-TAB1 were described previously (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar). FLAG-Ub vector was a kind gift from Dr. David Wotton at the University of Virginia. Antibodies (dilutions) used in this study are as follows: anti-FLAG (1:3,000) (Sigma-Aldrich), anti-HA (1:5,000) (12CA5), anti-T7 (1:10,000) (Novagen), anti-PP6 (1:5,000) (30Stefansson B. Brautigan D.L. J. Biol. Chem. 2006; 281: 22624-22634Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar), anti-(Thr(P)184/Thr(P)187) TAK1 (1:1,000) and anti-(Ser(P)177/Ser(P)181) IKKβ (1:1,000) (Cell Signaling Technology Inc.), anti-GST and anti-TAB4 (1:5,000) (described above), and anti-(Ser(P)187) MEK3/(Ser(P)207) MEK6 (1:1,000) (Santa Cruz Biotechnology, Inc.). Cell Culture, Transfection, Immunoprecipitation, and Pulldown Assays—HEK293, HEK293T, and 293IL-1R1 cells were grown in Dulbecco's modified Eagle's medium and 10% fetal bovine serum at 37 °C in a humidified incubator with 5% CO2. HEK293T cells were transfected using Arrest-In (Open Biosystems) as suggested by the manufacturer. In every case, HEK293T cells were seeded into 10-cm dishes at ∼40% confluence the day before transfection. Cells were transfected using ∼5 μg of plasmid for each construct and incubated for 24–48 h before harvesting. Cell extracts were made using a 1% Nonidet P-40 (Igepal CA-630, Sigma) lysis buffer (1% Nonidet P-40, 50 mm MOPS, pH 7.4, 150 mm NaCl, 1 μm microcystin-LR (Alexis Biochemicals), 1 mm sodium orthovanadate, 1 mm sodium fluoride, 1 mm Pefabloc, 1 mg/ml leupeptin, 1 mg/ml pepstatin, 1 mm dithiothreitol). Extracts were immunoprecipitated using either anti-FLAG M2 beads (Sigma-Aldrich), anti-HA beads (Sigma-Aldrich), or anti-TAB4 bound to protein A-agarose (Amersham Biosciences). Immunoprecipitations and pulldowns were done using approximately the same volume of extracts with 10–15 μl of a 50% slurry of anti-FLAG, anti-HA, and microcystin-LR-agarose beads. Immunoprecipitations and pulldowns were incubated at 4 °C for 2 h and then washed with Nonidet P-40 buffer two to three times. Complexes were eluted using 35 μl of 2× SDS sample buffer and boiled for 5 min. Extracts and immunoprecipitates were analyzed by immunoblotting using the antibodies described earlier and the LI-COR Odyssey infrared scanner and software. Recombinant λ-Phosphatase Treatment—HEK293T cells were transfected with 1) FLAG-TAK1 and T7-TAB1 or 2) FLAG-TAK1 and T7-TAB1 plus HA-TAB4, and extracts were made with RIPA buffer (1% Nonidet P-40, 0.25% sodium deoxycholate, 0.1% SDS, 50 mm MOPS, pH 7.4, 150 mm NaCl, 1 mm EDTA, 1 μm microcystin-LR, 1 mm sodium orthovanadate, 1 mm sodium fluoride, 20 mm β-glycerophosphate, 1 mm Pefabloc, 1 mg/ml leupeptin, 1 mg/ml pepstatin, 1 mm dithiothreitol). Immunoprecipitates were collected after 2 h at 4 °C and washed three times with RIPA buffer followed by two washes with 50 mm Tris-HCl, pH 7.5, 0.1 mm EDTA, 2 mm MnCl2, 5 mm dithiothreitol (λ-phosphatase buffer). Immunoprecipitates were taken up in 30 ml of λ-phosphatase buffer and treated with 0, 0.2, or 1 μl of MBP-λ-phosphatase (∼8,330 units/mg) for 2 h at 30 °C. Samples were then analyzed by SDS-PAGE and immunoblotted to detect mobility shifts of TAK1 and/or TAB1. Far-Western (Overlay) Assay—HEK293T cells were transfected with 1) FLAG-TAK1, 2) FLAG-TAK1 and T7-TAB1, 3) FLAG-TAK1 and T7-TAB1 plus HA-TAB4, or 4) empty vector control. Extracts were made using RIPA buffer and immunoprecipitated using anti-FLAG beads for 2 h at 4 °C. Immunoprecipitates were washed three times with RIPA buffer, eluted with 35 μl of 2× SDS sample buffer, and boiled for 5 min. Proteins were resolved by SDS-PAGE and transferred to nitrocellulose. Membranes were blocked in 1% blocking buffer (1% bovine serum albumin in Tris-buffered saline/Tween 20) for 2 h. Probes were diluted in 1% blocking buffer at a concentration of 5 mg/ml and incubated overnight at 4 °C. Membranes were washed two to three times with 1× phosphate-buffered saline for 1–2 min followed by fixation using 0.5% paraformaldehyde for 30 min at room temperature. Membranes were then rinsed quickly twice with 1× phosphate-buffered saline and quenched using 2% glycine in phosphate-buffered saline for 10 min at room temperature. The membrane was incubated with anti-GST plus secondary antibody and analyzed using the LI-COR Odyssey system and software. FLAG-Ub Binding Assay—HEK293T cells were transfected with HA-TAB4(wt), HA-TAB4(F254A), or HA-TAB4(FP-AA) or empty vector control along with FLAG-Ub. Extracts were prepared using 1% Nonidet P-40 lysis buffer described above and immunoprecipitated using anti-HA beads for 2 h at 4 °C and washed 2–3 times with Nonidet P-40 buffer. HA-FLAG complexes were eluted using 35 μl 2X SDS sample buffer and boiled for 5 min. Samples were analyzed by SDS-PAGE and immunoblotted with anti-FLAG and anti-HA. Immunoblots were analyzed using the LI-COR Odyssey system and software. In Vitro TAK1 Kinase Assay with MKK6 or IKKβ—HEK293T cells were transfected with 1) FLAG-TAK1, 2) FLAG-TAK1 and T7-TAB1, or 3) FLAG-TAK1 and T7-TAB1 plus either HA-TAB4(wt), 4) HA-TAB4(F254A), or 5) HA-TAB4(FP-AA). Extracts were prepared using a 1% Nonidet P-40 lysis buffer described above and immunoprecipitated using anti-FLAG beads. Immunoprecipitates were collected after 2 h at 4 °C, washed two to three times with Nonidet P-40 buffer, and then washed twice in 20 mm Tris-HCl, pH 7.5, 500 mm NaCl, 10 mm MgCl2. Immunoprecipitates were taken up in 30 ml of 20 mm Tris-HCl, pH 7.5, 10 mm MgCl2. Kinase assays were done using 1 μg of recombinant His6-MKK6 or GST-IKKβ (Upstate-Chemicon), 5 μl of immunoprecipitate, 2 μl of 5× kinase buffer (50 mm Tris-HCl, pH 7.5, 5 mm dithiothreitol, 25 mm MgCl2), 5 μCi of [γ-32P]ATP at 30 °C for 2 min. Kinase reactions were stopped by adding an equal volume of 2× SDS sample buffer and resolved by SDS-PAGE followed by staining with Gel-Code Blue (Pierce) to visualize bands. Bands corresponding to His6-MKK6 or GST-IKKβ were excised from the stained gel, and 32P was analyzed using a liquid scintillation counter. NF-κB Luciferase Assays—HEK293T cells were seeded at 30–40% confluence in 12-well dishes and transfected 16 h later with 100 ng of F254A, FP-AA, or empty vector plus 100 ng of NF-κB firefly luciferase and 10 ng of Renilla luciferase vectors or with 100 ng of FLAG-TAB4(wt) or empty vector and HA-TAK1(wt) or HA-TAK1(K63W) plus 100 ng of NF-κB luciferase and 10 ng of Renilla vectors. Cells were incubated for 16 h before changing the medium to serum-free conditions (0.5% fetal bovine serum, Dulbecco's modified Eagle's medium) for the remainder of the experiment. Cells were pretreated with curcumin or SB203580 for 30 min prior to stimulation for 6 h with 10 ng/ml IL-1β or vehicle alone. Cells were harvested and analyzed as described previously (29Prickett T.D. Brautigan D.L. Mol. Cell. Biol. 2007; 27: 4217-4227Crossref PubMed Scopus (47) Google Scholar) to test for luciferase activities in extracts. TAB4 Enhances Activation of TAK1-TAB1—The human protein NP_690866 has been reported to bind protein phosphatase catalytic subunits PP2A, PP4, and PP6 (27Gingras A.C. Caballero M. Zarske M. Sanchez A. Hazbun T.R. Fields S. Sonenberg N. Hafen E. Raught B. Aebersold R. Mol. Cell. Proteomics. 2005; 4: 1725-1740Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar, 28McConnell J.L. Gomez R.J. McCorvey L.R. Law B.K. Wadzinski B.E. Oncogene. 2007; 26: 6021-6030Crossref PubMed Scopus (64) Google Scholar) and is referred to as TIP. We found that TIP bound type 2 phosphatases in a yeast two-hybrid assay and noted that it showed preferential binding to the C-terminal region of PP6 (residues 177–305) compared with PP2A. Because PP6 dephosphorylates and inactivates TAK1 kinase (21Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar), we tested whether overexpression of this PP6-binding protein (which we called TAB4) would affect TAK1. Activation of TAK1 and its substrate IKKβ were assayed in whole cell extracts by immunoblotting with phosphosite-specific antibodies (Fig. 1A). Neither TAK1 nor IKKβ were phosphorylated in cells transfected with FLAG-TAK1 alone (lane 1) or T7-TAB1 alone (lane 2). However, cells co-expressing FLAG-TAK1 with T7-TAB1 exhibited phospho-TAK1, with retarded migration of the FLAG-TAK1, and increased phosphorylation of endogenous IKKβ (lane 3). Compared with this, co-expression with HA-TAB4 (lane 6) caused more reduced migration of FLAG-TAK1 and greatly increased the phosphorylation of endogenous IKKβ at Ser177/Ser181 with appearance of multiple IKK bands presumably due to other sites of phosphorylation. Co-expression of TAB4 with either FLAG-TAK1 alone (lane 4) or T7-TAB1 alone (lane 5) as controls did not induce phosphorylation of either TAK1 or IKKβ. This shows TAB1 dependence of TAK1 activation by TAB4, the same as for activation of TAK1 by TAB2/3. The effects were specific for TAB4 and not mimicked by overexpression of another PP2A/PP4/PP6-binding protein, α-4 (Fig. 1A). HA-α-4 was expressed with FLAG-TAK1 (lane 7) or T7-TAB1 (lane 8) but produced no increase in phospho-TAK1, no gel shift of FLAG-TAK1, and no detectable phospho-IKKβ. Triple expression of HA-α-4, FLAG-TAK1, and T7-TAB1 (lane 9) was no different from dual expression of FLAG-TAK1 and T7-TAB1 (lane 3). The level of HA-α-4 expressed in these controls was even higher than the levels of HA-TAB4 in parallel samples based on anti-HA immunoblotting (Fig. 2A, lanes 4–6 and 7–9). Together these results showed that TAB4 expression enhanced TAB1-dependent TAK1 phosphorylation and TAK1 activity toward the endogenous substrate IKKβ.FIGURE 2Phosphorylation sites in TAK1 and TAB1. Phosphorylation sites in TAK1 (top) and TAB1 (bottom) are shown as vertical lines, and those sites significantly increased by co-expression of TAB4 are indicated with a P above the boxes. The kinase domain with three sites of activating phosphorylation and the TAB2/3 binding region in TAK1 and the PP2C-like domain and TAK1 binding domain in TAB1 are shown as hatched boxes within the entire sequence. TGFβ, transforming growth factor β.View Large Image Figure ViewerDownload Hi-res image Download (PPT) TAB4 Significantly Increases Multiple Sites of Phosphorylation in TAK1 and TAB1—The reduced mobility of FLAG-TAK1 and T7-TAB1 in SDS-PAGE was due to phosphorylation that was induced by TAB4 and reversed by λ-phosphatase (Fig. 1B). FLAG-TAK1 and T7-TAB1 were expressed in HEK293T cells with and without HA-TAB4, and complexes were immunoprecipitated using anti-FLAG M2 beads. Immunoblotting with anti-FLAG and anti-T7 showed reduced mobility of both TAK1 and TAB1 proteins due to TAB4 co-expression (Fig. 1B; also see Fig. 3A below). Incubation of immunoprecipitates with increasing amounts of recombinant λ-phosphatase-MBP fusion protein dephosphorylated both FLAG-TAK1 and T7-TAB1 as evident from their increased mobility (Fig. 1B). After dephosphorylation by MBP-λ-phosphatase the FLAG-TAK1 and T7-TAB1 had the same mobility whether they originated from cells expressing or not expressing TAB4. This demonstrated that the extra reduced mobility of TAK1 and TAB1 during co-expression with TAB4 was due to phosphorylation. We noted that migration of TAB4 itself in SDS-PAGE was not affected by co-expression with TAK1-TAB1 or incubation with MBP-λ-phosphatase, suggesting that it was not phosphorylated. The results demonstrate that TAB4 increased phosphorylation and kinase activity of TAK1-TAB1 complexes. Phosphorylation sites in both TAK1 and TAB1 induced by co-expression of TAB4 were mapped by mass spectrometry. Cells were transfected to express TAK1-TAB1 with and without TAB4, FLAG-TAK1 complexes were immunoprecipitated, and the tryptic peptides were analyzed by a linear quadrupole ion trap-Fourier transform mass spectrometer (ThermoScientific) (Table 1). A total of at least 16 phosphorylation sites were identified in FLAG-TAK1, including the well known sites at Thr184, Thr187, and Ser192 in the kinase activation loop (Fig. 2). Phosphorylation of 14 sites in T7-TAB1 were identified. Co-expression of TAB4 induced a significant increase (>5-fold) in phosphorylation of at least four sites in TAK1: 1) residue Thr344 in peptide residues 331–347; 2) peptide 373–386 with residues Ser374, Ser375, and Ser382; 3) peptide 388–398 containing residues Ser389 and Ser393; and 4) peptide 412–429 containing residues Ser412, Thr421, and Ser428. These all mapped to a region C-terminal to the kinase domain (Fig. 2). Likewise co-expression of TAB4 significantly increased at least two sites of phosphorylation in TAB1: 1) peptide 364–386 containing phosphorylated residues Ser273 and Ser278 and 2) peptide 464–477 phosphorylated at residue Ser464 or Ser469. Thus, TAB4 co-expression significantly increased phosphorylation of specific sites in both TAK1 and TAB1.TABLE 1Phosphopeptide analysis of TAK1 and TAB1 by mass spectrometrySitesPeptidesaPeptides with significantly increased phosphorylation (>5-fold) determined by peak area from co-expression of TAB4 are in boldface font.SequencebListing of TAK1 and TAB1 phosphopeptides detected in single letter code. Confirmed phosphorylation sites (phosphoserine (pS) or phosphothreonine (pT)) are in boldface font. “p()” indicates that a phosphorylation site is located within the parentheses but could not be defined further by the observed fragmentation.FLAG-TAK1 Thr184 or Thr187173-190ICDFGTACDIQp (THMT) NNK Thr184 and Thr187ICDFGTACDIQpTHMpTNNK triplephos (Thr178 or Thr184 or Thr187 or Ser192)173-209ICDFGppp (TACDIQTHMTNNKGS) AAWMAPEVFEGSNYSEK Thr344331-347SDTNMEQVPATNDpTIKR Ser374 or Ser375373-386cCoelution of more than one phosphorylated form of the peptide collectively contributed to the increased abundance.Gp (SS) VESLPPTSEGK Thr382GSSVESLPPpTSEGK Ser389388-398cCoelution of more than one phosphorylated form of the peptide collectively contributed to the increased abundance.MpSADMSEIEAR Ser393MSADMpSEIEAR Thr402399-409IVApTAGNGQPR Ser412 and (Thr419 or Thr421) and (Ser427 or Ser428)410-429RRpSIQDLTVp (TGT) EPGQVp (SS) R Ser412412-429pSIQDLTVTGTEPGQVSSR Ser412 and Thr421412-429cCoelution of more than one phosphorylated form of the peptide collectively contributed to the increased abundance.pSIQDLTVTGpTEPGQVSSR Ser412 and Ser428pSIQDLTVTGTEPGQVSpSR Thr440437-450MIpTTSGPTSEKPAR Thr444 or Ser445MITTSGPp (TS) EKPAR Thr440 and (Thr444 or Ser445)MIpTTSGPp (TS) EKPAR Thr537520-539KQELVAELDQDEKDQQNpTSRT7-TAB1 Ser77-35pSLLQSEQQPSWTDDLPLCHLSGVGSASNR Ser16 or Thr18SLLQSEQQPp (SWT) DDLPLCHLSGVGSASNR Ser7 and Ser16pSLLQSEQQPpSWTDDLPLCHLSGVGSASNR Ser7 and Thr18pSLLQSEQQPSWpTDDLPLCHLSGVGSASNR Thr4436-55SYSADGKGpTESHPPEDSWLK Ser120116-128SFLEpSIDDALAEK Ser263 or Thr282263-294p (SKPIIAEPEIHGAQPLDGVT) GFLVLMSEGLYK Ser344337-348IHSDTFApSGGER Ser373364-386cCoelution of more than one phosphorylated form of the peptide collectively contributed to the increased abundance.NFGYPLGEMpSQPTPSPAPAAGGR Ser378NFGYPLGEMSQPTPpSPAPAAGGR Ser373 and Ser378NFGYPLGEMpSQPTPpSPAPAAGGR Ser396387-402VYPVSVPYSpSAQSTSK Ser399, Thr400, or Ser401VYPVSVPYSSAQp (STS) K Ser396 and (Ser399 or Thr400 or Ser401)VYPVSV}, number={28}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Prickett, Todd D. and Ninomiya-Tsuji, Jun and Broglie, Peter and Muratore-Schroeder, Tara L. and Shabanowitz, Jeffrey and Hunt, Donald F. and Brautigan, David L.}, year={2008}, month={Jul}, pages={19245–19254} }
