@article{sai_nakanishi_scofield_tokarz_linder_cohen_ninomiya-tsuji_2023, title={Aberrantly activated TAK1 links neuroinflammation and neuronal loss in Alzheimer?s disease mouse models}, volume={136}, ISSN={["1477-9137"]}, DOI={10.1242/jcs.260102}, abstractNote={Neuroinflammation is causally associated with Alzheimer's disease (AD) pathology. Reactive glia cells secrete various neurotoxic factors that impair neuronal homeostasis eventually leading to neuronal loss. Although the glial activation mechanism in AD has been relatively well studied, how it perturbs intraneuronal signaling, which ultimately leads to neuronal cell death, remains poorly understood. Here, we report that compound stimulation with the neurotoxic factors TNF and glutamate aberrantly activates neuronal TAK1 (also known as MAP3K7), which promotes the pathogenesis of AD in mouse models. Glutamate-induced Ca2+ influx shifts TNF signaling to hyper-activate TAK1 enzymatic activity through Ca2+/calmodulin-dependent protein kinase II, which leads to necroptotic cellular damage. Genetic ablation and pharmacological inhibition of TAK1 ameliorated AD-associated neuronal loss and cognitive impairment in the AD model mice. Our findings provide a molecular mechanism linking cytokines, Ca2+ signaling and neuronal necroptosis in AD.}, number={6}, journal={JOURNAL OF CELL SCIENCE}, author={Sai, Kazuhito and Nakanishi, Aoi and Scofield, Kimberly M. and Tokarz, Debra A. and Linder, Keith E. and Cohen, Todd J. and Ninomiya-Tsuji, Jun}, year={2023}, month={Mar} }
 @article{lopez-perez_sai_sakamachi_parsons_kathariou_ninomiya-tsuji_2021, title={TAK1 inhibition elicits mitochondrial ROS to block intracellular bacterial colonization}, volume={118}, ISSN={["0027-8424"]}, DOI={10.1073/pnas.2023647118}, abstractNote={Mitogen-activated protein kinase kinase kinase 7 (MAP3K7), known as TAK1, is an intracellular signaling intermediate of inflammatory responses. However, a series of mouse Tak1 gene deletion analyses have revealed that ablation of TAK1 does not prevent but rather elicits inflammation, which is accompanied by elevation of reactive oxygen species (ROS). This has been considered a consequence of impaired TAK1-dependent maintenance of tissue integrity. Contrary to this view, here we propose that TAK1 inhibition-induced ROS are an active cellular process that targets intracellular bacteria. Intracellular bacterial effector proteins such as Yersinia's outer membrane protein YopJ are known to inhibit TAK1 to circumvent the inflammatory host responses. We found that such TAK1 inhibition induces mitochondrial-derived ROS, which effectively destroys intracellular bacteria. Two cell death-signaling molecules, caspase 8 and RIPK3, cooperatively participate in TAK1 inhibition-induced ROS and blockade of intracellular bacterial growth. Our results reveal a previously unrecognized host defense mechanism, which is initiated by host recognition of pathogen-induced impairment in a host protein, TAK1, but not directly of pathogens.}, number={25}, journal={PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA}, author={Lopez-Perez, Wilfred and Sai, Kazuhito and Sakamachi, Yosuke and Parsons, Cameron and Kathariou, Sophia and Ninomiya-Tsuji, Jun}, year={2021}, month={Jun} }
 @article{hsieh_agarwal_cholok_loder_kaneko_huber_chung_ranganathan_habbouche_li_et al._2019, title={Coordinating Tissue Regeneration Through Transforming Growth Factor-beta Activated Kinase 1 Inactivation and Reactivation}, volume={37}, ISSN={["1549-4918"]}, DOI={10.1002/stem.2991}, abstractNote={Abstract Aberrant wound healing presents as inappropriate or insufficient tissue formation. Using a model of musculoskeletal injury, we demonstrate that loss of transforming growth factor-β activated kinase 1 (TAK1) signaling reduces inappropriate tissue formation (heterotopic ossification) through reduced cellular differentiation. Upon identifying increased proliferation with loss of TAK1 signaling, we considered a regenerative approach to address insufficient tissue production through coordinated inactivation of TAK1 to promote cellular proliferation, followed by reactivation to elicit differentiation and extracellular matrix production. Although the current regenerative medicine paradigm is centered on the effects of drug treatment (“drug on”), the impact of drug withdrawal (“drug off”) implicit in these regimens is unknown. Because current TAK1 inhibitors are unable to phenocopy genetic Tak1 loss, we introduce the dual-inducible COmbinational Sequential Inversion ENgineering (COSIEN) mouse model. The COSIEN mouse model, which allows us to study the response to targeted drug treatment (“drug on”) and subsequent withdrawal (“drug off”) through genetic modification, was used here to inactivate and reactivate Tak1 with the purpose of augmenting tissue regeneration in a calvarial defect model. Our study reveals the importance of both the “drug on” (Cre-mediated inactivation) and “drug off” (Flp-mediated reactivation) states during regenerative therapy using a mouse model with broad utility to study targeted therapies for disease. Stem Cells 2019;37:766–778}, number={6}, journal={STEM CELLS}, author={Hsieh, Hsiao Hsin Sung and Agarwal, Shailesh and Cholok, David J. and Loder, Shawn J. and Kaneko, Kieko and Huber, Amanda and Chung, Michael T. and Ranganathan, Kavitha and Habbouche, Joe and Li, John and et al.}, year={2019}, month={Jun}, pages={766–778} }
 @article{sai_parsons_house_kathariou_ninomiya-tsuji_2019, title={Necroptosis mediators RIPK3 and MLKL suppress intracellular Listeria replication independently of host cell killing}, volume={218}, ISSN={["1540-8140"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85067213651&partnerID=MN8TOARS}, DOI={10.1083/jcb.201810014}, abstractNote={RIPK3, a key mediator of necroptosis, has been implicated in the host defense against viral infection primary in immune cells. However, gene expression analysis revealed that RIPK3 is abundantly expressed not only in immune organs but also in the gastrointestinal tract, particularly in the small intestine. We found that orally inoculated Listeria monocytogenes, a bacterial foodborne pathogen, efficiently spread and caused systemic infection in Ripk3-deficient mice while almost no dissemination was observed in wild-type mice. Listeria infection activated the RIPK3-MLKL pathway in cultured cells, which resulted in suppression of intracellular replication of Listeria. Surprisingly, Listeria infection–induced phosphorylation of MLKL did not result in host cell killing. We found that MLKL directly binds to Listeria and inhibits their replication in the cytosol. Our findings have revealed a novel functional role of the RIPK3-MLKL pathway in nonimmune cell-derived host defense against Listeria invasion, which is mediated through cell death–independent mechanisms.}, number={6}, journal={JOURNAL OF CELL BIOLOGY}, publisher={Rockefeller University Press}, author={Sai, Kazuhito and Parsons, Cameron and House, John S. and Kathariou, Sophia and Ninomiya-Tsuji, Jun}, year={2019}, month={Jun}, pages={1994–2005} }
 @article{liu_hayano_pan_inagaki_ninomiya-tsuji_sun_mishina_2018, title={Compound mutations in Bmpr1a and Tak1 synergize facial deformities via increased cell death}, volume={56}, ISSN={["1526-968X"]}, DOI={10.1002/dvg.23093}, abstractNote={BMP signaling plays a critical role in craniofacial development. Augmentation of BMPR1A signaling through neural crest-specific expression of constitutively active Bmpr1a (caBmpr1a) results in craniofacial deformities in mice. To investigate whether deletion of Tak1 may rescue the craniofacial deformities caused by enhanced Smad-dependent signaling through caBMPR1A, we generated embryos to activate transcription of caBmpr1a transgene and ablate Tak1 in neural crest derivatives at the same time. We found that deformities of the double mutant mice showed more severe than those with each single mutation, including median facial cleft and cleft palate. We found higher levels of cell death in the medial nasal and the lateral nasal processes at E10.5 in association with higher levels of p53 in the double mutant embryos. We also found higher levels of pSmad1/5/9 in the lateral nasal processes at E10.5 in the double mutant embryos. Western analyses revealed that double mutant embryos showed similar degrees of upregulation of pSmad1/5/9 with caBmpr1a or Tak1-cKO embryos while the double mutant embryos showed higher levels of phospho-p38 than caBmpr1a or Tak1-cKO embryos at E17.5, but not at E10.5. It suggested that deletion of Tak1 aggravates the craniofacial deformities of the caBmpr1a mutants by increasing p53 and phospho-p38 at different stage of embryogenesis.}, number={3}, journal={GENESIS}, author={Liu, Xia and Hayano, Satoru and Pan, Haichun and Inagaki, Maiko and Ninomiya-Tsuji, Jun and Sun, Hongchen and Mishina, Yuji}, year={2018}, month={Mar} }