 @article{kim_omori_matsumoto_nunez_ninomiya-tsuji_2008, title={TAK1 is a central mediator of NOD2 signaling in epidermal cells}, volume={283}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M704746200}, abstractNote={Muramyl dipeptide (MDP) is a peptidoglycan moiety derived from commensal and pathogenic bacteria, and a ligand of its intracellular sensor NOD2. Mutations in NOD2 are highly associated with Crohn disease, which is characterized by dysregulated inflammation in the intestine. However, the mechanism linking abnormality of NOD2 signaling and inflammation has yet to be elucidated. Here we show that transforming growth factor beta-activated kinase 1 (TAK1) is an essential intermediate of NOD2 signaling. We found that TAK1 deletion completely abolished MDP-NOD2 signaling, activation of NF-kappaB and MAPKs, and subsequent induction of cytokines/chemokines in keratinocytes. NOD2 and its downstream effector RICK associated with and activated TAK1. TAK1 deficiency also abolished MDP-induced NOD2 expression. Because mice with epidermis-specific deletion of TAK1 develop severe inflammatory conditions, we propose that TAK1 and NOD2 signaling are important for maintaining normal homeostasis of the skin, and its ablation may impair the skin barrier function leading to inflammation.}, number={1}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Kim, Jae-Young and Omori, Emily and Matsumoto, Kunihiro and Nunez, Gabriel and Ninomiya-Tsuji, Jun}, year={2008}, month={Jan}, pages={137–144} }
 @article{omori_morioka_matsumoto_ninomiya-tsuji_2008, title={TAK1 regulates reactive oxygen species and cell death in keratinocytes, which is essential for skin integrity}, volume={283}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M804513200}, abstractNote={Mice with a keratinocyte-specific deletion of Tak1 exhibit severe skin inflammation due to hypersensitivity to tumor necrosis factor (TNF) killing. Here we have examined the mechanisms underlying this hypersensitivity. We found that TAK1 deficiency up-regulates reactive oxygen species (ROS) resulting in cell death upon TNF or oxidative stress challenge. Because blockade of NF-κB did not increase ROS or did not sensitize cells to oxidative stress in keratinocytes TAK1 regulates ROS mainly through the mechanisms other than those mediated by NF-κB. We found that c-Jun was decreased in TAK1-deficient keratinocytes and that ectopic expression of c-Jun could partially inhibit TNF-induced increase of ROS and cell death. Finally, we show that, in an in vivo setting, the antioxidant treatment could reduce an inflammatory condition in keratinocyte-specific Tak1 deletion mice. Thus, TAK1 regulates ROS partially through c-Jun, which is important for preventing ROS-induced skin inflammation. Mice with a keratinocyte-specific deletion of Tak1 exhibit severe skin inflammation due to hypersensitivity to tumor necrosis factor (TNF) killing. Here we have examined the mechanisms underlying this hypersensitivity. We found that TAK1 deficiency up-regulates reactive oxygen species (ROS) resulting in cell death upon TNF or oxidative stress challenge. Because blockade of NF-κB did not increase ROS or did not sensitize cells to oxidative stress in keratinocytes TAK1 regulates ROS mainly through the mechanisms other than those mediated by NF-κB. We found that c-Jun was decreased in TAK1-deficient keratinocytes and that ectopic expression of c-Jun could partially inhibit TNF-induced increase of ROS and cell death. Finally, we show that, in an in vivo setting, the antioxidant treatment could reduce an inflammatory condition in keratinocyte-specific Tak1 deletion mice. Thus, TAK1 regulates ROS partially through c-Jun, which is important for preventing ROS-induced skin inflammation. Tumor necrosis factor (TNF) 2The abbreviations used are: TNFtumor necrosis factorBHAbutylated hydroxyanisolec-FLIPcellular FADD-like interleukin-1β-converting enzyme inhibitory proteinFADDFas-associated death domainMEFmouse embryonic fibroblastsROSreactive oxygen speciestBHPtertbutyl hydroperoxideMnSODmanganese superoxide dismutaseJNKc-Jun NH2-terminal kinaseCREBcAMP-response element-binding protein4-OHT4-hydroxytamoxifenCM-H2DCFDA5 (6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester. plays a central role in inflammation, and also regulates cell death and survival (1Aggarwal B.B. Nat. Rev. Immunol. 2003; 3: 745-756Crossref PubMed Scopus (2166) Google Scholar, 2Karin M. Lin A. Nat. Immunol. 2002; 3: 221-227Crossref PubMed Scopus (2452) Google Scholar, 3Ashkenazi A. Nat. Rev. Cancer. 2002; 2: 420-430Crossref PubMed Scopus (1109) Google Scholar). TNF initiates intracellular signaling by binding to its receptor, initiating the formation of the TNF receptor complex, which consists of several proteins including RIP1 kinase, Fas-associated death domain (FADD), and pro-caspase-8 (also called FLICE). The TNF receptor complex in turn activates two opposing intracellular signaling pathways; one leads to up-regulation of the expression of anti-apoptotic genes such as cellular FLICE-inhibitory protein (c-FLIP) (4Micheau O. Lens S. Gaide O. Alevizopoulos K. Tschopp J. Mol. Cell. Biol. 2001; 21: 5299-5305Crossref PubMed Scopus (687) Google Scholar) and caspase inhibitor IAPs (inhibitor of apoptosis proteins) (5Wang C.-Y. Mayo M.W. Korneluk R.G. Goeddel D.V. Baldwin Jr., A.S. Science. 1998; 281: 1680-1683Crossref PubMed Scopus (2580) Google Scholar) (anti-cell death pathway); another activates the caspase cascade to execute apoptotic cell death (pro-cell death pathway). TNF-induced activation of the transcription factor NF-κB is one of the major pathways of anti-apoptotic gene up-regulation and cell death inhibition. NF-κB is activated upon degradation of IκB (inhibitor of NF-κB), which is induced by its phosphorylation by IκB kinases (6Hayden M.S. Ghosh S. Cell. 2008; 132: 344-362Abstract Full Text Full Text PDF PubMed Scopus (3570) Google Scholar). tumor necrosis factor butylated hydroxyanisole cellular FADD-like interleukin-1β-converting enzyme inhibitory protein Fas-associated death domain mouse embryonic fibroblasts reactive oxygen species tertbutyl hydroperoxide manganese superoxide dismutase c-Jun NH2-terminal kinase cAMP-response element-binding protein 4-hydroxytamoxifen 5 (6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester. The pro-cell death pathway is activated through FADD (1Aggarwal B.B. Nat. Rev. Immunol. 2003; 3: 745-756Crossref PubMed Scopus (2166) Google Scholar, 2Karin M. Lin A. Nat. Immunol. 2002; 3: 221-227Crossref PubMed Scopus (2452) Google Scholar, 3Ashkenazi A. Nat. Rev. Cancer. 2002; 2: 420-430Crossref PubMed Scopus (1109) Google Scholar). FADD recruits the apoptosis-initiating protease caspase-8, which is in turn autoactivated by proteolysis. Caspase-8 cleaves and activates executor caspases such as caspase-3. c-FLIP is a specific inhibitor of caspase-8 (7Thome M. Tschopp J. Nat. Rev. Immunol. 2001; 1: 50-58Crossref PubMed Scopus (352) Google Scholar). Additionally, the TNF receptor complex activates NADPH oxidase 1 and increases ROS production (8Kim Y.S. Morgan M.J. Choksi S. Liu Z.G. Mol. Cell. 2007; 26: 675-687Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). ROS causes prolonged activation of JNK (9Sakon S. Xue X. Takekawa M. Sasazuki T. Okazaki T. Kojima Y. Piao J.H. Yagita H. Okumura K. Doi T. Nakano H. EMBO J. 2003; 22: 3898-3909Crossref PubMed Scopus (455) Google Scholar, 10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar). Prolonged JNK activation down-regulates the E3 ubiquitin ligase Itch, which degrades c-FLIP (11Gallagher E. Gao M. Liu Y.C. Karin M. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 1717-1722Crossref PubMed Scopus (224) Google Scholar, 12Chang L. Kamata H. Solinas G. Luo J.L. Maeda S. Venuprasad K. Liu Y.C. Karin M. Cell. 2006; 124: 601-613Abstract Full Text Full Text PDF PubMed Scopus (595) Google Scholar). This ROS-JNK-mediated c-FLIP degradation facilitates the activation of caspase-8 (12Chang L. Kamata H. Solinas G. Luo J.L. Maeda S. Venuprasad K. Liu Y.C. Karin M. Cell. 2006; 124: 601-613Abstract Full Text Full Text PDF PubMed Scopus (595) Google Scholar). The ROS-facilitated caspase pathway is believed to be the major pathway of TNF-induced cell death. TAK1 kinase is a member of the mitogen-activated protein kinase kinase kinase family and is activated by innate immune stimuli including bacterial components and proinflammatory cytokines such as interleukin-1 and TNF (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1020) Google Scholar, 14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (764) Google Scholar). TAK1 is an ubiquitin-dependent kinase and plays an essential role in innate immune signaling by activating both IκB kinases-NF-κB and mitogen-activated protein kinase (MAPK) pathways leading to activation of transcription factor AP-1 (15Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar, 16Reiley W.W. Jin W. Lee A.J. Wright A. Wu X. Tewalt E.F. Leonard T.O. Norbury C.C. Fitzpatrick L. Zhang M. Sun S.C. J. Exp. Med. 2007; 204: 1475-1485Crossref PubMed Scopus (201) Google Scholar). We have recently generated mice harboring a skin keratinocyte (epidermal)-specific deletion of Tak1 and found that TAK1 is essential for keratinocyte survival in vivo (17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). We have found that TAK1 deficiency causes hypersensitivity to TNF-mediated killing in keratinocytes. TNF expressed in the skin kills TAK1-deficient keratinocytes and induces an inflammatory condition in the Tak1 mutant skin. However, the mechanism by which TAK1 deficiency increases the susceptibility to TNF killing has not yet determined. One plausible mechanism is that TAK1 deficiency impairs TNF-induced NF-κB resulting in activation of the pro-death caspase pathway. However, the degree of cell death is somewhat greater in TAK1-deficient mouse embryonic fibroblasts (MEFs) than NF-κB-deficient MEFs as described previously (18Shim J.-H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.-Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (595) Google Scholar). Furthermore, we have recently found that Tak1 deletion in the intestinal epithelium causes epithelial cell death at a much higher degree compared with the intestinal epithelium-specific deletion of NEMO (19Kajino-Sakamoto R. Inagaki M. Lippert E. Akira S. Robine S. Matsumoto K. Jobin C. Ninomiya-Tsuji J. J. Immunol. 2008; 180: 1143-1152Crossref Scopus (124) Google Scholar, 20Nenci A. Becker C. Wullaert A. Gareus R. van Loo G. Danese S. Huth M. Nikolaev A. Neufert C. Madison B. Gumucio D. Neurath M.F. Pasparakis M. Nature. 2007; 446: 557-561Crossref PubMed Scopus (850) Google Scholar). Therefore, we speculate that TAK1 may participate in cell survival pathways other than those mediated by NF-κB. In this study, we investigated the mechanisms by which TAK1 regulates sensitivity to TNF-induced cell death. Particularly, we are interested in whether TAK1 deficiency induces cell death through the mechanisms mediated by other than lack of NF-κB activation in TAK1-deficient keratinocytes. To this end, we generated NF-κB-deficient keratinocytes by expressing non-degradable IκB(IκBΔN) that completely blocks activation of NF-κB, and compared them with TAK1-deficient keratinocytes. We show here that TNF-induced ROS is mainly regulated by a non-NF-κB mechanism in TAK1-deficient keratinocytes, and that this TAK1-dependent ROS regulation is important for preventing the inflammatory conditions in mice having an epidermal specific Tak1 deletion. Mice—Tak1-floxed (Tak1flox/flox) mice were from Dr. Akira, Osaka University (14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (764) Google Scholar). K14-CreERT mice were obtained from the Jackson Laboratories (21Vasioukhin V. Degenstein L. Wise B. Fuchs E. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8551-8556Crossref PubMed Scopus (469) Google Scholar). Mice harboring an epidermal-specific inducible Tak1 deletion (K14-CreERT Tak1flox/flox) were generated and at 5 weeks of age were topically treated on the dorsal skin once a day for 5 consecutive days with 4-hydroxytamoxifen (1 mg/mouse). Some mice were fed with food containing 0.7% butylated hydroxyanisole (BHA) starting at 3 days prior to the tamoxifen treatment. Deletion of the Tak1 gene was confirmed by PCR using the following primer set that can detect the truncated from of Tak1 (Tak1Δ): CACCAGTGCTGGATTCTTTTTGAGGC and GGAACCCGTGGATAAGTGCACTTGAAT. TNF receptor was done as a loading control using the following primer set: TGTGAAAAGGGCACCTTTACGGC and GGCTGCAGTCCACGCACTGG. All animal experiments were done with the approval of the North Carolina State University Institutional Animal Care and Use Committee. Cell Culture—Tak1+/+ and Tak1Δ/Δ keratinocytes were isolated from Tak1flox/flox, K5-Cre Tak1flox/flox mice described previously (17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). Spontaneously immortalized keratinocytes derived from the skin of postnatal day 0-2 mice were cultured in Ca2+-free minimal essential medium (Invitrogen) supplemented with 4% Chelex-treated bovine growth serum (Hyclone), 10 ng/ml human epidermal growth factor (Invitrogen), 0.05 mm calcium chloride, and penicillin-streptomycin at 33 °C in 8% CO2. Reagents—Reagents used were TNF-α (human recombinant; Roche), N-acetyl-l-cysteine (Calbiochem), BHA (Sigma), tert-butyl hydroperoxide (tBHP; Sigma), and 4-hydroxytamoxifen (Sigma). Polyclonal antibodies were TAK1 described previously (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1020) Google Scholar), JNK1 (FL), p65 (F-6; Santa Cruz), caspase-3 (Cell Signaling), CREB (Santa Cruz), and phospho-c-Jun (Ser73; Cell Signaling). Monoclonal antibodies were c-FLIP (Abcam), phospho-JNK (Thr183/Tyr185; Cell Signaling), c-Jun (BD Bioscience), β-actin (Sigma), and nidogen (Chemicon). Annexin V Binding Assay—To determine apoptotic cells, Annexin V-Alexa Fluor 488 binding and propidium iodide staining were performed according to the manufacturer's protocol (Invitrogen). Images were taken using an inverted fluorescent microscope (TE2000-S; Nikon). 3-5 randomly selected areas were photographed with the same exposure time. The images were processed using the fixed threshold in all samples in each experiment, and more than 1000 cells were counted for each sample. Crystal Violet Assay—The viable adherent cells were fixed with 10% formalin and stained with 0.1% crystal violet. The stain was solubilized by adding 25% ethanol containing 50 mm sodium citrate, and the absorbance of each plate was determined at 595 nm. Real-time PCR Analysis—Total RNA was prepared from keratinocytes using the RNeasy protect mini kit (Qiagen). cDNA was synthesized using the reverse transcription reagents (Applied Biosystems). Real-time PCR analysis was performed using the ABI PRISM 7000 sequence detection system and the Assays-on-Demand gene expression kit (Applied Biosystems). All samples were normalized to the signal generated from glyceraldehyde-3-phosphate dehydrogenase. Electrophoretic Mobility Shift Assay—The binding reactions contained radiolabeled 32P-NF-κB oligonucleotide probe (Pro-mega), cell extracts, 4% glycerol, 1 mm MgCl2, 0.5 mm EDTA, 0.5 mm dithiothreitol, 50 mm NaCl, 10 mm Tris-HCl (pH 7.5), 500 ng of poly(dI-dC) (GE Healthcare), and 10 μg of bovine serum albumin to a final volume of 15 μl. The reaction mixtures were incubated at 25 °C for 30 min, separated by 5% (w/v) polyacrylamide gel, and visualized by autoradiography. ROS Measurement—Keratinocytes were stimulated with TNF and incubated with 10 μm CM-H2DCFDA (Invitrogen) for 30 min at 37 °C, harvested, and analyzed by flow cytometry. Immunoblotting—Cells were washed once with ice-cold phosphate-buffered saline and whole cell extracts were prepared using a lysis buffer (20 mm HEPES (pH 7.4), 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mm MgCl2, 2 mm EGTA, 10 mm sodium fluoride, 2 mm dithiothreitol, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 20 μm aprotinin, 0.5% Triton X-100). Cell extracts were resolved on SDS-PAGE and transferred to Hybond-P membranes (GE Healthcare). The membranes were immunoblotted with various antibodies, and the bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against rabbit or mouse IgG using the ECL Western blotting system (GE Healthcare). Analysis of Cytochrome c Release—Cytosolic fraction was obtained using cytochrome c release apoptosis assay kit (Calbiochem). Briefly, keratinocytes were collected by trypsinization and sonicated in cytosol extraction buffer. Homogenates were fractionated into cytosolic and mitochondrial fractions. Immunoblot was performed using monoclonal antibody against cytochrome c (BD Bioscience). Retroviral Infection—Retroviral vectors for c-Jun (pMX-puro-c-Jun) and IκbΔn (pQCXIP-IκBΔN) was generated by inserting c-Jun cDNA into the retroviral vector pMX-puro (22Kitamura T. Int. J. Hematol. 1998; 67: 351-359Crossref PubMed Google Scholar) or IκBΔN into the retroviral vector pQCXIP (Clontech). IκBΔN cDNA was a gift from Dr. Ballard, Vanderbilt University (23Brockman J.A. Scherer D.C. McKinsey T.A. Hall S.M. Qi X. Lee W.Y. Ballard D.W. Mol. Cell. Biol. 1995; 15: 2809-2818Crossref PubMed Google Scholar). EcoPack293 cells (BD Biosciences) were transiently transfected with pMX-puro-c-Jun or pQCXIP-IκBΔN. After 48 h culture, growth medium containing retrovirus was collected and filtered with 0.45-μm cellulose acetate membrane to remove packaging cells. Keratinocytes were incubated with the collected virus-containing medium with 8 μg/ml Polybrene for 24 h. Uninfected cells were removed by puromycin selection. Histology and TUNEL Staining—Paraffin sections were stained with hematoxylin and eosin for histological analysis. dUTP nick-end labeling (TUNEL) assay was performed on frozen sections using an apoptotic cell death detection kit (Pro-mega) according to the manufacturer's instructions. Immunohistochemical analysis was performed on paraffin sections using polyclonal antibodies against K5, K6, Loricrin (Convance), and cleaved caspase-3 (Cell Signaling). Sections were counterstained with hematoxylin. TNF Induces Pro-cell Death Events in Tak1Δ/Δ Keratinocytes—We first determined which cell signaling events were induced in Tak1Δ/Δ keratinocytes following TNF stimulation. Tak1 wild-type and Δ/Δ keratinocytes were isolated from Tak1flox/flox or K5-Cre Tak1flox/flox mice, respectively. In this floxed Tak1 system, Cre recombinase catalyzes the deletion of the TAK1 ATP binding site, amino acids 41-77, resulting in the generation of a truncated form of TAK1 (TAK1Δ) (Fig. 1A, bottom panel). As reported previously (17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar), TNF activated NF-κBin Tak1 wild-type keratinocytes, but this activation was largely abolished in Tak1Δ/Δ keratinocytes (Fig. 1A, top panel). We next examined pro-cell death events, including activation of JNK, degradation of c-FLIP, and activation of caspase in Tak1 wild-type and Δ/Δ keratinocytes. TNF activated JNK in a transient manner, peaking at 10 min post-stimulation in Tak1 wild-type keratinocytes, whereas no transient JNK activation was detected in Tak1Δ/Δ keratinocytes (Fig. 1A, third panel). Thus, TAK1 is essential for TNF-induced transient JNK activation, consistent with earlier studies using TAK1-deficient MEFs (14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (764) Google Scholar, 18Shim J.-H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.-Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (595) Google Scholar). However, JNK was greatly activated at 3-6 h after TNF stimulation in Tak1Δ/Δ but not in wild-type keratinocytes. It has been reported that ROS accumulation activates JNK in a prolonged manner following TNF stimulation (9Sakon S. Xue X. Takekawa M. Sasazuki T. Okazaki T. Kojima Y. Piao J.H. Yagita H. Okumura K. Doi T. Nakano H. EMBO J. 2003; 22: 3898-3909Crossref PubMed Scopus (455) Google Scholar, 10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar). Prolonged activation of JNK has been linked to c-FLIP degradation and subsequent caspase activation (10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar). We examined c-FILP degradation and caspase-3 activation (Fig. 1A, fifth and sixth panels). As anticipated, c-FLIP was degraded and caspase-3 was activated in Tak1Δ/Δ but not in wild-type keratinocytes. We measured ROS production using CM-H2DCFDA, a substrate that exhibits increased fluorescence when oxidized by intracellular ROS (Fig. 1B). The levels of ROS were greatly increased in Tak1Δ/Δ but not in wild-type keratinocytes following TNF stimulation. We also examined whether cell death is through the apoptotic or necrotic pathways. Apoptosis and necrosis were assessed by Annexin V binding and propidium iodide staining (Fig. 1C). The numbers of both apoptotic and necrotic cells were greatly increased in Tak1Δ/Δ keratinocytes at 2-6 h post-TNF stimulation. Cytochrome c was increased in the cytoplasm in TNF-stimulated Tak1Δ/Δ but not in wild-type keratinocytes (Fig. 1D), suggesting that TNF activates the mitochondrial apoptosis pathway in Tak1Δ/Δ keratinocytes. Collectively, these results demonstrate that TNF induces pro-cell death events including activation of JNK and caspase-3 in TAK1Δ/Δ keratinocytes, which occur concomitantly with accumulation of ROS, resulting in apoptotic and necrotic cell death. Inhibition of ROS Completely Blocks TNF-induced Cell Death in Tak1Δ/Δ Keratinocytes—It is known that ROS activates JNK resulting in activation of caspases through c-FLIP degradation. Furthermore, the activation of JNK and caspase-3 in Tak1Δ/Δ keratinocytes occurred concomitantly with ROS accumulation. Therefore, we assume that ROS is the cause of these pro-cell death events. We examined the effect of inhibiting ROS with antioxidants on TNF-induced pro-cell death events. Cells were treated with the antioxidant BHA and the activation of JNK and caspase-3 and c-FLIP degradation examined (Fig. 2A). BHA could abolish all these pro-cell death events. We also measured apoptosis and cell viability. BHA could completely inhibit an increase of apoptotic cells following TNF stimulation in Tak1Δ/Δ keratinocytes (Fig. 2B). Furthermore, BHA and another antioxidant N-acetylcysteine could totally block TNF-induced cell death (Fig. 2C). These results suggest that ROS is the major mediator of TNF-induced cell death in Tak1Δ/Δ keratinocytes. NF-κB Deficiency Does Not Effectively Induce ROS or Apoptosis in TNF-stimulated Keratinocytes—Our results thus far demonstrated that TAK1 deficiency causes ROS accumulation upon TNF stimulation, which results in apoptotic and necrotic cell death. One likely mechanism by which TAK1 deficiency causes ROS accumulation is a lack of activation of NF-κB. It is known that NF-κB regulates several enzymes and molecules that are involved in ROS metabolism such as manganese superoxide dismutase (MnSOD) and ferritin heavy chain (10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar, 24Pham C.G. Bubici C. Zazzeroni F. Papa S. Jones J. Alvarez K. Jayawardena S. De Smaele E. Cong R. Beaumont C. Torti F.M. Torti S.V. Franzoso G. Cell. 2004; 119: 529-542Abstract Full Text Full Text PDF PubMed Scopus (536) Google Scholar). To examine the role of NF-κB in TNF-induced cell death in keratinocytes, we generated wild-type keratinocytes stably expressing the repressor of NF-κB, IκBΔN(IκBΔN keratinotyes). We used Tak1 wild-type keratinocytes isolated from the littermate mice of those we isolated from our Tak1Δ/Δ keratinocytes. Therefore, the backgrounds of Tak1Δ/Δ and IκBΔN keratinocytes are similar. We confirmed that TNF-induced NF-κB activation was completely abolished in IκBΔN keratinocytes (Fig. 3A). We examined TNF-induced ROS accumulation, apoptosis, and cell death. Tak1Δ/Δ keratinocytes exhibited a large increase of ROS at 5 h and ROS could not be measured due to cell death at 16 h after TNF stimulation (Fig. 3B). In contrast, ROS was not increased even at 16 h in IκBΔN keratinocytes (Fig. 3B). Annexin V-binding positive cells were also not increased in IκBΔN keratinocytes (Fig. 3C). These results indicate that TAK1 regulates ROS and cell death not through NF-κB. In MEFs, MnSOD is one of the major targets of NF-κB and regulates ROS (10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar). To further examine the involvement of NF-κB in ROS regulation in keratinocytes, we observed the expression levels of MnSOD following TNF stimulation (Fig. 3D). A chemokine MIP2, which is a NF-κB target, was greatly increased by TNF in Tak1 wild-type keratinocytes, indicating that NF-κB was activated under this experimental condition. However, unlike MEFs, MnSOD was not increased by TNF in keratinocytes and TAK1 deficiency did not decrease the level of MnSOD. Collectively, we conclude that NF-κB is not primarily important for ROS regulation at least in keratinocytes. Finally, we examined TNF-induced cell death at 24 h after stimulation. Cell death was moderately increased in IκBΔN keratinocytes, however, cell death was significantly less compared with that in Tak1Δ/Δ keratinocytes (Fig. 3E). These results suggest that TAK1 deficiency causes an increase of ROS and cell death mainly not through the lack of NF-κB activation. We next examined the relationship between TAK1 and ROS. If TAK1 regulates ROS, TAK1 deficiency should cause an increase of sensitivity not only to TNF but also to ROS-induced cell death. We treated keratinocytes with tBHP, a prototypical organic oxidant. Tak1Δ/Δ keratinocytes died by 0.3 mm tBHP treatment (Fig. 3E, left panel), whereas Tak1 wild-type and IκBΔN keratinocytes were resistant to 0.5 mm tBHA and died with 1.0 mm tBHP treatment (Fig. 3F, right panel). These results demonstrate that TAK1 but not NF-κB affects sensitivity to ROS-induced cell death in keratinocytes, suggesting that TAK1 regulates ROS mainly through non-NF-κB mechanisms. c-Jun Is Partially Involved in TAK1 Regulation of ROS—We next attempted to determine the mechanism by which TAK1 regulates ROS. TAK1 can activate two groups of transcription factors, namely NF-κB and AP1. As described above, we found that ROS is regulated through non-NF-κB mechanisms. Therefore, we examined the levels of AP1 family transcription factors including the Jun family and c-Fos. We also examined CREB. Among these, we found that the levels of c-Jun were reduced in TAK1-deficient keratinocytes under the basal condition (Fig. 4, A and B). The level of c-Jun was not significantly altered by TNF stimulation both in wild-type and Tak1Δ/Δ keratinocytes. Thus, only the basal level of c-Jun is regulated by TAK1. TAK1 is activated by the number of stimuli including cytokines and stresses (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1020) Google Scholar, 25HuangFu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 26Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (322) Google Scholar), which presumably are constitutively present at low levels even in unstimulated conditions. We speculate that TAK1 may be constitutively activated at a low level under the normal culture conditions, and this constitutive activity of TAK1 is important to maintain the basal level of c-Jun. We hypothesized that TAK1-dependent basal expression of c-Jun is involved in ROS regulation and cell survival. To examine this possibility, we generated Tak1Δ/Δ keratinocytes that ectopically express c-Jun (Fig. 4C), and examined accumulation of ROS, apoptosis, and cell death following TNF stimulation. We found that the levels of ROS were reduced by c-Jun expression in TNF-treated Tak1Δ/Δ keratinocytes (Fig. 4D). Concomitantly, TNF-induced apoptosis was significantly reduced in c-Jun expressing keratinocytes (Fig. 4E). However, cell viability at 24 h after TNF stimulation was not greatly rescued by c-Jun expression (Fig. 4F). We note that higher levels of c-Jun expression did not increase the level of rescuing the TNF-induced cell death (data not shown). These results suggest that the TAK1-c-Jun pathway participates in ROS regulation but is not sufficient to rescue cell death at later time points. Antioxidants Rescue the Skin Disorder in Mice Caused by Epidermal-specific Deletion of TAK1—Our results in cultured keratinocytes indicate that TAK1-dependent ROS regulation is important for cell survival. Finally, we asked whether ROS are the cause of keratinocyte death and subsequent skin inflammation in mice harboring an epidermal-specific deletion of TAK1. Mice with an epidermal-specific deletion of Tak1 were born at the expected Mendelian ratio but developed a severe skin inflammatory condition and were lethal by postnatal days 6-7. Because small pups are difficult to effectively treat with antioxidants, we generated mice with epidermal-specific inducible Tak1 deletion. We crossed homozygous Tak1-floxed (Tak1flox/flox) mice to transgenic mice expressing the tamoxifen-dependent Cre-ERT recombinase under the control of the cytokeratin K14 promoter (K14-CreERT) (21Vasioukhin V. Degenstein L. Wise B. Fuchs E. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8551-8556Crossref PubMed Scopus (469) Google Scholar). The resulting mice (K14-CreERT Tak1flox/flox) were born at the expected Mendelian ratio and grew normally, at least until the age of 6-7 months. To induce deletion of the Tak1 gene, we topically treated the K14-CreERT Tak1flox/flox mice with 4-hydroxytamoxifen (4-OHT), an active metabolite of tamoxifen. We confirmed that this treatment induced deletion of TAK1 by PCR, using a primer set that could only detect the deleted allele of Tak1 (Fig. 5B). The mutant mice harboring an epidermal-specific Tak1 deletion developed an inflammatory skin condition 2-5 days after treatment with 4-OHT. The inflammatory conditions were severe and similar to the conditions in the constitutive epidermal specific Tak1 deletion mice at postnatal days 5-7 (17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). The mutant epidermis was hyperplastic, hypertophic, and hyperkeratotic, and microabscesses were commonly found (supplementary Fig. S1A). An inflamed skin marker K6 was highly expressed in the entire area where 4-OHT was treated (supplementary Fig. S1B). Expression of the epidermal differentiation marker loricrin was diminished and apoptotic keratinocytes are greatly increased all over the 4-OHT-treated skin (supplementary Fig. S1B). To examine whether ROS are the cause of this inflammation, we fed the mice food containing BHA. The mice consuming food containing BHA showed less flaky skin compared with the TAK1-deficient littermates who did not consume BHA (Fig. 5A). Histological analysis revealed that BHA decreased epidermal hyperplasia, infiltration of immune cells, and hyperkeratotic stratum corneum that are frequently observed in TAK1-deficient epidermis (Fig. 5C). Importantly, keratinocyte death was significantly reduced in BHA-treated mice (Fig. 5C). These results demonstrated that ROS are the cause of the skin inflammation in mice having TAK1-deficient epidermis. TNF induces ROS, activation of JNK, degradation of c-FLIP, and activation of caspases in Tak1Δ/Δ keratinocytes, and all of these events cooperatively promote cell death. Because inhibition of ROS could abolish pro-cell death events and ultimately blocked cell death in Tak1Δ/Δ keratinocytes, we surmise that accumulation of ROS in the TAK1-deficient keratinocytes is the central mediator of keratinocyte death. How Does TAK1 Regulate ROS?—ROS are regulated by a number of enzymes including NF-κB target gene products such as MnSOD and ferritin heavy chain (10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar, 24Pham C.G. Bubici C. Zazzeroni F. Papa S. Jones J. Alvarez K. Jayawardena S. De Smaele E. Cong R. Beaumont C. Torti F.M. Torti S.V. Franzoso G. Cell. 2004; 119: 529-542Abstract Full Text Full Text PDF PubMed Scopus (536) Google Scholar, 27Winyard P.G. Moody C.J. Jacob C. Trends Biochem. Sci. 2005; 30: 453-461Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar). TAK1 is an essential intermediate in the TNF signaling pathway leading to activation of NF-κB transcription factors (Fig. 1A). Therefore, it was anticipated that TAK1 would influence the expression of MnSOD and/or ferritin heavy chain. However, we found that deletion of TAK1 did not affect their expression (Fig. 3D and data not shown). Moreover, we found that NF-κB-deficiency did not induce ROS following TNF stimulation (Fig. 3B). Thus, NF-κB does not regulate the level of ROS in keratinocytes, and the mechanisms mediated by other than NF-κB should be important for ROS regulation. We found that TAK1-dependent c-Jun expression may partially contribute to ROS regulation in keratinocytes. However, we could not totally block either TNF-induced ROS accumulation or cell death by ectopic expression of c-Jun. Therefore, TAK1 activates several mediators including c-Jun, and unidentified factors that may cooperatively regulate the levels of ROS in keratinocytes. We have recently found that intestinal epithelial specific Tak1 mutant mice die immediately after birth and they show massive epithelial cell death (19Kajino-Sakamoto R. Inagaki M. Lippert E. Akira S. Robine S. Matsumoto K. Jobin C. Ninomiya-Tsuji J. J. Immunol. 2008; 180: 1143-1152Crossref Scopus (124) Google Scholar). In contrast, intestinal epithelial specific NF-κB-deficient (NEMO deletion) mice slowly develop intestinal inflammation by 6 weeks of age (20Nenci A. Becker C. Wullaert A. Gareus R. van Loo G. Danese S. Huth M. Nikolaev A. Neufert C. Madison B. Gumucio D. Neurath M.F. Pasparakis M. Nature. 2007; 446: 557-561Crossref PubMed Scopus (850) Google Scholar). Our current results raise the possibility that Tak1 deletion increases ROS, thereby inducing cell death and tissue damage in intestinal epithelial specific Tak1 deletion mice more severely compared with the epithelial specific NEMO deletion mice. TAK1, ROS, and Psoriasis—ROS has been associated with psoriasis; however, it has not been determined whether ROS is the cause or the consequence of inflammation (28Bickers D.R. Athar M. J. Investig. Dermatol. 2006; 126: 2565-2575Abstract Full Text Full Text PDF PubMed Scopus (826) Google Scholar). We have shown here that Tak1 deletion causes dysregulation of ROS in keratinocytes, which is causally associated with skin inflammation (Ref. 17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar and Fig. 5). TAK1 can be activated by cytokines and innate immune stimuli including interleukin-1, TNF, and microbial components and stress conditions (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1020) Google Scholar, 25HuangFu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 26Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (322) Google Scholar). The levels of those TAK1 stimuli in the epithelial tissues may be fluctuated in vivo. For example, reduction of commensal bacteria decreases TAK1 activity, thereby increasing the accumulation of ROS. Such dysregulation in TAK1 activity may contribute to ROS-mediated epithelial inflammation. Our results warrant further studies on the relationship of the TAK1 signaling pathway, ROS metabolism, and psoriasis. We thank S. Akira for Tak1-floxed mice, D. Ballard for IκBΔN cDNA, and Y. Tsuji for discussion, J. Dow, B. J. Welker, and M. Mattmuler for support. Download .pdf (1.65 MB) Help with pdf files}, number={38}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Omori, Emily and Morioka, Sho and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2008}, month={Sep}, pages={26161–26168} }
 @article{inagaki_omori_kim_komatsu_scott_ray_yamada_matsumoto_mishina_ninomiya-tsuji_2008, title={TAK1-binding Protein 1, TAB1, Mediates Osmotic Stress-induced TAK1 Activation but Is Dispensable for TAK1-mediated Cytokine Signaling}, volume={283}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M807574200}, abstractNote={TAK1 kinase is an indispensable intermediate in several cytokine signaling pathways including tumor necrosis factor, interleukin-1, and transforming growth factor-β signaling pathways. TAK1 also participates in stress-activated intracellular signaling pathways such as osmotic stress signaling pathway. TAK1-binding protein 1 (TAB1) is constitutively associated with TAK1 through its C-terminal region. Although TAB1 is known to augment TAK1 catalytic activity when it is overexpressed, the role of TAB1 under physiological conditions has not yet been identified. In this study, we determined the role of TAB1 in TAK1 signaling by analyzing TAB1-deficient mouse embryonic fibroblasts (MEFs). Tumor necrosis factor- and interleukin-1-induced activation of TAK1 was entirely normal in Tab1-deficient MEFs and could activate both mitogen-activated protein kinases and NF-κB. In contrast, we found that osmotic stress-induced activation of TAK1 was largely impaired in Tab1-deficient MEFs. Furthermore, we showed that the C-terminal 68 amino acids of TAB1 were sufficient to mediate osmotic stress-induced TAK1 activation. Finally, we attempted to determine the mechanism by which TAB1 activates TAK1. We found that TAK1 is spontaneously activated when the concentration is increased and that it is totally dependent on TAB1. Cell shrinkage under the osmotic stress condition increases the concentration of TAB1-TAK1 and may oligomerize and activate TAK1 in a TAB1-dependent manner. These results demonstrate that TAB1 mediates TAK1 activation only in a subset of TAK1 pathways that are mediated through spontaneous oligomerization of TAB1-TAK1.}, number={48}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Inagaki, Maiko and Omori, Emily and Kim, Jae-Young and Komatsu, Yoshihiro and Scott, Greg and Ray, Manas K. and Yamada, Gen and Matsumoto, Kunihiro and Mishina, Yuji and Ninomiya-Tsuji, Jun}, year={2008}, month={Nov}, pages={33080–33086} }
 @article{huangfu_matsumoto_ninomiya-tsuji_2007, title={Osmotic stress blocks NF-kappa B-dependent in inflammatory responses by inhibiting ubiquitination of I kappa B}, volume={581}, ISSN={["1873-3468"]}, DOI={10.1016/j.febslet.2007.11.002}, abstractNote={The inhibitory effects of hypertonic conditions on immune responses have been described in clinical studies; however, the molecular mechanism underlying this phenomenon has yet to be defined. Here we investigate osmotic stress-mediated modification of the NF-kappaB pathway, a central signaling pathway in inflammation. We unexpectedly found that osmotic stress could activate IkappaBalpha kinase but did not activate NF-kappaB. Osmotic stress-induced phosphorylated IkappaBalpha was not ubiquitinated, and osmotic stress inhibited interleukin 1-induced ubiquitination of IkappaBalpha and ultimately blocked expression of cytokine/chemokines. Thus, blockage of IkappaBalpha ubiquitination is likely to be a major mechanism for inhibition of inflammation by hypertonic conditions.}, number={29}, journal={FEBS LETTERS}, author={HuangFu, Wei-Chun and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2007}, month={Dec}, pages={5549–5554} }
 @article{kajino_omori_ishii_matsumoto_ninomiya-tsuji_2007, title={TAK1 MAPK kinase kinase mediates transforming growth factor-beta signaling by targeting SnoN oncoprotein for degradation}, volume={282}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M700875200}, abstractNote={Transforming growth factor-β (TGF-β) regulates a variety of physiologic processes through essential intracellular mediators Smads. The SnoN oncoprotein is an inhibitor of TGF-β signaling. SnoN recruits transcriptional repressor complex to block Smad-dependent transcriptional activation of TGF-β-responsive genes. Following TGF-β stimulation, SnoN is rapidly degraded, thereby allowing the activation of TGF-β target genes. Here, we report the role of TAK1 as a SnoN protein kinase. TAK1 interacted with and phosphorylated SnoN, and this phosphorylation regulated the stability of SnoN. Inactivation of TAK1 prevented TGF-β-induced SnoN degradation and impaired induction of the TGF-β-responsive genes. These data suggest that TAK1 modulates TGF-β-dependent cellular responses by targeting SnoN for degradation. Transforming growth factor-β (TGF-β) regulates a variety of physiologic processes through essential intracellular mediators Smads. The SnoN oncoprotein is an inhibitor of TGF-β signaling. SnoN recruits transcriptional repressor complex to block Smad-dependent transcriptional activation of TGF-β-responsive genes. Following TGF-β stimulation, SnoN is rapidly degraded, thereby allowing the activation of TGF-β target genes. Here, we report the role of TAK1 as a SnoN protein kinase. TAK1 interacted with and phosphorylated SnoN, and this phosphorylation regulated the stability of SnoN. Inactivation of TAK1 prevented TGF-β-induced SnoN degradation and impaired induction of the TGF-β-responsive genes. These data suggest that TAK1 modulates TGF-β-dependent cellular responses by targeting SnoN for degradation. Transforming growth factor-β (TGF-β) 2The abbreviations used are: TGF-β, transforming growth factor-β; TAK1, TGF-β-activated kinase 1; TAB1, TAK1-binding protein 1; MAPKKK, mitogen-activated protein kinase kinase kinase; HA, hemagglutinin; siRNA, small interfering RNA; GST, glutathione S-transferase. is a multifunctional cytokine involved in the regulation of proliferation, differentiation, migration, and survival of many different cell types (1Shi Y. Massague J. Cell. 2003; 113: 685-700Abstract Full Text Full Text PDF PubMed Scopus (4836) Google Scholar, 2Wakefield L.M. Roberts A.B. Curr. Opin. Genet. Dev. 2002; 12: 22-29Crossref PubMed Scopus (729) Google Scholar). TGF-β ligand binds to and activates Ser/Thr kinase receptors (3Wrana J.L. Attisano L. Wieser R. Ventura F. Massague J. Nature. 1994; 370: 341-347Crossref PubMed Scopus (2114) Google Scholar). This leads to the phosphorylation and activation of the receptor-regulated Smad family (R-Smad), Smad2 and Smad3 (4Chen X. Rubock M.J. Whitman M. Nature. 1996; 383: 691-696Crossref PubMed Scopus (632) Google Scholar). Phosphorylated R-Smad forms a functional complex with the co-mediator Smad (Co-Smad), Smad4, and this complex accumulates in the nucleus and modulates expression of the TGF-β-responsive genes such as plasminogen activator inhibitor type-1 (PAI-1) (1Shi Y. Massague J. Cell. 2003; 113: 685-700Abstract Full Text Full Text PDF PubMed Scopus (4836) Google Scholar, 5Westerhausen Jr., D.R. Hopkins W.E. Billadello J.J. J. Biol. Chem. 1991; 266: 1092-1100Abstract Full Text PDF PubMed Google Scholar, 6Nakao A. Imamura T. Souchelnytskyi S. Kawabata M. Ishisaki A. Oeda E. Tamaki K. Hanai J. Heldin C.H. Miyazono K. ten Dijke P. EMBO J. 1997; 16: 5353-5362Crossref PubMed Scopus (916) Google Scholar). The nuclear Smads complex is maintained in an inactive state via its association with Ski family oncoproteins, Ski and SnoN (7Luo K. Curr. Opin. Genet. Dev. 2004; 14: 65-70Crossref PubMed Scopus (177) Google Scholar, 8Sun Y. Liu X. Eaton E.N. Lane W.S. Lodish H.F. Weinberg R.A. Mol. Cell. 1999; 4: 499-509Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar). By binding to Smads, Ski and SnoN recruit transcriptional repressor complexes such as N-CoR/SMRT and mSin3A to TGF-β target promoters and thereby repress transcription of TGF-β-responsive genes (7Luo K. Curr. Opin. Genet. Dev. 2004; 14: 65-70Crossref PubMed Scopus (177) Google Scholar, 9Nomura T. Khan M.M. Kaul S.C. Dong H.D. Wadhwa R. Colmenares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar). Upon TGF-β stimulation, SnoN is immediately down-regulated via the ubiquitin-proteasome pathway induced by anaphase-promoting complex (APC) or Smurf2 E3 ubiquitin-protein isopeptide ligases (10Bonni S. Wang H.R. Causing C.G. Kavsak P. Stroschein S.L. Luo K. Wrana J.L. Nat. Cell Biol. 2001; 3: 587-595Crossref PubMed Scopus (273) Google Scholar, 11Stroschein S.L. Bonni S. Wrana J.L. Luo K. Genes Dev. 2001; 15: 2822-2836Crossref PubMed Google Scholar, 12Wan Y. Liu X. Kirschner M.W. Mol. Cell. 2001; 8: 1027-1039Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). Degradation of SnoN initially allows the Smad heteromeric complex to activate TGF-β target genes (13Sun Y. Liu X. Ng-Eaton E. Lodish H.F. Weinberg R.