 @article{mihaly_sakamachi_ninomiya-tsuji_morioka_2017, title={Erratum: Noncanonical cell death program independent of caspase activation cascade and necroptotic modules is elicited by loss of TGFβ-activated kinase 1}, volume={7}, ISSN={2045-2322}, url={http://dx.doi.org/10.1038/S41598-017-09609-Z}, DOI={10.1038/S41598-017-09609-Z}, abstractNote={A correction to this article has been published and is linked from the HTML version of this paper. The error has been fixed in the paper.}, number={1}, journal={Scientific Reports}, publisher={Springer Nature}, author={Mihaly, September R. and Sakamachi, Yosuke and Ninomiya-Tsuji, Jun and Morioka, Sho}, year={2017}, month={Sep} }
 @article{mihaly_sakamachi_ninomiya-tsuji_morioka_2017, title={Noncanocial cell death program independent of caspase activation cascade and necroptotic modules is elicited by loss of TGF beta-activated kinase 1}, volume={7}, ISSN={["2045-2322"]}, DOI={10.1038/s41598-017-03112-1}, abstractNote={Abstract Programmed cell death (PCD) occurs in several forms including apoptosis and necroptosis. Apoptosis is executed by the activation of caspases, while necroptosis is dependent on the receptor interacting protein kinase 3 (RIPK3). Precise control of cell death is crucial for tissue homeostasis. Indeed, necroptosis is triggered by caspase inhibition to ensure cell death. Here we identified a previously uncharacterized cell death pathway regulated by TAK1, which is unexpectedly provoked by inhibition of caspase activity and necroptosis cascades. Ablation of TAK1 triggers spontaneous death in macrophages. Simultaneous inhibition of caspases and RIPK3 did not completely restore cell viability. Previous studies demonstrated that loss of TAK1 in fibroblasts causes TNF-induced apoptosis and that additional inhibition of caspase leads to necroptotic cell death. However, we surprisingly found that caspase and RIPK3 inhibitions do not completely suppress cell death in Tak1 -deficient cells. Mechanistically, the execution of the third cell death pathway in Tak1 -deficient macrophages and fibroblasts were mediated by RIPK1-dependent rapid accumulation of reactive oxygen species (ROS). Conversely, activation of RIPK1 was sufficient to induce cell death. Therefore, loss of TAK1 elicits noncanonical cell death which is mediated by RIPK1-induced oxidative stress upon caspase and necroptosis inhibition to further ensure induction of cell death.}, journal={SCIENTIFIC REPORTS}, author={Mihaly, September R. and Sakamachi, Yosuke and Ninomiya-Tsuji, Jun and Morioka, Sho}, year={2017}, month={Jun} }
 @article{sakamachi_morioka_mihaly_takaesu_foley_fessler_ninomiya-tsuji_2017, title={TAK1 regulates resident macrophages by protecting lysosomal integrity}, volume={8}, ISSN={["2041-4889"]}, DOI={10.1038/cddis.2017.23}, abstractNote={Abstract Hematopoietic cell survival and death is critical for development of a functional immune system. Here, we report that a protein kinase, TAK1, is selectively required for resident macrophage integrity during embryogenesis. Hematopoietic lineage-specific deletion of Tak1 gene (Tak1 HKO ) caused accumulation of cellular debris in the thymus in perinatal mice. Although no overt alteration in thymocytes and blood myeloid populations was observed in Tak1 HKO mice, we found that thymic and lung macrophages were diminished. In the in vitro setting, Tak1 deficiency caused profound disruption of lysosomes and killed bone marrow-derived macrophages (BMDMs) without any exogenous stressors. Inhibition of the lysosomal protease, cathepsin B, partially blocked Tak1 -deficient BMDM death, suggesting that leakage of the lysosomal contents is in part the cause of cell death. To identify the trigger of this cell death, we examined involvement of TNF and Toll-like receptor pathways. Among them, we found that deletion of Tnfr1 partially rescued cell death. Finally, we show that Tnfr1 deletion partially restored thymic and lung macrophages in vivo . These results suggest that autocrine and potentially paracrine TNF kills Tak1 -deficient macrophages during development. Our results reveal that TAK1 signaling maintains proper macrophage populations through protecting lysosomal integrity.}, journal={CELL DEATH & DISEASE}, author={Sakamachi, Yosuke and Morioka, Sho and Mihaly, September R. and Takaesu, Giichi and Foley, Julie F. and Fessler, Michael B. and Ninomiya-Tsuji, Jun}, year={2017}, month={Feb} }
 @article{hashimoto_simmons_kajino-sakamoto_tsuji_ninomiya-tsuji_2016, title={TAK1 Regulates the Nrf2 Antioxidant System Through Modulating p62/SQSTM1}, volume={25}, ISSN={["1557-7716"]}, DOI={10.1089/ars.2016.6663}, abstractNote={Aims: Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2) is the master transcriptional regulator of antioxidant gene expression. On increased oxidative stress, an adaptor for Nrf2 degradation, Kelch-like ECH-associated protein 1 (Keap1), is directly modulated by oxidants in the cytoplasm, which results in stabilization and activation of Nrf2. Nrf2 is also constitutively active, to some extent, in the absence of exogenous oxidative stress. We have previously demonstrated that intestinal epithelium-specific TGF-β-activated kinase 1 (TAK1) deletion downregulates the level of Nrf2 protein, resulting in an increase of reactive oxygen species (ROS) in a mouse model. We aim at determining the mechanism by which TAK1 modulates the level of Nrf2. Results: We found that TAK1 upregulated serine 351 phosphorylation of an autophagic adaptor protein, p62/Sequestosome-1 (SQSTM1), which facilitates interaction between p62/SQSTM1 and Keap1 and subsequent Keap1 degradation. This, ultimately, causes increased Nrf2. Tak1 deficiency reduced the phosphorylation of p62/SQSTM1, resulting in decreased steady-state levels of Nrf2 along with increased Keap1. We also found that this regulation is independent of the canonical redox-mediated Nrf2 activation mechanism. In Tak1-deficient intestinal epithelium, a synthetic phenolic electrophile, butylated hydroxyanisole still effectively upregulated Nrf2 and reduced ROS. Innovation: Our results identify for the first time that TAK1 is a modulator of p62/SQSTM1-dependent Keap1 degradation and maintains the steady state-level of Nrf2. Conclusion: TAK1 regulates Nrf2 through modulation of Keap-p62/SQSTM1 interaction. This regulation is important for homeostatic antioxidant protection in the intestinal epithelium. Antioxid. Redox Signal. 25, 953–964.}, number={17}, journal={ANTIOXIDANTS & REDOX SIGNALING}, author={Hashimoto, Kazunori and Simmons, Alicia N. and Kajino-Sakamoto, Rie and Tsuji, Yoshiaki and Ninomiya-Tsuji, Jun}, year={2016}, month={Dec}, pages={953–964} }
 @article{sai_morioka_takaesu_muthusamy_ghashghaei_hanafusa_matsumoto_ninomiya-tsuji_2016, title={TAK1 determines susceptibility to endoplasmic reticulum stress and leptin resistance in the hypothalamus}, volume={129}, ISSN={0021-9533 1477-9137}, url={http://dx.doi.org/10.1242/jcs.180505}, DOI={10.1242/jcs.180505}, abstractNote={Sustained endoplasmic reticulum (ER) stress disrupts normal cellular homeostasis and leads to the development of many types of human diseases including metabolic disorders. TAK1 is a member of the mitogen-activated protein kinase kinase kinase (MAP3K) family, and is activated by a diverse set of inflammatory stimuli. Here we demonstrate that TAK1 regulates ER stress and metabolic signaling through modulation of lipid biogenesis. We found that deletion of Tak1 increased ER volume and facilitated ER stress tolerance in cultured cells, which was mediated by upregulation of sterol-regulatory element binding proteins (SREBPs)-dependent lipogenesis. In the in vivo setting, central nervous system (CNS)-specific Tak1 deletion upregulated SREBP target lipogenic genes and blocked ER stress in the hypothalamus. Furthermore, CNS-specific Tak1 deletion prevented ER stress-induced hypothalamic leptin resistance and hyperphagic obesity under high fat diet (HFD). Thus, TAK1 is a critical regulator of ER stress in vivo, which could be a target for alleviation of ER stress and its associated disease conditions.}, number={9}, journal={Journal of Cell Science}, publisher={The Company of Biologists}, author={Sai, Kazuhito and Morioka, Sho and Takaesu, Giichi and Muthusamy, Nagendran and Ghashghaei, H. Troy and Hanafusa, Hiroshi and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2016}, month={Mar}, pages={1855–1865} }