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12442-12447Crossref PubMed Scopus (226) Google Scholar). However, longer TGF-β treatment leads to higher expression via transcriptional activation of the SnoN gene (14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). This functions as a negative feedback circuit to limit the effects of TGF-β. Importantly, overexpression of SnoN results in the loss of TGF-β-induced growth arrest of the cells, suggesting a potential mechanism for SnoN-mediated oncogenesis (8Sun Y. Liu X. Eaton E.N. Lane W.S. Lodish H.F. Weinberg R.A. Mol. Cell. 1999; 4: 499-509Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar, 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). TGF-β-activated kinase 1 (TAK1) is a member of mitogen-activated protein kinase kinase kinase (MAPKKK) and functions as a signaling intermediate in several intracellular signaling pathways including the TGF-β and interleukin-1 pathways (15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1175) Google Scholar, 16Shibuya H. Iwata H. Masuyama N. Gotoh Y. Yamaguchi K. Irie K. Matsumoto K. Nishida E. Ueno N. EMBO J. 1998; 17: 1019-1028Crossref PubMed Scopus (190) Google Scholar, 17Hanafusa H. Ninomiya-Tsuji J. Masuyama N. Nishita M. Fujisawa J. Shibuya H. Matsumoto K. Nishida E. J. Biol. Chem. 1999; 274: 27161-27167Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar, 18Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1019) Google Scholar). TAK1 is catalytically activated by TGF-β stimulation (15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1175) Google Scholar) and plays an essential role in TGF-β-induced p38 activation (17Hanafusa H. Ninomiya-Tsuji J. Masuyama N. Nishita M. Fujisawa J. Shibuya H. Matsumoto K. Nishida E. J. Biol. Chem. 1999; 274: 27161-27167Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar). TAK1 has also been implicated in several TGF-β-induced biological processes including apoptosis (19Edlund S. Bu S. Schuster N. Aspenstrom P. Heuchel R. Heldin N.E. ten Dijke P. Heldin C.H. Landstrom M. Mol. Biol. Cell. 2003; 14: 529-544Crossref PubMed Scopus (187) Google Scholar) and vascular development (20Jadrich J.L. O'Connor M.B. Coucouvanis E. Development (Camb.). 2006; 133: 1529-1541Crossref PubMed Scopus (111) Google Scholar). However little is known about how TAK1 mediates TGF-β signaling. In this study, we found that TAK1 interacts with SnoN and targets it for degradation. The TAK1 regulation of SnoN may participate in TGF-β-induced cellular responses. Plasmids and Protein—The mammalian expression vectors for TAK1, HA-TAK1, HA-TAK1(K63W), TAB1, and HA-ubiquitin have been described previously (15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1175) Google Scholar, 18Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1019) Google Scholar, 21Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (520) Google Scholar, 22Shimura H. Hattori N. Kubo S. Mizuno Y. Asakawa S. Minoshima S. Shimizu N. Iwai K. Chiba T. Tanaka K. Suzuki T. Nat. Genet. 2000; 25: 302-305Crossref PubMed Scopus (1706) Google Scholar). Full-length SnoN and SnoN-(1–366) were subcloned into pCMV in-frame with HA tag or FLAG tag at the N terminus. Small interference RNA (siRNA) was produced using the BS/H1 vector to direct expression of the relevant hairpin double-stranded sequence from the H1 promoter. The siRNA target sequences corresponded to nucleotides 88–106 of the TAK1 cording region. Target oligonucleotides were synthesized (5′-GATCCCCGAGATCGACTACAAGGAGATTCAAGAGATCTCCTTGTAGTCGATCTCTTTTTGGAAA-3′; and 5′-AGCTTTTCCAAAAAGAGATCGACTACAAGGAGATCTCTTGAATCTCCTTGTAGTCGATCTCGGG-3′), annealed, and cloned into BS/H1 between the BglII and HindIII sites using standard molecular cloning techniques. Generation of various point mutations of full-length SnoN and SnoN-(1–366), including full-length SnoN and SnoN-(1–366) mutated at Ser-115, Ser-117, and Thr-119 to Ala or Ser-108, Ser-112, Ser-115, Ser-117, Thr-119, Ser-126, Ser-140, and Ser-141 to Ala, were done using PCR and QuikChange II XL site-directed mutagenesis kit (Stratagene) and verified by DNA sequencing. Bacterially expressed SnoN-(1–366) fused to glutathione S-transferase (GST) (GST-SnoN-(1–366)) was purified using glutathione-Sepharose 4 Fast Flow (Amersham Biosciences) according to manufacturer's instructions. The retrovirus vectors for HA-SnoN full-length and HA-SnoN mutant full-length were generated by insertion of HA-tagged SnoN cDNAs into pQCXIP vector (Stratagene). Antibodies and Reagents—The following antibodies were used: anti-HA monoclonal antibody 16B12 (Covance), anti-FLAG monoclonal antibody M2 (Sigma), anti-Sno polyclonal antibody (Upstate Biotechnology), anti-TAK1 antibody (18Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1019) Google Scholar), anti-IκBα polyclonal antibody C-21 (Santa Cruz Biotechnology), anti-β-catenin monoclonal antibody 14 (BD Biosciences), anti-Smad2/3 polyclonal antibody (Upstate Biotechnology), anti-p53 monoclonal antibody DO-1 (Santa Cruz Biotechnology), and anti-β-actin monoclonal antibody AC-15 (Sigma). Recombinant human TGF-β1 was purchased from Roche Applied Science. (5Z)-7-Oxozeaenol was as described previously (23Ninomiya-Tsuji J. Kajino T. Ono K. Ohtomo T. Matsumoto M. Shiina M. Mihara M. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2003; 278: 18485-18490Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar). G418 (Invitrogen), hygromycin B (A. G. Scientific, Inc.), λ phosphatase (New England Biolabs), and cycloheximide (Calbiochem) were used. Cell Culture, Transfection, and Virus Infection—293 cells, HaCaT cells, and HeLa S3 cells were cultured in Dulbecco's modified Eagle's medium plus 10% fetal calf serum or bovine growth serum (HyClone). Transfection of 293 cells was carried out using the calcium phosphate precipitation method. Stable transfections of HaCaT cells and HeLa S3 cells were carried out using TransFast™ (Promega). The retrovirus for expression of HA-SnoN full-length and HA-SonN mutant full-length were generated and infected into HaCaT cells according to the manufacturer's instruction. Stable cell line selection was achieved using G418, hygromycin B, or puromycin. Yeast Two-hybrid Screening—Plasmid pGBD-C-TAK1(K63W) was used as bait to screen a mouse B cell library (in pGAD) (21Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (520) Google Scholar). The bait plasmid and the library cDNAs were co-transformed into the yeast strain PJ69-4A using the lithium acetate method. Yeast cells were plated on selective medium plates and allowed to grow at 30 °C. Positive colonies were then restreaked on selective medium plates. Plasmid DNA was rescued from positive colonies that grew on selective medium plates and subject to further sequence analysis. Immunoprecipitation and Immunoblotting—Whole cell extracts were prepared in lysis buffer (20 mm HEPES, pH 7.4, 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mm MgCl2, 2 mm EGTA, 10 mm NaF, 2 mm dithiothreitol, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 100 units/ml aprotinin, 0.5% Triton X-100). Proteins from cell lysates were immunoprecipitated with 1 μg of various antibodies and 15 μl of protein G-Sepharose (Amersham Biosciences). The immune complexes were washed three times with wash buffer containing 20 mm HEPES (pH 7.4), 500 mm NaCl, and 10 mm MgCl2 and once with rinse buffer containing 20 mm HEPES (pH 7.4), 150 mm NaCl, and 10 mm MgCl2 and suspended in 30 μl of rinse buffer. For immunoblotting, the immunoprecipitates or cell lysates were resolved on SDS-PAGE and transferred to Hybond-P membranes (Amersham Biosciences). The membranes were immunoblotted with various antibodies, and bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against mouse or rabbit IgG using the ECL Western blotting system (Amersham Biosciences). Cellular Fractionation—To isolate the nuclear and the cytoplasm fractions, cells in 10-cm dishes were treated with TGF-β (5 ng/ml) and then lysed with 500 μl of hypotonic buffer A (50 mm HEPES (pH 7.4), 10 mm KCl, 1 mm EDTA, 1 mm EGTA, 1 mm dithiothreitol, 0.2 mm phenylmethylsulfonyl fluoride, and 100 units/ml aprotinin) containing 0.1% Nonidet P-40 and homogenized in a Dounce homogenizer (30 strokes). Lysates were then centrifuged at 4,000 × g for 4 min. The supernatant was centrifuged at 12,500 × g for 4 min to obtain the cytosolic fraction. This pellet was resuspended in hypotonic buffer B (buffer A containing 1.7 m sucrose) and then centrifuged at 15,000 × g for 30 min. The pellet (nuclear fraction) was resuspended in 0.5% Triton X-100 lysis buffer and sonicated. All steps were performed on ice or at 4 °C. Protein concentrations were determined using the micro BCA protein assay kit (Pierce). The purity of the cytosolic and nuclear fractions was assessed by immunoblotting of IκB (a cytosolic marker) and lamin B (a nuclear marker). Real-time Quantitative Reverse Transcription-PCR—Real-time quantitative PCR was preformed using 7300 Real-time PCR system (PE Applied Biosystems) and SYBR Premix Ex Taq (Takara Bio Inc.). The cycling conditions were as follows: 95 °C for 10 s; 40 cycles of 95 °C for 5 s and 60 °C for 34 s. The primers for PAI-1 (forward, 5′-GCC ATG GAA CAA GGA TGA GAT C-3′; reverse, 5′-AGC CCT GGA CCA GCT TCA G-3′) and β-actin (forward, 5′-GCC GGG ACC TGA CTG ACT AC; reverse, 5′-TCC TTA ATG TCA CGC ACG ATT TC-3′) were designed using Primer Express, version 2.0. In Vitro Kinase Assay—Ectopically expressed HA-TAK1 was immunoprecipitated with anti-HA antibody as described above. Immunoprecipitates were incubated with or without 1 μg of bacterially expressed SnoN-(1–366) in 10 μl of kinase buffer containing 10 mm HEPES (pH 7.4), 1 mm dithiothreitol, 5 mm MgCl2, and 5 μCi of [γ-32P]ATP (3,000 Ci/mmol) at 30 °C for 15 min. Samples were fractionated by 10% SDS-PAGE and visualized by autoradiography. To study the role of TAK1 in TGF-β signaling, we screened for TAK1-binding proteins using the yeast two-hybrid system. A kinase-inactive mutant of TAK1, TAK1(K63W), was used as the bait to screen a mouse B cell cDNA library. From a total of 2 × 106 transformants, 28 clones were identified as potential interactors. Sequence analysis revealed that one of the positive clones encoded SnoN2 (Fig. 1A). SnoN undergoes alternative splicing, creating four splicing isoform, SnoN, SnoN2, SnoI, and SnoA (7Luo K. Curr. Opin. Genet. Dev. 2004; 14: 65-70Crossref PubMed Scopus (177) Google Scholar, 24Pearson-White S. Crittenden R. Nucleic Acids Res. 1997; 25: 2930-2937Crossref PubMed Scopus (64) Google Scholar). The N terminus of SnoN, from 1 to 366 amino acids, is identical among the four isoforms. The SnoN2 sequence is completely identical with that of SnoN except for the C-terminal 46 amino acids (Fig. 1B). As SnoN2 is the less abundantly expressed isoform in human cells (24Pearson-White S. Crittenden R. Nucleic Acids Res. 1997; 25: 2930-2937Crossref PubMed Scopus (64) Google Scholar), we focused on the interaction between TAK1 and SnoN. Interaction of TAK1 with SnoN was further confirmed in mammalian cell by co-immunoprecipitation assays. HA epitope-tagged TAK1 and FLAG-tagged SnoN were transiently co-expressed in 293 human embryonic kidney cells. The cell extracts were immunoprecipitated with anti-FLAG antibody and followed by immunoblotting analysis (Fig. 1C). When FLAG-SnoN was immunoprecipitated, both HA-TAK1 and HA-TAK1(K63W) were co-immunoprecipitated. To establish the connection between TAK1 and SnoN, we next determined the subcellular localizations of TAK1 and SnoN. We performed biochemical fractionation with human keratinocyte HaCaT cells. TGF-β-stimulated and unstimulated HaCaT cells were fractionated into the nuclear and the cytosolic extracts. Endogenous SnoN was localized only in the nucleus but was degraded upon TGF-β stimulation (Fig. 2, left panel). Endogenous TAK1 was localized primarily in the cytoplasm but also was detected in the nuclear fractions. Upon TGF-β stimulation, the amount of nuclear TAK1 was increased. The fractions were reasonably pure, as determined by the presence of IκB only in the cytosolic fraction and not in the nuclear fraction. Conversely, a nuclear protein, lamin B, was detected only in the nuclear fraction but not the cytosolic fraction (supplemental Fig. S1). These data raised the possibility that TAK1 is co-localized with SnoN in the nucleus. To examine the interaction between TAK1 and SnoN in the nucleus, endogenous TAK1 was immunoprecipitated following fractionation (Fig. 2, right panel). SnoN was found to be associated with TAK1 in the nuclear fraction independently of TGF-β stimulation, but no association could be detected in the cytosolic fraction. Thus, TGF-β stimulation induces the TAK1 accumulation in the nucleus, and this nuclear TAK1 interacts with SnoN. The observed association between TAK1 and SnoN suggested that TAK1 is involved in the TGF-β-dependent degradation of SnoN. To test the possibility, we employed siRNA to reduce the levels of endogenous TAK1 (25Elbashir S.M. Harborth J. Lendeckel W. Yalcin A. Weber K. Tuschl T. Nature. 