 @article{simmons_kajino-sakamoto_ninomiya-tsuji_2016, title={TAK1 regulates Paneth cell integrity partly through blocking necroptosis}, volume={7}, ISSN={["2041-4889"]}, DOI={10.1038/cddis.2016.98}, abstractNote={Abstract Paneth cells reside at the base of crypts of the small intestine and secrete antimicrobial factors to control gut microbiota. Paneth cell loss is observed in the chronically inflamed intestine, which is often associated with increased reactive oxygen species (ROS). However, the relationship between Paneth cell loss and ROS is not yet clear. Intestinal epithelial-specific deletion of a protein kinase Tak1 depletes Paneth cells and highly upregulates ROS in the mouse model. We found that depletion of gut bacteria or myeloid differentiation factor 88 ( Myd88 ), a mediator of bacteria-derived cell signaling, reduced ROS but did not block Paneth cell loss, suggesting that gut bacteria are the cause of ROS accumulation but bacteria-induced ROS are not the cause of Paneth cell loss. In contrast, deletion of the necroptotic cell death signaling intermediate, receptor-interacting protein kinase 3 ( Ripk3 ), partially blocked Paneth cell loss. Thus, Tak1 deletion causes Paneth cell loss in part through necroptotic cell death. These results suggest that TAK1 participates in intestinal integrity through separately modulating bacteria-derived ROS and RIPK3-dependent Paneth cell loss.}, journal={CELL DEATH & DISEASE}, author={Simmons, A. N. and Kajino-Sakamoto, R. and Ninomiya-Tsuji, J.}, year={2016}, month={Apr} }
 @article{morioka_sai_omori_ikeda_matsumoto_ninomiya-tsuji_2016, title={TAK1 regulates hepatic lipid homeostasis through SREBP}, volume={35}, ISSN={["1476-5594"]}, DOI={10.1038/onc.2015.453}, abstractNote={Sterol-regulatory element-binding proteins (SREBPs) are key transcription factors regulating cholesterol and fatty acid biosynthesis. SREBP activity is tightly regulated to maintain lipid homeostasis, and is modulated upon extracellular stimuli such as growth factors. While the homeostatic SREBP regulation is well studied, stimuli-dependent regulatory mechanisms are still elusive. Here we demonstrate that SREBPs are regulated by a previously uncharacterized mechanism through transforming growth factor-β activated kinase 1 (TAK1), a signaling molecule of inflammation. We found that TAK1 binds to and inhibits mature forms of SREBPs. In an in vivo setting, hepatocyte-specific Tak1 deletion upregulates liver lipid deposition and lipogenic enzymes in the mouse model. Furthermore, hepatic Tak1 deficiency causes steatosis pathologies including elevated blood triglyceride and cholesterol levels, which are established risk factors for the development of hepatocellular carcinoma (HCC) and are indeed correlated with Tak1-deficiency-induced HCC development. Pharmacological inhibition of SREBPs alleviated the steatosis and reduced the expression level of the HCC marker gene in the Tak1-deficient liver. Thus, TAK1 regulation of SREBP critically contributes to the maintenance of liver homeostasis to prevent steatosis, which is a potentially important mechanism to prevent HCC development.}, number={29}, journal={ONCOGENE}, author={Morioka, S. and Sai, K. and Omori, E. and Ikeda, Y. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2016}, month={Jul}, pages={3829–3838} }
 @article{lane_yumoto_azhar_ninomiya-tsuji_inagaki_hu_deng_kim_mishina_kaartinen_2015, title={Tak1, Smad4 and Trim33 redundantly mediate TGF-beta 3 signaling during palate development}, volume={398}, ISSN={["1095-564X"]}, DOI={10.1016/j.ydbio.2014.12.006}, abstractNote={Transforming growth factor-beta3 (TGF-β3) plays a critical role in palatal epithelial cells by inducing palatal epithelial fusion, failure of which results in cleft palate, one of the most common birth defects in humans. Recent studies have shown that Smad-dependent and Smad-independent pathways work redundantly to transduce TGF-β3 signaling in palatal epithelial cells. However, detailed mechanisms by which this signaling is mediated still remain to be elucidated. Here we show that TGF-β activated kinase-1 (Tak1) and Smad4 interact genetically in palatal epithelial fusion. While simultaneous abrogation of both Tak1 and Smad4 in palatal epithelial cells resulted in characteristic defects in the anterior and posterior secondary palate, these phenotypes were less severe than those seen in the corresponding Tgfb3 mutants. Moreover, our results demonstrate that Trim33, a novel chromatin reader and regulator of TGF-β signaling, cooperates with Smad4 during palatogenesis. Unlike the epithelium-specific Smad4 mutants, epithelium-specific Tak1:Smad4- and Trim33:Smad4-double mutants display reduced expression of Mmp13 in palatal medial edge epithelial cells, suggesting that both of these redundant mechanisms are required for appropriate TGF-β signal transduction. Moreover, we show that inactivation of Tak1 in Trim33:Smad4 double conditional knockouts leads to the palatal phenotypes which are identical to those seen in epithelium-specific Tgfb3 mutants. To conclude, our data reveal added complexity in TGF-β signaling during palatogenesis and demonstrate that functionally redundant pathways involving Smad4, Tak1 and Trim33 regulate palatal epithelial fusion.}, number={2}, journal={DEVELOPMENTAL BIOLOGY}, author={Lane, Jamie and Yumoto, Kenji and Azhar, Mohamad and Ninomiya-Tsuji, Jun and Inagaki, Maiko and Hu, Yingling and Deng, Chu-Xia and Kim, Jieun and Mishina, Yuji and Kaartinen, Vesa}, year={2015}, month={Feb}, pages={231–241} }
 @article{mihaly_morioka_ninomiya-tsuji_takaesu_2014, title={Activated Macrophage Survival Is Coordinated by TAK1 Binding Proteins}, volume={9}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0094982}, abstractNote={Macrophages play diverse roles in tissue homeostasis and immunity, and canonically activated macrophages are critically associated with acute inflammatory responses. It is known that activated macrophages undergo cell death after transient activation in some settings, and the viability of macrophages impacts on inflammatory status. Here we report that TGFβ- activated kinase (TAK1) activators, TAK1-binding protein 1 (TAB1) and TAK1-binding protein 2 (TAB2), are critical molecules in the regulation of activated macrophage survival. While deletion of Tak1 induced cell death in bone marrow derived macrophages even without activation, Tab1 or Tab2 deletion alone did not profoundly affect survival of naïve macrophages. However, in lipopolysaccharide (LPS)-activated macrophages, even single deletion of Tab1 or Tab2 resulted in macrophage death with both necrotic and apoptotic features. We show that TAB1 and TAB2 were redundantly involved in LPS-induced TAK1 activation in macrophages. These results demonstrate that TAK1 activity is the key to activated macrophage survival. Finally, in an in vivo setting, Tab1 deficiency impaired increase of peritoneal macrophages upon LPS challenge, suggesting that TAK1 complex regulation of macrophages may participate in in vivo macrophage homeostasis. Our results demonstrate that TAB1 and TAB2 are required for activated macrophages, making TAB1 and TAB2 effective targets to control inflammation by modulating macrophage survival.}, number={4}, journal={PLOS ONE}, author={Mihaly, September R. and Morioka, Sho and Ninomiya-Tsuji, Jun and Takaesu, Giichi}, year={2014}, month={Apr} }
 @article{ikeda_morioka_matsumoto_ninomiya-tsuji_2014, title={TAK1 Binding Protein 2 Is Essential for Liver Protection from Stressors}, volume={9}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0088037}, abstractNote={The liver is the first line of defense from environmental stressors in that hepatocytes respond to and metabolize them. Hence, hepatocytes can be damaged by stressors. Protection against hepatic cell damage and cell death is important for liver function and homeostasis. TAK1 (MAP3K7) is an intermediate of stressors such as bacterial moieties–induced signal transduction pathways in several cell types. Tak1 deficiency has been reported to induce spontaneous hepatocellular carcinoma. However, the regulatory mechanism of TAK1 activity in liver stress response has not yet been defined. Here we report that activation of TAK1 through TAK1 binding protein 2 (TAB2) is required for liver protection from stressors. We found that a bacterial moiety, lipopolysaccharides (LPS), activated TAK1 in primary hepatocytes, which was diminished by deletion of TAB2. Mice having hepatocyte-specific deletion of the Tab2 gene exhibited only late-onset moderate liver lesions but were hypersensitive to LPS-induced liver injury. Furthermore, we show that a chemical stressor induced greatly exaggerated liver injury in hepatocyte-specific Tab2-deficient mice. These results demonstrate that TAB2 is a sensor of stress conditions in the liver and functions to protect the liver by activating the TAK1 pathway.}, number={2}, journal={PLOS ONE}, author={Ikeda, Yuka and Morioka, Sho and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2014}, month={Feb} }
 @misc{mihaly_ninomiya-tsuji_morioka_2014, title={TAK1 control of cell death}, volume={21}, ISSN={["1476-5403"]}, DOI={10.1038/cdd.2014.123}, abstractNote={Programmed cell death, a physiologic process for removing cells, is critically important in normal development and for elimination of damaged cells. Conversely, unattended cell death contributes to a variety of human disease pathogenesis. Thus, precise understanding of molecular mechanisms underlying control of cell death is important and relevant to public health. Recent studies emphasize that transforming growth factor-β-activated kinase 1 (TAK1) is a central regulator of cell death and is activated through a diverse set of intra- and extracellular stimuli. The physiologic importance of TAK1 and TAK1-binding proteins in cell survival and death has been demonstrated using a number of genetically engineered mice. These studies uncover an indispensable role of TAK1 and its binding proteins for maintenance of cell viability and tissue homeostasis in a variety of organs. TAK1 is known to control cell viability and inflammation through activating downstream effectors such as NF-κB and mitogen-activated protein kinases (MAPKs). It is also emerging that TAK1 regulates cell survival not solely through NF-κB but also through NF-κB-independent pathways such as oxidative stress and receptor-interacting protein kinase 1 (RIPK1) kinase activity-dependent pathway. Moreover, recent studies have identified TAK1's seemingly paradoxical role to induce programmed necrosis, also referred to as necroptosis. This review summarizes the consequences of TAK1 deficiency in different cell and tissue types from the perspective of cell death and also focuses on the mechanism by which TAK1 complex inhibits or promotes programmed cell death. This review serves to synthesize our current understanding of TAK1 in cell survival and death to identify promising directions for future research and TAK1's potential relevance to human disease pathogenesis.}, number={11}, journal={CELL DEATH AND DIFFERENTIATION}, author={Mihaly, S. R. and Ninomiya-Tsuji, J. and Morioka, S.}, year={2014}, month={Nov}, pages={1667–1676} }
 @article{morioka_broglie_omori_ikeda_takaesu_matsumoto_ninomiya-tsuji_2014, title={TAK1 kinase switches cell fate from apoptosis to necrosis following TNF stimulation}, volume={204}, ISSN={1540-8140 0021-9525}, url={http://dx.doi.org/10.1083/JCB.201305070}, DOI={10.1083/JCB.201305070}, abstractNote={TNF activates three distinct intracellular signaling cascades leading to cell survival, caspase-8–mediated apoptosis, or receptor interacting protein kinase 3 (RIPK3)–dependent necrosis, also called necroptosis. Depending on the cellular context, one of these pathways is activated upon TNF challenge. When caspase-8 is activated, it drives the apoptosis cascade and blocks RIPK3-dependent necrosis. Here we report the biological event switching to activate necrosis over apoptosis. TAK1 kinase is normally transiently activated upon TNF stimulation. We found that prolonged and hyperactivation of TAK1 induced phosphorylation and activation of RIPK3, leading to necrosis without caspase activation. In addition, we also demonstrated that activation of RIPK1 and RIPK3 promoted TAK1 activation, suggesting a positive feedforward loop of RIPK1, RIPK3, and TAK1. Conversely, ablation of TAK1 caused caspase-dependent apoptosis, in which Ripk3 deletion did not block cell death either in vivo or in vitro. Our results reveal that TAK1 activation drives RIPK3-dependent necrosis and inhibits apoptosis. TAK1 acts as a switch between apoptosis and necrosis.}, number={4}, journal={The Journal of Cell Biology}, publisher={Rockefeller University Press}, author={Morioka, Sho and Broglie, Peter and Omori, Emily and Ikeda, Yuka and Takaesu, Giichi and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2014}, month={Feb}, pages={607–623} }
 @article{moreno-garcia_sommer_rincon-arano_brault_ninomiya-tsuji_matesic_rawlings_2013, title={Kinase-Independent Feedback of the TAK1/TAB1 Complex on BCL10 Turnover and NF-kappa B Activation}, volume={33}, ISSN={["1098-5549"]}, DOI={10.1128/mcb.06407-11}, abstractNote={ABSTRACT Antigen receptors activate pathways that control cell survival, proliferation, and differentiation. Two important targets of antigen receptors, NF-κB and Jun N-terminal kinase (JNK), are activated downstream of CARMA1, a scaffolding protein that nucleates a complex including BCL10, MALT1, and other IκB kinase (IKK)-signalosome components. Somatic mutations that constitutively activate CARMA1 occur frequently in diffuse large B cell lymphoma (DLBCL) and mediate essential survival signals. Mechanisms that downregulate this pathway might thus yield important therapeutic targets. Stimulation of antigen receptors induces not only BCL10 activation but also its degradation downstream of CARMA1, thereby ultimately limiting signals to its downstream targets. Here, using lymphocyte cell models, we identify a kinase-independent requirement for TAK1 and its adaptor, TAB1, in antigen receptor-induced BCL10 degradation. We show that TAK1 acts as an adaptor for E3 ubiquitin ligases that target BCL10 for degradation. Functionally, TAK1 overexpression restrains CARMA1-dependent activation of NF-κB by reducing BCL10 levels. TAK1 also promotes counterselection of NF-κB-addicted DLBCL lines by a dual mechanism involving kinase-independent degradation of BCL10 and kinase-dependent activation of JNK. Thus, by directly promoting BCL10 degradation, TAK1 counterbalances NF-κB and JNK signals essential for the activation and survival of lymphocytes and CARMA1-addicted lymphoma types.}, number={6}, journal={MOLECULAR AND CELLULAR BIOLOGY}, author={Moreno-Garcia, Miguel E. and Sommer, Karen and Rincon-Arano, Hector and Brault, Michelle and Ninomiya-Tsuji, Jun and Matesic, Lydia E. and Rawlings, David J.}, year={2013}, month={Mar}, pages={1149–1163} }