2001; 411: 494-498Crossref PubMed Scopus (8161) Google Scholar). We generated two independent HeLa S3 cell lines stably expressing TAK1 siRNA. Expression of TAK1 in each clone was determined by immunoblotting. Expression of TAK1 siRNA greatly reduced the amount of endogenous TAK1 but not affect β-catenin (Fig. 3A). Both TAK1 knockdown cells and parent cells were then treated with TGF-β and subjected to biochemical fractionation. The nuclear fraction was further subjected to immunoblotting with anti-SnoN, anti-TAK1, and anti-Smad2/3. As shown in Fig. 3B, TGF-β induced the degradation of SnoN in HeLa S3 cells, but degradation was impaired in TAK1 knockdown cells. In contrast, TGF-β-induced nuclear accumulation of Smad2/3 was observed to be normal in cells expressing TAK1 siRNA. To assess the influence of TAK1 knockdown on the TGF-β-dependent biological events, we examined expression of a TGF-β-responsive gene, PAI-1. PAI-1 participates in wound healing processes. The mRNA levels of PAI-1 were increased at around 30–60 min, which occurred subsequent to SnoN degradation and Smad accumulation. The accumulation of PAI-1 mRNA in response to TGF-β was impaired in the TAK1 siRNA-expressing cells (Fig. 3C). These results suggest that TAK1 is involved in TGF-β-dependent biological processes. We found that the N-terminal region of SnoN-(1–366) was also associated with TAK1 in 293 cells by co-immunoprecipitation assays (Fig. 1C). This region is identical in four isoforms of SnoN and sufficient for transcriptional repression (supplemental Fig. S2 and Refs. 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar and 26Liu X. Sun Y. Weinberg R.A. Lodish H.F. Cytokine Growth Factor Rev. 2001; 12: 1-8Crossref PubMed Scopus (176) Google Scholar). To determine whether the N terminus of SnoN is sufficient for TGF-β-dependent degradation, we generated HaCaT cells stably expressing HA-tagged SnoN-(1–366). We found that TGF-β treatment induced degradation of SnoN-(1–366) (Fig. 4A). We had shown previously that (5Z)-7-oxozeaenol selectively blocks the activity of endogenous TAK1 (23Ninomiya-Tsuji J. Kajino T. Ono K. Ohtomo T. Matsumoto M. Shiina M. Mihara M. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2003; 278: 18485-18490Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar). To determine whether the decrease of the SnoN-(1–366) depends on TAK1 activity, we treated the cells with the TAK1 inhibitor. The SnoN degradation was blocked by TAK1 inhibition. Thus, SnoN-(1–366) is likely to be degraded through TAK1-dependent phosphorylation. To further dissect the role of TAK1 on SnoN degradation, we used SnoN-(1–366). To confirm whether TAK1 phosphorylates SnoN-(1–366), we prepared bacterially expressed recombinant GST-SnoN-(1–366) and preformed in vitro kinase assay using immunoprecipitated HA-TAK1 from 293 cells co-transfected with HA-TAK1 and TAB1. TAK1 is activated by co-expression of TAB1 (21Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (520) Google Scholar, 27Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). We found that TAK1, but not the kinase-inactive TAK1(K63W), could phosphorylate SnoN-(1–366) in vitro (Fig. 4B). To further confirm the phosphorylation of SnoN-(1–366) by TAK1 in vivo, we performed immunoblotting analysis and looked for a mobility shift in SDS-PAGE as an indicator of phosphorylation. In 293 cells, co-expression of TAK1 and TAB1 led to the appearance of a slower migrating form of SnoN-(1–366) (Fig. 4C). This shift in migration was reversed by treatment with phosphatase. These results suggest that TAK1 phosphorylates the N terminus of SnoN in vivo. To define the approximate region of SnoN phosphorylated by TAK1, we generated several truncated versions of SnoN-(1–366). Among the short regions of SnoN, we found that SnoN-(101–214) showed a slower migrating band with co-expression of TAK1 and TAB1 (supplemental Fig. S3A). We then generated a series of SnoN-(101–214) mutants that contain several amino acid substitutions from Ser or Thr to Ala. The analysis suggests that Ser-108, Ser-112, Ser-115, Ser-117, Thr-119, Ser-126, Ser-140, and/or Ser-141 are potential phosphorylation sites. We generated a mutant SnoN-(1–366) containing the Ser/Thr to Ala substitutions at Ser-108, Ser-112, Ser-115, Ser-117, Thr-119, Ser-126, Ser-140, and Ser-141 (SnoN-(1–366 8A)), which did not show slowly migrating band with co-expression of TAK1 and TAB1 (supplemental Fig. S3B). It has been reported that a member of the MAPKKK family phosphorylates substrates within a conserved Ser/Thr-X-X-X-Ser/Thr motif (28Cobb M.H. Goldsmith E.J. J. Biol. Chem. 1995; 270: 14843-14846Abstract Full Text Full Text PDF PubMed Scopus (1662) Google Scholar). We also generated SnoN(1–366 AAA), containing mutations of Ser-115, Ser-117, and Thr-119 to Ala and examined TAK1-dependent phosphorylation. SnoN(1–366 AAA) exhibited decreased phosphorylation by TAK1 (Fig. 4C and supplemental Fig. S3B). These results suggest that Ser-115, Ser-117, or/and Thr-119 are major sites of TAK1-dependent phosphorylation. However, we could still detect a slightly slower migrating band of SnoN-(1–366 AAA) when coexpressed with an active TAK1. It is likely that other sites among the eight amino acid residues may also be phosphorylated by TAK1. SnoN is ubiquitinated and degraded upon TGF-β stimulation (11Stroschein S.L. Bonni S. Wrana J.L. Luo K. Genes Dev. 2001; 15: 2822-2836Crossref PubMed Google Scholar, 13Sun Y. Liu X. Ng-Eaton E. Lodish H.F. Weinberg R.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12442-12447Crossref PubMed Scopus (226) Google Scholar). Our finding raised the possibility that TAK1-dependent phosphorylation of SnoN may induce SnoN ubiquitination and degradation. To investigate the relationship between SnoN phosphorylation and ubiquitination, we asked whether TAK1 induces SnoN ubiquitination. 293 cells were transfected with HA-tagged SnoN or SnoN-(1–366), TAK1, TAB1, and FLAG-ubiquitin. We immunoprecipitated SnoN followed by immunoblotting for ubiquitin (anti-FLAG) (Fig. 5A). The full-length SnoN was ubiquitinated to some extent in the absence of TAK1, and the level of ubiquitination was increased by co-expression of TAK1 + TAB1. However, the kinase-inactive TAK1(K63W) could not increase the ubiquitination. This suggests that TAK1-dependent phosphorylation of SnoN can trigger its ubiquitination. To verify the role of TAK1-dependent phosphorylation, we used the SnoN mutant lacking the phosphorylation sites SnoN(1–366 AAA). 293 cells were transfected with FLAG-tagged SnoN-(1–366), TAK1, TAB1, and HA-tagged ubiquitin. SnoN-(1–366) was immunoprecipitated with anti-FLAG antibody, and ubiquitinated SnoN-(1–366) was detected by immunoblotting with anti-HA antibody (Fig. 5B). Co-expression of TAK1 and TAB1 resulted in a marked increase in the ubiquitination of SnoN-(1–366). In contrast, SnoN(1–366 AAA) mutant, which lacks major phosphorylation sties, showed almost no ubiquitination under the same conditions. To further investigate the effect of TAK1 phosphorylation on the full-length SnoN, we generated a mutant full-length SnoN carrying the mutation at Ser-115, Ser-117, and/or Thr-119 (SnoN AAA). Although the basal level of ubiquitination was unchanged in the mutant SnoN (SnoN AAA), The TAK1 + TAB1-induced increase of ubiquitination was abrogated in SnoN AAA. These results suggest that phosphorylation of SnoN at Ser-115, Ser-117, and/or Thr-119 by TAK1 is important for SnoN ubiquitination. We next examined the effect of SnoN phosphorylation on its degradation. 293 cells were transfected with SnoN-(1–366), SnoN-(1–366) mutant SnoN-(1–366 AAA), TAK1, and TAB1, and the half-life of SnoN-(1–366) was determined following cycloheximide treatment (Fig. 6A). In the absence of the active TAK1, SnoN-(1–366) was stable and was not significantly degraded until 2 h after the cycloheximide treatment, whereas the half-life was significantly shortened when TAK1 was activated. The SnoN-(1–366 AAA) mutant showed a longer half-life compared with the wild type SnoN-(1–366) in the presence of active TAK1 (TAK1 + TAB1). These results suggest that phosphorylation at Ser-115, Ser-117, and Thr-119 is important for degradation of SnoN. To investigate whether phosphorylation of SnoN was required for TGF-β-induced degradation, we generated HaCaT cells stably expressing SnoN-(1–366), and SnoN-(1–366 AAA) mutant. Whereas SnoN-(1–366) was rapidly decreased in response to TGF-β stimulation, the SnoN-(1–366 AAA) levels decreased slowly compared with the wild type (Fig. 6B). Finally, we tested the TGF-β-induced degradation of the full-length SnoN. We generated HaCaT cells stably expressing SnoN wild type and AAA mutant and examined their levels upon TGF-β treatment (Fig. 6C). We used two independent stable clones that express SnoN or SnoN AAA at different levels. SnoN AAA decreased slowly compared with the wild type SnoN in both clones. These results suggest that TAK1-dependent phosphorylation is important for the TGF-β-induced degradation of SnoN. Our data have demonstrated that mutation of SnoN and SnoN-(1–366) at Ser-115, Ser-117, and Thr-119 reduced TGF-β-induced degradation; however, SnoN AAA and SnoN-(1–366 AAA) were still degraded at 30 min after TGF-β stimulation. This may be consistent with the fact that SnoN-(1–366 AAA) was still phosphorylated to some extent by TAK1 (Fig. 4C). Other phosphorylation sites may participate in SnoN degradation. To examine this possibility, we determined the half-life of SnoN-(1–366 8A) (supplemental Fig. S3C). SnoN-(1–366 8A) was stable even when TAK1 was activated. We also generated HaCaT cells stably expressing SnoN-(1–366 8A) and examined the effect of TGF-β treatment (supplemental Fig. S3D). SnoN-(1–366 8A) was not degraded by TGF-β and was much more stable compared with SnoN-(1–366 AAA). Thus, although Ser-115, Ser-117, and Thr-119 may be major sites of TAK1-dependent phosphorylation, phosphorylation at other sites is likely to participate in the induction of SnoN degradation. SnoN represses TGF-β signaling by recruiting transcriptional repressors to Smad complex (3Wrana J.L. Attisano L. Wieser R. Ventura F. Massague J. Nature. 1994; 370: 341-347Crossref PubMed Scopus (2114) Google Scholar, 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). We next examined whether the phosphorylation of SnoN modulates its transcriptional activity. Transient transfection experiments were performed in 293 cells with a transcriptional reporter, 3TP-lux, which contains TGF-β-responsive elements of the PAI-1 promoter region (29Wrana J.L. Attisano L. Carcamo J. Zentella A. Doody J. Laiho M. Wang X.F. Massague J. Cell. 1992; 71: 1003-1014Abstract Full Text PDF PubMed Scopus (1369) Google Scholar). At 48 h after transfection, cell lysates were prepared, and luciferase activities were measured (supplemental Fig. S2). The constitutively active form of TGF-β receptor ALK5(TD) was sufficient to induce the expression of a TGF-β-responsive gene in 293 cells, and overexpressed full-length SnoN as well as SnoN-(1–366) suppressed the TGF-β-dependent transcription as reported previously (3Wrana J.L. Attisano L. Wieser R. Ventura F. Massague J. Nature. 1994; 370: 341-347Crossref PubMed Scopus (2114) Google Scholar, 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). SnoN-(1–366 AAA and 8A) mutants could also reduce the TGF-β-dependent transcription, suggesting that the mutation does not affect binding to Smads or to transcriptional co-repressors. SnoN-(1–366) mutants may be a more potent inhibitor compared with SnoN-(1–366), because it is stable upon TGF-β stimulation. However, in the transiently transfection experiments, we could not detect the difference between SnoN-(1–366) and SnoN-(1–366 AAA and 8A), which is likely because they were highly expressed and ALK5(TD) could not effectively reduce the amount of SnoN-(1–366). Collectively, our results suggest that SnoN-(1–366 AAA and 8A) can bind to and inhibit Smads but is resistant to TAK1-mediated degradation. Therefore, TAK1 is likely to inhibit SnoN by modulating SnoN stability. In this report, we have determined the role of TAK1 MAP-KKK in TGF-β. Previous works had shown that TAK1 is activated by TGF-β (15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1175) Google Scholar) and that SnoN, an inhibitor of Smads, is degraded upon TGF-β stimulation (13Sun Y. Liu X. Ng-Eaton E. Lodish H.F. Weinberg R.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12442-12447Crossref PubMed Scopus (226) Google Scholar). This study links these two observations and suggests that TAK1 contributes to the induction of TGF-β-responsive genes by inducing the degradation of SnoN (Fig. 7). SnoN has been shown to be the important negative regulator of TGF-β signaling via its interaction with Smad proteins (7Luo K. Curr. Opin. Genet. Dev. 2004; 14: 65-70Crossref PubMed Scopus (177) Google Scholar, 8Sun Y. Liu X. Eaton E.N. Lane W.S. Lodish H.F. Weinberg R.A. Mol. Cell. 1999; 4: 499-509Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar). Upon TGF-β stimulation, SnoN is rapidly degraded by ubiquitin-dependent proteasome pathway (13Sun Y. Liu X. Ng-Eaton E. Lodish H.F. Weinberg R.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12442-12447Crossref PubMed Scopus (226) Google Scholar, 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). Two ubiquitin ligases are reported as SnoN ubiquitin ligases. One is anaphase-promoting complex, which induces the ubiquitination of SnoN on Lys-440, Lys-446, and Lys-449 and its consequent degradation in a Smad3-dependent manner (11Stroschein S.L. Bonni S. Wrana J.L. Luo K. Genes Dev. 2001; 15: 2822-2836Crossref PubMed Google Scholar, 12Wan Y. Liu X. Kirschner M.W. Mol. Cell. 2001; 8: 1027-1039Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). Another ubiquitin ligase is Smurf2, which is recruited to SnoN by Smad2, resulting in the ubiquitination and degradation of SnoN (10Bonni S. Wang H.R. Causing C.G. Kavsak P. Stroschein S.L. Luo K. Wrana J.L. Nat. Cell Biol. 2001; 3: 587-595Crossref PubMed Scopus (273) Google Scholar). SnoN-(1–366), which lacks sites ubiquitinated by APC or Smurf2, is neither ubiquitinated nor degraded in Ba/F3 pro-B cells (14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). However, we show that TGF-β induces degradation of SnoN-(1–366) in human keratinocyte HaCaT cells in a manner dependent on TAK1-induced phosphorylation and ubiquitination. Mutation of TAK1-dependent phosphorylation sites on SnoN-(1–366) blocked TGF-β-dependent degradation. Moreover, when endogenous TAK1 was inactivated by a small molecule TAK1 inhibitor in keratinocyte HaCaT cells or by siRNA-mediated knockdown in epithelial-like HeLa S3 cells, degradation of endogenous SnoN was impaired. Collectively, these results suggest that TAK1 phosphorylation of SnoN is required for its ubiquitination and degradation in some epithelial cells. These results further suggest that several different pathways induce SnoN degradation, depending on the cell type. Phosphorylation-induced degradation of proteins is a widely used mechanism by which protein levels can be modulated rapidly. We have found that TAK1 phosphorylates SnoN-(1–366) at several threonine and serine residues and that the SnoN mutant, which lacks its phosphorylation sites, did not undergo ubiquitination or degradation. We should note that the mutant SnoN is still capable of inhibiting TGF-β-induced transcription (supplemental Fig. S2). This indicates that the mutations at the phosphorylation sites do not interfere with interaction of SnoN with Smads or with transcriptional co-repressors. TAK1 is likely to inhibit SnoN solely by modulating SnoN stability. TAK1 is the first kinase demonstrated to phosphorylate SnoN and target it for ubiquitin-dependent proteasomal degradation. We thank H. Shibuya for the siRNA vector and R. Smart for discussion. Download .pdf (.59 MB) Help with pdf files}, number={13}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Kajino, Taisuke and Omori, Emily and Ishii, Shunsuke and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2007}, month={Mar}, pages={9475–9481} }