 @article{yumoto_thomas_lane_matsuzaki_inagaki_ninomiya-tsuji_scott_ray_ishii_maxson_et al._2013, title={TGF-beta-activated Kinase 1 (Tak1) Mediates Agonist-induced Smad Activation and Linker Region Phosphorylation in Embryonic Craniofacial Neural Crest-derived Cells}, volume={288}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.m112.431775}, abstractNote={The role of Smad-independent TGF-β signaling in craniofacial development is poorly elucidated.In craniofacial mesenchymal cells, Tak1 regulates both R-Smad C-terminal and linker region phosphorylation in TGF-β signaling.Tak1 plays an irreplaceable role in craniofacial ecto-mesenchyme during embryogenesis.Understanding the mechanisms of TGF-β signaling contributes to knowledge of pathogenetic mechanisms underlying common craniofacial birth defects. Although the importance of TGF-β superfamily signaling in craniofacial growth and patterning is well established, the precise details of its signaling mechanisms are still poorly understood. This is in part because of the concentration of studies on the role of the Smad-dependent (so-called "canonical") signaling pathways relative to the Smad-independent ones in many biological processes. Here, we have addressed the role of TGF-β-activated kinase 1 (Tak1, Map3k7), one of the key mediators of Smad-independent (noncanonical) TGF-β superfamily signaling in craniofacial development, by deleting Tak1 specifically in the neural crest lineage. Tak1-deficient mutants display a round skull, hypoplastic maxilla and mandible, and cleft palate resulting from a failure of palatal shelves to appropriately elevate and fuse. Our studies show that in neural crest-derived craniofacial ecto-mesenchymal cells, Tak1 is not only required for TGF-β- and bone morphogenetic protein-induced p38 Mapk activation but also plays a role in agonist-induced C-terminal and linker region phosphorylation of the receptor-mediated R-Smads. Specifically, we demonstrate that the agonist-induced linker region phosphorylation of Smad2 at Thr-220, which has been shown to be critical for full transcriptional activity of Smad2, is dependent on Tak1 activity and that in palatal mesenchymal cells TGFβRI and Tak1 kinases mediate both overlapping and distinct TGF-β2-induced transcriptional responses. To summarize, our results suggest that in neural crest-derived ecto-mesenchymal cells, Tak1 provides a critical point of intersection in a complex dialogue between the canonical and noncanonical arms of TGF-β superfamily signaling required for normal craniofacial development.}, number={19}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Yumoto, Kenji and Thomas, Penny S. and Lane, Jamie and Matsuzaki, Kouichi and Inagaki, Maiko and Ninomiya-Tsuji, Jun and Scott, Gregory J. and Ray, Manas K. and Ishii, Mamoru and Maxson, Robert and et al.}, year={2013}, month={May}, pages={13467–13480} }
 @article{omori_inagaki_mishina_matsumoto_ninomiya-tsuji_2012, title={Epithelial transforming growth factor  -activated kinase 1 (TAK1) is activated through two independent mechanisms and regulates reactive oxygen species}, volume={109}, ISSN={0027-8424 1091-6490}, url={http://dx.doi.org/10.1073/pnas.1116188109}, DOI={10.1073/pnas.1116188109}, abstractNote={Dysregulation in cellular redox systems results in accumulation of reactive oxygen species (ROS), which are causally associated with a number of disease conditions. Transforming growth factor β-activated kinase 1 (TAK1) is a signaling intermediate of innate immune signaling pathways and is critically involved in the redox regulation in vivo. Ablation of TAK1 causes accumulation of ROS, resulting in epithelial cell death and inflammation. Here we determine the mechanism by which TAK1 kinase is activated in epithelial tissues. TAB1 and TAB2 are structurally unrelated TAK1 binding protein partners. TAB2 is known to mediate polyubiquitin chain-dependent TAK1 activation in innate immune signaling pathways, whereas the role of TAB1 is not defined. We found that epithelial-specific TAB1 and TAB2 double- but not TAB1 or TAB2 single-knockout mice phenocopied epithelial-specific TAK1 knockout mice. We demonstrate that phosphorylation-dependent basal activity of TAK1 is dependent on TAB1. Ablation of both TAB1 and TAB2 diminished the activity of TAK1 in vivo and causes accumulation of ROS in the epithelial tissues. These results demonstrate that epithelial TAK1 activity is regulated through two unique, TAB1-dependent basal and TAB2-mediated stimuli-dependent mechanisms.}, number={9}, journal={Proceedings of the National Academy of Sciences}, publisher={Proceedings of the National Academy of Sciences}, author={Omori, E. and Inagaki, M. and Mishina, Y. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2012}, month={Feb}, pages={3365–3370} }
 @article{takaesu_inagaki_takubo_mishina_hess_dean_yoshimura_matsumoto_suda_ninomiya-tsuji_et al._2012, title={TAK1 (MAP3K7) Signaling Regulates Hematopoietic Stem Cells through TNF-Dependent and -Independent Mechanisms}, volume={7}, ISSN={1932-6203}, url={http://dx.doi.org/10.1371/journal.pone.0051073}, DOI={10.1371/journal.pone.0051073}, abstractNote={A cytokine/stress signaling kinase Tak1 (Map3k7) deficiency is known to impair hematopoietic progenitor cells. However, the role of TAK1 signaling in the stem cell function of the hematopoietic system is not yet well defined. Here we characterized hematopoietic stem cells (HSCs) harboring deletion of Tak1 and its activators, Tak1 binding proteins 1 and 2 (Tab1 and Tab2) using a competitive transplantation assay in a mouse model. Tak1 single or Tab1/Tab2 double deletions completely eliminated the reconstitution activity of HSCs, whereas Tab1 or Tab2 single deletion did not cause any abnormality. Tak1 single or Tab1/Tab2 double deficient lineage-negative, Sca-1+, c-Kit+ (LSK) cells did not proliferate and underwent cell death. We found that Tnfr1 deficiency restored the reconstitution activity of Tak1 deficient bone marrow cells for 6–18 weeks. However, the reconstitution activity of Tak1- and Tnfr1-double deficient bone marrow cells declined over the long term, and the number of phenotypically identified long-term hematopoietic stem cells were diminished. Our results indicate that TAB1- or TAB2-dependent activation of TAK1 is required for maintenance of the hematopoietic system through two mechanisms: one is prevention of TNF-dependent cell death and the other is TNF-independent maintenance of long-term HSC.}, number={11}, journal={PLoS ONE}, publisher={Public Library of Science (PLoS)}, author={Takaesu, Giichi and Inagaki, Maiko and Takubo, Keiyo and Mishina, Yuji and Hess, Paul R. and Dean, Gregg A. and Yoshimura, Akihiko and Matsumoto, Kunihiro and Suda, Toshio and Ninomiya-Tsuji, Jun and et al.}, editor={Tjwa, MarcEditor}, year={2012}, month={Nov}, pages={e51073} }
 @article{criollo_niso-santano_malik_michaud_morselli_marino_lachkar_arkhipenko_harper_pierron_et al._2011, title={Inhibition of autophagy by TAB2 and TAB3}, volume={30}, ISSN={["1460-2075"]}, DOI={10.1038/emboj.2011.413}, abstractNote={Article11 November 2011free access Inhibition of autophagy by TAB2 and TAB3 Alfredo Criollo Alfredo Criollo INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Mireia Niso-Santano Mireia Niso-Santano INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Shoaib Ahmad Malik Shoaib Ahmad Malik INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Mickael Michaud Mickael Michaud INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Eugenia Morselli Eugenia Morselli INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Guillermo Mariño Guillermo Mariño INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Sylvie Lachkar Sylvie Lachkar INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Alexander V Arkhipenko Alexander V Arkhipenko INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Search for more papers by this author Francis Harper Francis Harper Institut Gustave Roussy, Villejuif, France CNRS, UMR8122, Villejuif, France Search for more papers by this author Gérard Pierron Gérard Pierron Institut Gustave Roussy, Villejuif, France CNRS, UMR8122, Villejuif, France Search for more papers by this author Jean-Christophe Rain Jean-Christophe Rain Hybrigenics SA, Paris, France Search for more papers by this author Jun Ninomiya-Tsuji Jun Ninomiya-Tsuji Environmental and Molecular Toxicology, North Carolina State University, Raleigh, NC, USA Search for more papers by this author José M Fuentes José M Fuentes CIBERNED, Departamento de Bioquımica y Biologıa Molecular y Genética, EU Enfermería y TO, Universidad de Extremadura, Cacéres, Spain Search for more papers by this author Sergio Lavandero Sergio Lavandero Center Molecular Study of the Cell, Pharmaceutical and Chemical Science Faculty and Medicine Faculty, University of Chile, Santiago, Chile Cardiology Division, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX, USA Search for more papers by this author Lorenzo Galluzzi Lorenzo Galluzzi INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Maria Chiara Maiuri Corresponding Author Maria Chiara Maiuri INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, FranceThese authors share senior co-authorship Search for more papers by this author Guido Kroemer Corresponding Author Guido Kroemer INSERM, U848, Villejuif, France Metabolomics Platform, Institut Gustave Roussy, Villejuif, France Centre de Recherche des Cordeliers, Paris, France Pôle de Biologie, Hôpital Européen Georges Pompidou, AP-HP, Paris, France Université Paris Descartes, Sorbonne Paris Cité, Paris, FranceThese authors share senior co-authorship Search for more papers by this author Alfredo Criollo Alfredo Criollo INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Mireia Niso-Santano Mireia Niso-Santano INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Shoaib Ahmad Malik Shoaib Ahmad Malik INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Mickael Michaud Mickael Michaud INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Eugenia Morselli Eugenia Morselli INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Guillermo Mariño Guillermo Mariño INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Sylvie Lachkar Sylvie Lachkar INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Alexander V Arkhipenko Alexander V Arkhipenko INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Search for more papers by this author Francis Harper Francis Harper Institut Gustave Roussy, Villejuif, France CNRS, UMR8122, Villejuif, France Search for more papers by this author Gérard Pierron Gérard Pierron Institut Gustave Roussy, Villejuif, France CNRS, UMR8122, Villejuif, France Search for more papers by this author Jean-Christophe Rain Jean-Christophe Rain Hybrigenics SA, Paris, France Search for more papers by this author Jun Ninomiya-Tsuji Jun Ninomiya-Tsuji Environmental and Molecular Toxicology, North Carolina State University, Raleigh, NC, USA Search for more papers by this author José M Fuentes José M Fuentes CIBERNED, Departamento de Bioquımica y Biologıa Molecular y Genética, EU Enfermería y TO, Universidad de Extremadura, Cacéres, Spain Search for more papers by this author Sergio Lavandero Sergio Lavandero Center Molecular Study of the Cell, Pharmaceutical and Chemical Science Faculty and Medicine Faculty, University of Chile, Santiago, Chile Cardiology Division, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX, USA Search for more papers by this author Lorenzo Galluzzi Lorenzo Galluzzi INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, France Search for more papers by this author Maria Chiara Maiuri Corresponding Author Maria Chiara Maiuri INSERM, U848, Villejuif, France Institut Gustave Roussy, Villejuif, France Université Paris Sud, Paris 11, Villejuif, FranceThese authors share senior co-authorship Search for more papers by this author Guido Kroemer Corresponding Author Guido Kroemer INSERM, U848, Villejuif, France Metabolomics Platform, Institut Gustave Roussy, Villejuif, France Centre de Recherche des Cordeliers, Paris, France Pôle de Biologie, Hôpital Européen Georges Pompidou, AP-HP, Paris, France Université Paris Descartes, Sorbonne Paris Cité, Paris, FranceThese authors share senior co-authorship Search for more papers by this author Author Information Alfredo Criollo1,2,3,‡, Mireia Niso-Santano1,2,3,‡, Shoaib Ahmad Malik1,2,3, Mickael Michaud1,2,3, Eugenia Morselli1,2,3, Guillermo Mariño1,2,3, Sylvie Lachkar1,2,3, Alexander V Arkhipenko1,2, Francis Harper2,4, Gérard Pierron2,4, Jean-Christophe Rain5, Jun Ninomiya-Tsuji6, José M Fuentes7, Sergio Lavandero8,9, Lorenzo Galluzzi1,2,3, Maria Chiara Maiuri 1,2,3 and Guido Kroemer 1,10,11,12,13 1INSERM, U848, Villejuif, France 2Institut Gustave Roussy, Villejuif, France 3Université Paris Sud, Paris 11, Villejuif, France 4CNRS, UMR8122, Villejuif, France 5Hybrigenics SA, Paris, France 6Environmental and Molecular Toxicology, North Carolina State University, Raleigh, NC, USA 7CIBERNED, Departamento de Bioquımica y Biologıa Molecular y Genética, EU Enfermería y TO, Universidad de Extremadura, Cacéres, Spain 8Center Molecular Study of the Cell, Pharmaceutical and Chemical Science Faculty and Medicine Faculty, University of Chile, Santiago, Chile 9Cardiology Division, Department of Internal Medicine, University of Texas Southwestern Medical Center, Dallas, TX, USA 10Metabolomics Platform, Institut Gustave Roussy, Villejuif, France 11Centre de Recherche des Cordeliers, Paris, France 12Pôle de Biologie, Hôpital Européen Georges Pompidou, AP-HP, Paris, France 13Université Paris Descartes, Sorbonne Paris Cité, Paris, France ‡These authors contributed equally to this work *Corresponding authors: INSERM, U848, Institut Gustave Roussy, Pavillon de Recherche 1, 39 rue Camille Desmoulins, F–94805 Villejuif, France. Tel.: +33 1 4211 5216; Fax: +33 1 4211 6665; E-mail: [email protected] or Tel.: +33 1 4211 6046; Fax: +33 1 4211 6047; E-mail: [email protected] The EMBO Journal (2011)30:4908-4920https://doi.org/10.1038/emboj.2011.413 PDFDownload PDF of article text and main figures. Peer ReviewDownload a summary of the editorial decision process including editorial decision letters, reviewer comments and author responses to feedback. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Autophagic responses are coupled to the activation of the inhibitor of NF-κB kinase (IKK). Here, we report that the essential autophagy mediator Beclin 1 and TGFβ-activated kinase 1 (TAK1)-binding proteins 2 and 3 (TAB2 and TAB3), two upstream activators of the TAK1-IKK signalling axis, constitutively interact with each other via their coiled-coil domains (CCDs). Upon autophagy induction, TAB2 and TAB3 dissociate from Beclin 1 and bind TAK1. Moreover, overexpression of TAB2 and TAB3 suppresses, while their depletion triggers, autophagy. The expression of the C-terminal domain of TAB2 or TAB3 or that of the CCD of Beclin 1 competitively disrupts the interaction between endogenous Beclin 1, TAB2 and TAB3, hence stimulating autophagy through a pathway that requires endogenous Beclin 1, TAK1 and IKK to be optimally efficient. These results point to the existence of an autophagy-stimulatory ‘switch’ whereby TAB2 and TAB3 abandon inhibitory interactions with Beclin 1 to engage in a stimulatory liaison with TAK1. Introduction Macroautophagy (hereafter referred to as ‘autophagy’) is a catabolic pathway involving the sequestration of cytoplasmic material in double-membraned vesicles, the autophagosomes. Upon fusion with lysosomes, autophagosomes become autophagolysosomes and their content gets degraded by acidic hydrolases, allowing nutrients and macromolecules to fuel cellular metabolism or sustain stress responses (Klionsky, 2004; Mizushima et al, 2008). Multiple distinct perturbations of the cellular physiology can induce autophagy through a complex signalling network that crosstalks with several stress-response pathways (Kroemer et al, 2010; Green et al, 2011), including molecular cascades that are ignited by organellar damage as well as pathways leading to the activation of prominent transcription factors such as p53 (Tasdemir et al, 2008b; Scherz-Shouval et al, 2010) and NF-κB (Herrero-Martin et al, 2009; Criollo et al, 2010; Comb et al, 2011). Beclin 1 has been the first mammalian protein shown to play a critical role in the initiation of autophagy (Liang et al, 1999). Its complex interactome has a major influence on the positive and negative regulation of autophagy (Kang et al, 2011). One of the decisive events that ignites the autophagic machinery is the activation of the class III phosphatidylinositol 3-kinase (PI3KC3), also called VPS34, to generate phosphatidylinositol-3-phosphate, which is required for the initial steps of vesicle nucleation (Axe et al, 2008). Beclin 1 is an obligatory allosteric activator of VPS34, operating within the so-called ‘Beclin 1 core complex’ that involves Beclin 1, VPS15, VPS34 and, likely, AMBRA1 (He and Levine, 2010). Numerous additional proteins interact with Beclin 1. Pro-autophagic Beclin 1 interactors include ATG14 (also called ATG14L or BARKOR), UV radiation resistance-associated gene (UVRAG) and Bif-1/endophilin B1, which interacts with Beclin 1 via UVRAG. Autophagy-inhibitory interactors of Beclin 1 include RUN domain protein as Beclin 1 interacting and cysteine-rich containing (RUBICON), anti-apoptotic proteins from the BCL-2 family (BCL-2, BCL-XL and MCL-1) and the inositol-1,4,5 trisphosphate receptor, which interacts with Beclin 1 indirectly via BCL-2 (He and Levine, 2010; Kang et al, 2011). Beclin 1 possesses a BH3 domain (residues 114–123) through which it constitutively interacts with BCL-2-like proteins (Maiuri et al, 2007), and autophagy induction requires the dissociation of Beclin 1 from such inhibitory liaisons (He and Levine, 2010; Kang et al, 2011). The transcription factor NF-κB is activated when the inhibitor of NF-κB (IκB) is phosphorylated by the IκB kinase (IKK), a multiprotein complex that is composed by one regulatory (IKKγ, also known as NEMO) and two catalytic subunits (IKKα and IKKβ). IKK is activated in response to stressors as diverse as reactive oxygen species and DNA damage as well as by the ligation of death receptors (Baud and Karin, 2009). Frequently, the activation of IKK is mediated further upstream by yet another kinase, mitogen-activated protein kinase kinase kinase 7 (MAP3K7), better known as TGFβ-activated kinase 1 (TAK1) (Ninomiya-Tsuji et al, 1999; Takaesu et al, 2003; Landstrom, 2010). The phosphorylation of IκB by IKK stimulates IκB ubiquitination, thus targeting it for proteasomal degradation. In turn, IκB degradation allows NF-κB to translocate from the cytoplasm, where it is usually retained by IκB, to the nucleus, where NF-κB then becomes active as a cytoprotective and pro-inflammatory transcription factor (Baud and Karin, 2009). In both murine and human cells, the genetic inhibition of TAK1 or any of the IKK subunits (but not that of the NF-κB subunit p65) prevents the induction of autophagy in response to a panoply of different stimuli including starvation, rapamycin, p53 inhibition and endoplasmic reticulum stress (Herrero-Martin et al, 2009; Criollo et al, 2010; Comb et al, 2011). Conversely, constitutively active IKK subunits potently stimulate autophagy through a pathway that does not necessarily involve NF-κB, yet relies on the activation of AMPK and JNK1 (Criollo et al, 2010), as well as on several essential autophagy-related proteins including Beclin 1, ATG5 and LC3 (Comb et al, 2011). Altogether, these results point to the existence of a major crosstalk between autophagy and the TAK1-IKK signalling axis, yet do not reveal the molecular mechanisms through which these pathways intersect. Here, we report the discovery that TAK1-binding protein 2 (TAB2) and TAK1-binding protein 3 (TAB3) function as tonic inhibitors of autophagy. We found that TAB2 and TAB3 constitutively interact with Beclin 1 and that this liaison is lost upon treatment with physiological inducers of autophagy, causing TAB2 and TAB3 to bind TAK1 instead of Beclin 1. Competitive disruption of the Beclin 1/TAB2/TAB3 complex suffices to induce Beclin 1- and TAK1-dependent autophagy, underscoring the importance of the inhibitory interaction between Beclin 1, TAB2 and TAB3. Results Identification of TAB2 and TAB3 as novel Beclin 1 interactors To unveil a possible intersection between autophagy and the TAK1-IKK activation pathway, we identified Beclin 1 interactors in two yeast two-hybrid saturation screens based on a complex human random-primed cDNA library. This approach led us to identify 63 Beclin 1-interacting proteins. Beyond known interactors (such as UVRAG, ATG14 and ZWINT) (Behrends et al, 2010), our screens identified 11 new proteins that would bind Beclin 1 with an elevated Predicted Biological Score (Formstecher et al, 2005) (Figure 1A, also consultable at the following website http://pim.hybrigenics.com/). Among these 11 proteins, 1 (desmoplakin) has previously been described to bind multiple autophagy-relevant proteins including PIK3C3/VPS34 (but not Beclin 1), and two have been reported to interact with one single autophagy-related protein (PLEC1 with SQSTM1/p62 and SNX4 with RABGAP1) (Behrends et al, 2010). Of note, two among the putative Beclin 1 interactors, namely TAB2 and its close homologue TAB3, are known co-activators of TAK1 (Takaesu et al, 2000; Ishitani et al, 2003). Yeast two-hybrid technology allowed us to narrow down the domains that mediate the interaction of TAB2 and TAB3 with Beclin 1 to a C-terminal region that we called ‘Beclin-binding domain’ (BBD). The BBD spans from residues 526 to 657 in TAB2 and from residues 518 to 608 in TAB3 (Figure 1B). Co-immunoprecipitation experiments involving Beclin 1 and multiple TAB2 and TAB3 deletion constructs (Figure 1C) confirmed the interaction of full-length Beclin 1 with full-length TAB2 and TAB3, as well as with TAB2 and TAB3 fragments containing the C-terminal BBD. The binding of Beclin 1 to TAB2 and TAB3 was lost upon deletion of their BBDs (Figure 1D and E). Thus, TAB2 and TAB3 constitute novel bona fide members of the Beclin 1 interactome. Figure 1.Identification of novel Beclin 1 interactors. (A) Beclin 1 (BCN1) interactors identified by yeast two-hybrid technology. Proteins binding to BCN1 are listed and their interacting domains are indicated by black bars. Numbers refer to amino-acid positions. (B) Identification of TAB2 and TAB3 fragments interacting with BCN1 in the yeast two-hybrid system. Blue lines depict the fragments of TAB2 or TAB3 that were found to interact with BCN1 (numbers on the right refer to the amount of yeast clones identified for each fragment). The minimal domain required for the interaction is referred to as Beclin-binding domain (BBD). (C) Constructs derived from TAB2 and TAB3 used in this study. (D, E) Co-immunoprecipitation of TAB2 or TAB3 with BCN1. The indicated constructs, namely HA-tagged and T7-tagged TAB2, and TAB3 constructs in (D) and (E), respectively, and Flag-tagged Beclin 1 (Flag–BCN1) were transfected into HeLa cells alone or in combination. Twenty-four hours later, TAB2 and TAB3 were immunoprecipitated with antibodies specific for HA (D) or T7 (E) and the precipitate was separated by SDS–PAGE and revealed with an antibody specific for Flag. (F) Immunoprecipitation of endogenous BCN1 with endogenous TAB2 or TAB3. HeLa cells were subjected to autophagy induction with starvation conditions, 1 μM rapamycin or 30 μM pifithrin α (PFTα) for the indicated time and then processed for TAB2 or TAB3 immunoprecipitation followed by the immunodetection of BCN1, TAK1, TAB2 and TAB3. Results in (E) and (F) are representative for three independent experiments. Download figure Download PowerPoint TAB2 and TAB3 dissociate from Beclin 1 upon autophagy induction A His-tagged version of Beclin 1 was introduced together with epitope-tagged TAB2 or TAB3 into human cervical carcinoma HeLa cells, which were then driven into autophagy by culture in serum- and nutrient-free conditions (starvation), or by the administration of the mTOR inhibitor rapamycin or of the p53 inhibitor cyclic pifithrin α (PFTα). These three pro-autophagic stimuli all led to a decrease in the amount of TAB2 of TAB3 that co-immunoprecipitated with Beclin 1, as compared with control conditions (Supplementary Figure S1). Consistently, endogenous Beclin 1 co-immunoprecipitated with TAB2 or TAB3 (but not with TAK1) in control conditions, and this interaction was rapidly lost upon autophagy induction in HeLa cells (Figure 1F), as well as in other human cell lines (non small-cell lung cancer A549 cells, colorectal carcinoma HCT 116 cells) and mouse embryonic fibroblasts (MEFs, not shown). While in physiological conditions TAB2 and TAB3 failed to co-immunoprecipitate with TAK1, after the induction of autophagy with starvation, rapamycin or PFTα, both TAB2 and TAB3 were found to engage in such an interaction. Kinetic experiments revealed that TAB2 and TAB3 bind TAK1 as soon as they dissociate from Beclin 1 (Figure 1F). Inhibition of TAK1 by overexpression of a kinase-dead dominant-negative (DN) TAK1 mutant (TAK1K63W) (Ono et al, 2003; Figure 2A and B) or by means of a specific small-interfering RNA (siRNA) (Supplementary Figure S2) prevented the relocalization of a green fluorescence protein (GFP)–LC3 chimera from a diffuse pattern to discrete cytoplasmic puncta (Tasdemir et al, 2008a) by starvation, rapamycin or PFTα (Figure 2C and D). Similarly, TAK1 depletion prevented the autophagy-associated redistribution of a red fluorescent protein (RFP)-tagged FYVE domain (FYVE–RFP) (Zhang et al, 2007) to intracellular