 @article{huangfu_omori_akira_matsumoto_ninomiya-tsuji_2006, title={Osmotic Stress Activates the TAK1-JNK Pathway While Blocking TAK1-mediated NF-κB Activation}, volume={281}, ISSN={0021-9258 1083-351X}, url={http://dx.doi.org/10.1074/JBC.M603627200}, DOI={10.1074/JBC.M603627200}, abstractNote={Osmotic stress activates MAPKs, including JNK and p38, which play important roles in cellular stress responses. Transforming growth factor-β-activated kinase 1 (TAK1) is a member of the MAPK kinase kinase (MAPKKK) family and can activate JNK and p38. TAK1 can also activate IκB kinase (IKK) that leads to degradation of IκB and subsequent NF-κB activation. We found that TAK1 is essential for osmotic stress-induced activation of JNK but is not an exclusive mediator of p38 activation. Furthermore, we found that although TAK1 was highly activated upon osmotic stress, it could not induce degradation of IκB or activation of NF-κB. These results suggest that TAK1 activity is somehow modulated to function specifically in osmotic stress signaling, leading to the activation of JNK but not of IKK. To elucidate the mechanism underlying this modulation, we screened for potential TAK1-binding proteins. We found that TAO2 (thousand-and-one amino acid kinase 2) associates with TAK1 and can inhibit TAK1-mediated activation of NF-κB but not of JNK. We observed that TAO2 can interfere with the interaction between TAK1 and IKK and thus may regulate TAK1 function. TAK1 is activated by many distinct stimuli, including cytokines and stresses, and regulation by TAO2 may be important to activate specific intracellular signaling pathways that are unique to osmotic stress.}, number={39}, journal={Journal of Biological Chemistry}, publisher={American Society for Biochemistry & Molecular Biology (ASBMB)}, author={HuangFu, Wei-Chun and Omori, Emily and Akira, Shizuo and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2006}, month={Aug}, pages={28802–28810} }
 @article{huangfu_omori_akira_matsumoto_ninomiya-tsuji_2006, title={Osmotic stress activates the TAK1-JNK pathway while blocking TAK1-mediated NF-kappa B activation - TAO2 regulates TAK1 pathways}, volume={281}, DOI={10.1014/jbc.M60362/200}, number={39}, journal={Journal of Biological Chemistry}, author={Huangfu, W. C. and Omori, E. and Akira, S. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2006}, pages={28802–28810} }
 @article{kajino_ren_iemura_natsume_stefansson_brautigan_matsumoto_ninomiya-tsuji_2006, title={Protein phosphatase 6 down-regulates TAK1 kinase activation in the IL-1 signaling pathway}, volume={281}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M608155200}, abstractNote={TAK1 (transforming growth factor β-activated kinase 1) is a serine/threonine kinase that is a mitogen-activated protein kinase kinase kinase and an essential intracellular signaling component in inflammatory signaling pathways. Upon stimulation of cells with inflammatory cytokines, TAK1 binds proteins that stimulate autophosphorylation within its activation loop and is thereby catalytically activated. This activation is transient; it peaks within a couple of minutes and is subsequently down-regulated rapidly to basal levels. The mechanism of down-regulation of TAK1 has not yet been elucidated. In this study, we found that toxin inhibition of type 2A protein phosphatases greatly enhances interleukin 1 (IL-1)-dependent phosphorylation of Thr-187 in the TAK1 activation loop as well as the catalytic activity of TAK1. From proteomic analysis of TAK1-binding proteins, we identified protein phosphatase 6 (PP6), a type-2A phosphatase, and demonstrated that PP6 associated with and inactivated TAK1 by dephosphorylation of Thr-187. Ectopic and endogenous PP6 co-precipitated with TAK1, and expression of PP6 reduced IL-1 activation of TAK1 but did not affect osmotic activation of MLK3, another MAPKKK. Reduction of PP6 expression by small interfering RNA enhances IL-1-induced phosphorylation of Thr-187 in TAK1. Enhancement occurred without change in levels of PP2A showing specificity for PP6. Our results demonstrate that PP6 specifically down-regulates TAK1 through dephosphorylation of Thr-187 in the activation loop, which is likely important for suppressing inflammatory responses via TAK1 signaling pathways.}, number={52}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Kajino, Taisuke and Ren, Hong and Iemura, Shun-ichiro and Natsume, Tohru and Stefansson, Bjarki and Brautigan, David L. and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2006}, month={Dec}, pages={39891–39896} }
 @article{uemura_kajino_sanjo_sato_akira_matsumoto_ninomiya-tsuji_2006, title={TAK1 is a component of the Epstein-Barr virus LMP1 complex and is essential for activation of JNK but not of NF-kappa B}, volume={281}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M509834200}, abstractNote={Epstein-Barr virus latent membrane protein 1 (LMP1) activates NF-kappaB and c-Jun N-terminal kinase (JNK), which is essential for LMP1 oncogenic activity. Genetic analysis has revealed that tumor necrosis factor receptor-associated factor 6 (TRAF6) is an indispensable intermediate of LMP1 signaling leading to activation of both NF-kappaB and JNK. However, the mechanism by which LMP1 engages TRAF6 for activation of NF-kappaB and JNK is not well understood. Here we demonstrate that TAK1 mitogen-activated protein kinase kinase kinase and TAK1-binding protein 2 (TAB2), together with TRAF6, are recruited to LMP1 through its N-terminal transmembrane region. The C-terminal cytoplasmic region of LMP1 facilitates the assembly of this complex and enhances activation of JNK. In contrast, IkappaB kinase gamma is recruited through the C-terminal cytoplasmic region and this is essential for activation of NF-kappaB. Furthermore, we found that ablation of TAK1 resulted in the loss of LMP1-induced activation of JNK but not of NF-kappaB. These results suggest that an LMP1-associated complex containing TRAF6, TAB2, and TAK1 plays an essential role in the activation of JNK. However, TAK1 is not an exclusive intermediate for NF-kappaB activation in LMP1 signaling.}, number={12}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Uemura, N and Kajino, T and Sanjo, H and Sato, S and Akira, S and Matsumoto, K and Ninomiya-Tsuji, J}, year={2006}, month={Mar}, pages={7863–7872} }
 @article{omori_matsumoto_sanjo_sato_akira_smart_ninomiya-tsuji_2006, title={TAK1 is a master regulator of epidermal homeostasis involving skin inflammation and apoptosis}, volume={281}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M603384200}, abstractNote={Transforming growth factor beta-activated kinase 1 (TAK1) functions downstream of inflammatory cytokines to activate c-Jun N-terminal kinase (JNK) as well as NF-kappaB in several cell types. However, the functional role of TAK1 in an in vivo setting has not been determined. Here we have demonstrated that TAK1 is the major regulator of skin inflammation as well as keratinocyte death in vivo. Epidermal-specific deletion of TAK1 causes a severe inflammatory skin condition by postnatal day 6-8. The mutant skin also exhibits massive keratinocyte death. Analysis of keratinocytes isolated from the mutant skin revealed that TAK1 deficiency results in a striking increase in apoptosis in response to tumor necrosis factor (TNF). TAK1-deficient keratinocytes cannot activate NF-kappaB or JNK upon TNF treatment. These results suggest that TNF induces TAK1-deficient keratinocyte death because of the lack of NF-kappaB (and possibly JNK)-mediated cell survival signaling. Finally, we have shown that deletion of the TNF receptor can largely rescue keratinocyte death as well as inflammatory skin condition in epidermal-specific TAK1-deficient mice. Our results demonstrate that TAK1 is a master regulator of TNF signaling in skin and regulates skin inflammation and keratinocyte death.}, number={28}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Omori, Emily and Matsumoto, Kunihiro and Sanjo, Hideki and Sato, Shintaro and Akira, Shizuo and Smart, Robert C. and Ninomiya-Tsuji, Jun}, year={2006}, month={Jul}, pages={19610–19617} }
 @article{sato_sanjo_tsujimura_ninomiya-tsuji_yamamoto_kawai_takeuchi_akira_2006, title={TAK1 is indispensable for development of T cells and prevention of colitis by the generation of regulatory T cells}, volume={18}, ISSN={["1460-2377"]}, DOI={10.1093/intimm/dxl082}, abstractNote={Transforming growth factor (TGF)-beta-activating kinase 1 (TAK1) is critical for Toll-like receptor- and tumor necrosis factor-mediated cellular responses. In B cells, TAK1 is essential for the activation of mitogen-activated protein kinases (MAPKs), but not nuclear factor-kappaB (NF-kappaB), in antigen receptor signaling. In this study, we generate T cell-specific TAK1-deficient (Lck(Cre/(+))Tak1(flox/flox)) mice and show that TAK1 is indispensable for the maintenance of peripheral CD4 and CD8 T cells. In thymocytes, TAK1 is essential for TCR-mediated activation of both NF-kappaB and MAPKs. Additionally, Lck(Cre/(+))Tak1(flox/flox) mice developed colitis as they aged. In these mice, accumulations of activated/memory T cells as well as B cells were observed. Development of regulatory T (Treg) cells in thymus was abrogated in Lck(Cre/(+))Tak1(flox/flox) mice, suggesting that the loss of Treg cells is the cause of the disease. Together, the results show that TAK1, by controlling the generation of central Treg cells, is important for preventing spontaneously developing colitis.}, number={10}, journal={INTERNATIONAL IMMUNOLOGY}, author={Sato, Shintaro and Sanjo, Hideki and Tsujimura, Tohru and Ninomiya-Tsuji, Jun and Yamamoto, Masahiro and Kawai, Taro and Takeuchi, Osamu and Akira, Shizuo}, year={2006}, month={Oct}, pages={1405–1411} }
 @article{ninomiya-tsuji_matsumoto_2006, title={Tab1}, ISSN={1477-5921}, url={http://dx.doi.org/10.1038/mp.a002247.01}, DOI={10.1038/mp.a002247.01}, journal={AfCS-Nature Molecule Pages}, publisher={Springer Science and Business Media LLC}, author={Ninomiya-Tsuji, Jun and Matsumoto, Kunihiro}, year={2006}, month={Mar} }
 @article{ninomiya-tsuji_matsumoto_2006, title={Tak1}, ISSN={1477-5921}, url={http://dx.doi.org/10.1038/mp.a002249.01}, DOI={10.1038/mp.a002249.01}, journal={AfCS-Nature Molecule Pages}, publisher={Springer Science and Business Media LLC}, author={Ninomiya-Tsuji, Jun and Matsumoto, Kunihiro}, year={2006}, month={Jan} }
 @article{li_miller_ninomiya-tsuji_russell_young_2005, title={AMP-activated protein kinase activates p38 mitogen-activated protein kinase by increasing recruitment of p38 MAPK to TAB1 in the ischemic heart}, volume={97}, ISSN={["1524-4571"]}, DOI={10.1161/01.RES.0000187458.77026.10}, abstractNote={AMP-activated protein kinase (AMPK) promotes glucose transport, maintains ATP stores, and prevents injury and apoptosis during ischemia. AMPK has several direct molecular targets in the heart but also may interact with other stress-signaling pathways. This study examined the role of AMPK in the activation of the p38 mitogen-activated protein kinase (MAPK). In isolated heart muscles, the AMPK activator 5-aminoimidazole-4-carboxy-amide-1-beta-D-ribofuranoside (AICAR) increased p38 MAPK activation. In AMPK-deficient mouse hearts, expressing a kinase-dead (KD) alpha2 catalytic subunit, p38 MAPK activation was markedly reduced during low-flow ischemia (2.3- versus 7-fold in wild-type hearts, P<0.01) and was similarly reduced during severe no-flow ischemia in KD hearts (P<0.01 versus ischemic wild type). Knockout of the p38 MAPK upstream kinase, MAPK kinase 3 (MKK3), did not affect ischemic activation of either AMPK or p38 MAPK in transgenic mkk3(-/-) mouse hearts. Ischemia increased p38 MAPK recruitment to transforming growth factor-beta-activated protein kinase 1-binding protein 1 (TAB1), a scaffold protein that promotes p38 MAPK autophosphorylation. Moreover, TAB1 was associated with the alpha2 catalytic subunit of AMPK. p38 MAPK recruitment to TAB1/AMPK complexes required AMPK activation and was reduced in ischemic AMPK-deficient transgenic mouse hearts. The potential role of p38 MAPK in mediating the downstream action of AMPK to promote glucose transport was also assessed. The p38 MAPK inhibitor SB203580 partially inhibited both AICAR- and hypoxia-stimulated glucose uptake and GLUT4 translocation. Activation of p38 MAPK by anisomycin also increased glucose transport in heart muscles. Thus, AMPK has an important role in promoting p38 MAPK activation in the ischemic heart by inducing p38 MAPK autophosphorylation through interaction with the scaffold protein TAB1.}, number={9}, journal={CIRCULATION RESEARCH}, author={Li, J and Miller, EJ and Ninomiya-Tsuji, J and Russell, RR and Young, LH}, year={2005}, month={Oct}, pages={872–879} }
 @article{sato_sanjo_takeda_ninomiya-tsuji_yamamoto_kawai_matsumoto_takeuchi_akira_2005, title={Essential function for the kinase TAK1 in innate and adaptive immune responses}, volume={6}, ISSN={["1529-2916"]}, DOI={10.1038/ni1255}, number={11}, journal={NATURE IMMUNOLOGY}, author={Sato, S and Sanjo, H and Takeda, K and Ninomiya-Tsuji, J and Yamamoto, M and Kawai, T and Matsumoto, K and Takeuchi, O and Akira, S}, year={2005}, month={Nov}, pages={1087–1095} }
 @article{kishida_sanjo_akira_matsumoto_ninomiya-tsuji_2005, title={TAK1-binding protein 2 facilitates ubiquitination of TRAF6 and assembly of TRAF6 with IKK in the IL-1 signaling pathway}, volume={10}, ISSN={["1365-2443"]}, DOI={10.1111/j.1365-2443.2005.00852.x}, abstractNote={TAK1 mitogen-activated protein kinase kinase kinase participates in the Interleukin-1 (IL-1) signaling pathway by mediating activation of JNK, p38, and NF-kappaB. TAK1-binding protein 2 (TAB2) was previously identified as an adaptor that links TAK1 to an upstream signaling intermediate, tumor necrosis factor receptor-associated factor 6 (TRAF6). Recently, ubiquitination of TRAF6 was shown to play an essential role in the activation of TAK1. However, the mechanism by which IL-1 induces TRAF6 ubiquitination remains to be elucidated. Here we report that TAB2 functions to facilitate TRAF6 ubiquitination and thereby mediates IL-1-induced cellular events. A conserved ubiquitin binding domain in TAB2, the CUE domain, is important for this function. We also found that TAB2 promotes the assembly of TRAF6 with a downstream kinase, IkappaB kinase (IKK). These results show that TAB2 acts as a multifunctional signaling molecule, facilitating both IL-1-dependent TRAF6 ubiquitination and assembly of the IL-1 signaling complex.}, number={5}, journal={GENES TO CELLS}, author={Kishida, S and Sanjo, H and Akira, S and Matsumoto, K and Ninomiya-Tsuji, J}, year={2005}, month={May}, pages={447–454} }
 @article{safwat_ninomiya-tsuji_gore_miller_2005, title={Transforming growth factor beta-activated kinase 1 is a key mediator of ovine follicle-stimulating hormone beta-subunit expression}, volume={146}, ISSN={["1945-7170"]}, DOI={10.1210/en.2005-0457}, abstractNote={FSH, a key regulator of gonadal function, contains a β-subunit (FSHβ) that is transcriptionally induced by activin, a member of the TGFβ-superfamily. This study used 4.7 kb of the ovine FSHβ-promoter linked to luciferase (oFSHβLuc) plus a well-characterized activin-responsive construct, p3TPLuc, to investigate the hypothesis that Smad3, TGFβ-activated kinase 1 (TAK1), or both cause activin-mediated induction of FSH. Overexpression of either Smad3 or TAK1 induced oFSHβLuc in gonadotrope-derived LβT2 cells as much as activin itself. Induction of p3TPLuc by activin is known to require Smad3 activation in many cell types, and this was true in LβT2 cells, where 10-fold induction by activin (2–8 h after activin treatment) was blocked more than 90% by two dominant negative (DN) inhibitors of Smad3 [DN-Smad3 (3SA) and DN-Smad3 (D407E)]. By contrast, 6.5-fold induction of oFSHβLuc by activin (10–24 h after activin treatment) was not blocked by either DN-Smad inhibitor, suggesting that activation of Smad3 did not trigger induction of oFSHβLuc. By contrast, inhibition of TAK1 by a DN-TAK1 construct led to a 50% decrease in activin-mediated induction of oFSHβLuc, and a specific inhibitor of TAK1 (5Z-7-Oxozeanol) blocked induction by 100%, indicating that TAK1 is necessary for activin induction of oFSHβLuc. Finally, inhibiting p38-MAPK (often activated by TAK1) blocked induction of oFSHβLuc by 60%. In conclusion, the data presented here indicate that activation of TAK1 (and probably p38-MAPK), but not Smad3, is necessary for triggering induction of oFSHβ by activin.}, number={11}, journal={ENDOCRINOLOGY}, author={Safwat, N and Ninomiya-Tsuji, J and Gore, AJ and Miller, WL}, year={2005}, month={Nov}, pages={4814–4824} }
 @article{akiyama_yonezawa_kudo_li_wang_ito_yoshioka_ninomiya-tsuji_matsumoto_kanamaru_et al._2004, title={Activation mechanism of c-Jun amino-terminal kinase in the course of neural differentiation of P19 embryonic carcinoma cells}, volume={279}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M406610200}, abstractNote={P19 embryonic carcinoma cells, a model system for studying early development and differentiation, can differentiate into neurons and primitive endoderm-like cells depending on the culture conditions. We have previously reported that the activation of c-Jun amino-terminal kinase (JNK) is required for the retinoic acid-induced neural differentiation of P19 cells. However, the signaling pathway(s) responsible for the activation of JNK has not been known. In this study, we demonstrated that activities of MAPK kinase 4 (MKK4) and TAK1, one of the upstream kinases of MKK4, were enhanced in the neurally differentiating cells. Inhibition of the neural differentiation by an overexpression of protein phosphatase 2Cϵ, an inactivator of TAK1, suggested a critical role of the TAK1 signaling pathway during the differentiation. Confocal microscopic analysis indicated that TAK1, phospho-MKK4, and phospho-JNK were colocalized with tubulin in the neurites and localized also in the nuclei of the differentiating cells. In contrast, two TAK1-binding proteins, TAB1 and TAB2, which are involved in the activation of TAK1, were localized in the neurites and the nuclei of the differentiating cells, respectively. These results suggest that two distinct TAK1-MKK4-JNK signaling pathways are independently activated at the different intracellular locations and may participate in the regulation of the neural differentiation of P19 cells.}, number={35}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Akiyama, S and Yonezawa, T and Kudo, TA and Li, MG and Wang, H and Ito, M and Yoshioka, K and Ninomiya-Tsuji, J and Matsumoto, K and Kanamaru, R and et al.}, year={2004}, month={Aug}, pages={36616–36620} }
 @article{takeda_matsuzawa_nishitoh_tobiume_kishida_ninomiya‐tsuji_matsumoto_ichijo_2004, title={Involvement of ASK1 in Ca
            2+
            ‐induced p38 MAP kinase activation}, volume={5}, ISSN={1469-221X 1469-3178}, url={http://dx.doi.org/10.1038/sj.embor.7400072}, DOI={10.1038/sj.embor.7400072}, abstractNote={The mammalian mitogen-activated protein (MAP) kinase kinase kinase apoptosis signal-regulating kinase 1 (ASK1) is a pivotal component in cytokine- and stress-induced apoptosis. It also regulates cell differentiation and survival through p38 MAP kinase activation. Here we show that Ca2+ signalling regulates the ASK1-p38 MAP kinase cascade. Ca2+ influx evoked by membrane depolarization in primary neurons and synaptosomes induced activation of p38, which was impaired in those derived from ASK1-deficient mice. Ca2+/calmodulin-dependent protein kinase type II (CaMKII) activated ASK1 by phosphorylation. Moreover, p38 activation induced by the expression of constitutively active CaMKII required endogenous ASK1. Thus, ASK1 is a critical intermediate of Ca2+ signalling between CaMKII and p38 MAP kinase.}, number={2}, journal={EMBO reports}, publisher={EMBO}, author={Takeda, Kohsuke and Matsuzawa, Atsushi and Nishitoh, Hideki and Tobiume, Kei and Kishida, Satoshi and Ninomiya‐Tsuji, Jun and Matsumoto, Kunihiro and Ichijo, Hidenori}, year={2004}, month={Jan}, pages={161–166} }
 @article{ono_ohtomo_ninomiya-tsuji_tsuchiya_2003, title={A dominant negative TAK1 inhibits cellular fibrotic responses induced by TGF-beta}, volume={307}, ISSN={["0006-291X"]}, DOI={10.1016/S0006-291X(03)01207-5}, abstractNote={Transforming growth factor-beta (TGF-beta) is crucially virulent in the progression of fibrotic disorders. TAK1 (TGF-beta activated kinase 1) is one of the mitogen-activated kinase kinase kinase (MAPKKK) that is involved in TGF-beta signal transduction. To elucidate the importance of TAK1 in TGF-beta-induced fibrotic marker expression, we investigated whether dominant negative TAK1 could suppress TGF-beta signaling. Based on the finding that TAB1 (TAK1 binding protein 1) binding to TAK1 is required for TAK1 activation, a minimal portion of TAK1 lacking kinase activity that binds to TAB1 was designed as a TAK1 dominant negative inhibitor (TAK1-DN). The effect of TAK1-DN was assessed in the cells that respond to TGF-beta stimulation and that lead to the increase in production of extracellular matrix (ECM) proteins. TAK1-DN, indeed, decreased the ECM protein production, indicating that TAK1-DN retains the ability to intercept the TGF-beta signaling effectively.}, number={2}, journal={BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS}, author={Ono, K and Ohtomo, T and Ninomiya-Tsuji, J and Tsuchiya, M}, year={2003}, month={Jul}, pages={332–337} }
 @article{ninomiya-tsuji_kajino_ono_ohtomo_matsumoto_shiina_mihara_tsuchiya_matsumoto_2003, title={A resorcylic acid lactone, 5Z-7-oxozeaenol, prevents inflammation by inhibiting the catalytic activity of TAK1 MAPK kinase kinase}, volume={278}, ISSN={["0021-9258"]}, DOI={10.1074/jbc.M207453200}, abstractNote={TAK1, a member of the mitogen-activated kinase kinase kinase (MAPKKK) family, participates in proinflammatory cellular signaling pathways by activating JNK/p38 MAPKs and NF-kappaB. To identify drugs that prevent inflammation, we screened inhibitors of TAK1 catalytic activity. We identified a natural resorcylic lactone of fungal origin, 5Z-7-oxozeaenol, as a highly potent inhibitor of TAK1. This compound did not effectively inhibit the catalytic activities of the MEKK1 or ASK1 MAPKKKs, suggesting that 5Z-7-oxozeaenol is a selective inhibitor of TAK1. In cell culture, 5Z-7-oxozeaenol blocked interleukin-1-induced activation of TAK1, JNK/p38 MAPK, IkappaB kinases, and NF-kappaB, resulting in inhibition of cyclooxgenase-2 production. Furthermore, in vivo 5Z-7-oxozeaenol was able to inhibit picryl chloride-induced ear swelling. Thus, 5Z-7-oxozeaenol blocks proinflammatory signaling by selectively inhibiting TAK1 MAPKKK.}, number={20}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Ninomiya-Tsuji, J and Kajino, T and Ono, K and Ohtomo, T and Matsumoto, M and Shiina, M and Mihara, M and Tsuchiya, M and Matsumoto, K}, year={2003}, month={May}, pages={18485–18490} }
 @article{li_katsura_nomiyama_komaki_ninomiya-tsuji_matsumoto_kobayashi_tamura_2003, title={Regulation of the interleukin-1-induced signaling pathways by a novel member of the protein phosphatase 2C family (PP2C epsilon)}, volume={278}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M211474200}, abstractNote={Although TAK1 signaling plays essential roles in eliciting cellular responses to interleukin-1 (IL-1), a proinflammatory cytokine, how the IL-1-TAK1 signaling pathway is positively and negatively regulated remains poorly understood. In this study, we investigated the possible role of a novel protein phosphatase 2C (PP2C) family member, PP2Cε, in the regulation of the IL-1-TAK1 signaling pathway. PP2Cε was composed of 303 amino acids, and the overall similarity of amino acid sequence between PP2Cε and PP2Cα was found to be 267. Ectopic expression of PP2Cε inhibited the IL-1- and TAK1-induced activation of mitogen-activated protein kinase kinase 4 (MKK4)-c-Jun N-terminal kinase or MKK3-p38 signaling pathway. PP2Cε dephosphorylated TAK1 <i>in vitro</i>. Co-immunoprecipitation experiments indicated that PP2Cε associates stably with TAK1 and attenuates the binding of TAK1 to MKK4 or MKK6. Ectopic expression of a phosphatase-negative mutant of PP2Cε, PP2Cε(D/A), which acted as a dominant negative form, enhanced both the association between TAK1 and MKK4 or MKK6 and the TAK1-induced activation of an AP-1 reporter gene. The association between PP2Cε and TAK1 was transiently suppressed by IL-1 treatment of the cells. Taken together, these results suggest that, in the absence of IL-1-induced signal, PP2Cε contributes to keeping the TAK1 signaling pathway in an inactive state by associating with and dephosphorylating TAK1.AY184801}, number={14}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Li, MG and Katsura, K and Nomiyama, H and Komaki, K and Ninomiya-Tsuji, J and Matsumoto, K and Kobayashi, T and Tamura, S}, year={2003}, month={Apr}, pages={12013–12021} }
 @article{takaesu_surabhi_park_ninomiya-tsuji_matsumoto_gaynor_2003, title={TAK1 is critical for I kappa B kinase-mediated activation of the NF-kappa B pathway}, volume={326}, ISSN={["0022-2836"]}, DOI={10.1016/S0022-2836(02)01404-3}, abstractNote={Cytokine treatment stimulates the IkappaB kinases, IKKalpha and IKKbeta, which phosphorylate the IkappaB proteins, leading to their degradation and activation of NF-kappaB regulated genes. A clear definition of the specific roles of IKKalpha and IKKbeta in activating the NF-kappaB pathway and the upstream kinases that regulate IKK activity remain to be elucidated. Here, we utilized small interfering RNAs (siRNAs) directed against IKKalpha, IKKbeta and the upstream regulatory kinase TAK1 in order to better define their roles in cytokine-induced activation of the NF-kappaB pathway. In contrast to previous results with mouse embryo fibroblasts lacking either IKKalpha or IKKbeta, which indicated that only IKKbeta is involved in cytokine-induced NF-kappaB activation, we found that both IKKalpha and IKKbeta were important in activating the NF-kappaB pathway. Furthermore, we found that the MAP3K TAK1, which has been implicated in IL-1-induced activation of the NF-kappaB pathway, was also critical for TNFalpha-induced activation of the NF-kappaB pathway. TNFalpha activation of the NF-kappaB pathway is associated with the inducible binding of TAK1 to TRAF2 and both IKKalpha and IKKbeta. This analysis further defines the distinct in vivo roles of IKKalpha, IKKbeta and TAK1 in cytokine-induced activation of the NF-kappaB pathway.}, number={1}, journal={JOURNAL OF MOLECULAR BIOLOGY}, author={Takaesu, G and Surabhi, RM and Park, KJ and Ninomiya-Tsuji, J and Matsumoto, K and Gaynor, RB}, year={2003}, month={Feb}, pages={105–115} }
 @article{komatsu_shibuya_takeda_ninomiya-tsuji_yasui_miyado_sekimoto_ueno_matsumoto_yamada_2002, title={Targeted disruption of the Tab1 gene causes embryonic lethality and defects in cardiovascular and lung morphogenesis}, volume={119}, ISSN={["0925-4773"]}, DOI={10.1016/S0925-4773(02)00391-X}, abstractNote={The transforming growth factor-beta (TGF-beta) superfamily consists of a group of secreted signaling molecules that perform important roles in the regulation of cell growth and differentiation. TGF-beta activated kinase-1 binding protein-1 (TAB1) was identified as a molecule that activates TGF-beta activated kinase-1 (TAK1). Recent studies have revealed that the TAB1-TAK1 interaction plays an important role in signal transduction in vitro, but little is known about the role of these molecules in vivo. To investigate the role of TAB1 during development, we cloned the murine Tab1 gene and disrupted it by homologous recombination. Homozygous Tab1 mutant mice died, exhibiting a bloated appearance with extensive edema and hemorrhage at the late stages of gestation. By histological examinations, it was revealed that mutant embryos exhibited cardiovascular and lung dysmorphogenesis. Tab1 mutant embryonic fibroblast cells displayed drastically reduced TAK1 kinase activities and decreased sensitivity to TGF-beta stimulation. These results indicate a possibility that TAB1 plays an important role in mammalian embryogenesis and is required for TAK1 activation in TGF-beta signaling.}, number={2}, journal={MECHANISMS OF DEVELOPMENT}, author={Komatsu, Y and Shibuya, H and Takeda, N and Ninomiya-Tsuji, J and Yasui, T and Miyado, K and Sekimoto, T and Ueno, N and Matsumoto, K and Yamada, G}, year={2002}, month={Dec}, pages={239–249} }