membranes containing phosphatidylinositol-3-phosphate (Figure 2E and F). Figure 2.Reduced interaction between Beclin 1, TAB and TAB3 in conditions of autophagy induction. (A, B) Inhibition of autophagy by dominant-negative (DN) TAK1. HeLa cells were co-transfected with a GFP–LC3-encoding construct plus pcDNA3.1 (empty vector), or plasmids for the expression of WT TAK1 (TAK1WT) or the DN TAK1K63W mutant. One day later, cells were either left untreated (control) or driven into autophagy by starvation or by the administration of 1 μM rapamycin or 30 μM pifithrin α (PFTα), followed by immunoblotting for the detection of TAK1 and endogenous LC3 (A) or immunofluorescence microscopy for the quantification of cells with cytosolic GFP–LC3 puncta (GFP–LC3VAC cells) (B) (mean values±s.d., n=3; *P<0.01 versus control cells). GAPDH levels were monitored to ensure equal loading. (C, D) Inhibition of autophagy by knockdown of VPS34, Beclin 1 (BCN1) and TAK1. siRNAs that effectively deplete VPS34, BCN1 and TAK1 were co-transfected with a GFP–LC3-encoding plasmid in HeLa cells. Autophagy was then induced as in (A) and the frequency of GFP–LC3VAC cells (mean values±s.d., n=3; *P<0.01 versus control cells) was determined. (E, F) The same setting shown in (C, D) was performed with U2OS cells and FYVE–RFP (mean values±s.d., n=3; *P<0.01, **P<0.001 versus control cells). Download figure Download PowerPoint Altogether, these results support the idea that TAB2 and TAB3 dissociate from Beclin 1 to engage with TAK1 when autophagy is induced. TAB2 and TAB3 are endogenous inhibitors of autophagy Depletion of TAB2 or TAB3 by specific siRNAs induced the accumulation of GFP–LC3+ dots in HeLa and human osteosarcoma U2OS cells stably expressing GFP–LC3 (Figure 3A and B), in HeLa cells transiently transfected with a GFP–LC3-encoding plasmid as well as in HCT 116 cells (Supplementary Figure S3). Moreover, TAB2 or TAB3 knockdown stimulated the lipidation of endogenous LC3, an autophagy-associated post-translational modification that enhances its electrophoretic mobility (shift from the LC3-I to the LC3-II form), and reduced the abundance of the autophagic substrate SQSTM1/p62 (Figure 3C), suggesting that TAB2 and TAB3 act as endogenous inhibitors of autophagy. Accordingly, the depletion of TAB2 or TAB3 led to the accumulation of bona fide autophagosomes and autophagolysosomes, as determined by transmission electron microscopy (Figure 3D and E). Epistatic experiments revealed that the simultaneous knockdown of TAB2 and TAB3 induced only slightly more GFP–LC3+ puncta than the depletion of each of these proteins alone. Moreover, the induction of autophagy by TAB2 depletion was inhibited by transfection of non-interferable TAB2 or wild-type (WT) TAB3 (and vice versa TAB2 transfection antagonized autophagy induction by TAB3 depletion), suggesting that both proteins inhibit the formation of autophagic puncta in a similar, overlapping manner (Figure 3F). Moreover, the depletion of either TAB induced the formation of FYVE–RFP+ puncta to similar extents (Figure 3G), suggesting that both TAB2 and TAB3 usually restrain the lipid kinase activity of the Beclin 1 complex. Figure 3.Induction of autophagosomes by depletion of TAB2 or TAB3. (A, B) Detection of autophagic GFP–LC3+ puncta. HeLa or U2OS cells stably expressing GFP–LC3 were transfected with siRNAs targeting TAK1, TAB1, TAB2 or TAB3 or with a control siRNA (siUNR). One day later, the subcellular localization and abundance of GFP–LC3 or immunostained TAB2 or TAB3 was determined by epifluorescence microscopy. Representative images are shown in (A) (HeLa cells) and quantitative results (mean values±s.d., n=3; *P<0.01 versus siUNR-transfected cells) are depicted in (B) (U2OS cells). (C) Lipidation of LC3 induced by TAB2 or TAB3 knockdown. Representative immunoblots showing the conversion of non-lipidated LC3 (LC3-I) to its lipidated variant (LC3-II) as well as SQSTM1/p62 protein levels are shown. GAPDH levels were monitored to ensure equal loading. (D, E) Quantification of autophagosomes and autophagolysosomes by transmission electron microscopy. Representative images of HeLa cells transfected with siUNR or with TAB2- or TAB3-targeting siRNAs are shown in (D), and quantitative results are depicted in (E) (mean values±s.d., n=3; *P<0.01 versus siUNR-transfected cells). (F) Epistatic analysis of the effects of TAB2 and TAB3 depletion on autophagy. HeLa cells stably expressing GFP–LC3 were transfected with siRNAs specific for TAB2 or TAB3 and/or with cDNAs coding for full-length HA-tagged TAB2 (HA–TAB2) or TAB3 (HA–TAB3). Twenty-four hours later, the frequency of cells exhibiting >5 GFP–LC3+ cytosolic puncta (GFP–LC3VAC cells) was determined. Results are mean values±s.d. (n=3; *P<0.01 versus siUNR-transfected cells). (G) U2OS cells stably expressing FYVE–RFP were transfected with siUNR, or with siRNAs specific for TAB2, TAB3, VPS34, Beclin 1 (BCN1) and TAK1, in the indicated combinations. Forty-eight hours later, the percentage of cells with RFP–FYVE+ puncta cells was determined. Results are mean values±s.d. (n=3; *P<0.01 versus siUNR-transfected cells). Download figure Download PowerPoint The accumulation of autophagosomes may result from enhanced sequestration of cytoplasmic material (increased on-rate) as well as from reduced removal of autophagosomes by fusion with lysosomes (reduced off-rate). Therefore, we measured autophagosome formation induced by TAB depletion in the absence or presence of bafilomycin A1 (BafA1), which inhibited the colocalization of the autophagic marker GFP–LC3 and the lysosomal marker LAMP2, in accord with its known capacity to block the autophagosome–lysosome fusion (Mizushima et al, 2010) (Figure 4A–C). In the presence of BafA1, the depletion of TAB2 and TAB3 resulted in more GFP–LC3+ puncta than in its absence (Figure 4D). Similar flux determinations were performed in the presence of an alternative lysosomal inhibitor, ammonium chloride, or protease inhibitors (E64d plus pepstatin A) (Supplementary Figure S4). Also, MEFs lacking TAB2 expression due to homologous recombination (Tab2−/−), but neither WT MEFs nor their Tab1−/− counterparts, manifested increased LC3 lipidation, both in the absence and in the presence of BafA1 (Figure 4E). Autophagy induced by TAB2 or TAB3 knockdown followed the canonical pathway, as it was reduced upon depletion of essential autophagy proteins such as Beclin 1, its associated phosphatidylinositol 3-kinase VPS34, ATG5 and ATG7 (Figure 4F). Moreover, it involved the obligatory contribution of TAK1 and that of the three subunits of the IKK complex, as shown by additional experiments of siRNA-mediated knockdown (Figure 4G) or transfection with DN TAK1 (Figure 4H). In conclusion, TAB2 and TAB3 are endogenous inhibitors of the canonical autophagic pathway, which requires the action of kinases from the TAK1-IKK signalling axis. Figure 4.Mechanisms of autophagy induced by depletion of TAB2 or TAB3. (A–D) Impact of bafilomycin A1 (BafA1) on the induction of GFP–LC3+ puncta by TAB2 and TAB3 depletion. HeLa cells stably expressing GFP–LC3 were transfected with a control siRNA (siUNR) or with siRNAs targeting TAB2 and TAB3 for 24 h. During the last 12 h of this period, BafA1 was optionally added. After fixation and permeabilization, LAMP2 was detected by immunofluorescence. Representative confocal microphotographs for the TAB2 siRNA are shown (A), together with the profiles of colocalization of fluorescent signals (B) along the indicated direction (α–ω). Columns in (C) represent the percentage of colocalization of GFP–LC3 and LAMP2 (mean values±s.d.; *P<0.01 versus siUNR-transfected cells), as quantified in at least 50 cells for each condition. The frequency (mean±s.d.) of cells with >5 GFP–LC3+ cytosolic puncta (GFP–LC3VAC cells) is plotted in (D). (E) Impact of BafA1 on LC3 lipidation. MEFs with the indicated genotypes were cultured in complete medium supplemented with BafA1 for 12 h and the proportion of LC3-I/LC3-II was determined by immunoblotting. GAPDH levels were monitored to ensure equal loading. (F, G) Impact of autophagy-relevant proteins and of the TAK1-IKK signalling axis on GFP–LC3 aggregation induced by the depletion of TAB2 or TAB3. HeLa cells stably expressing GFP–LC3 were transfected with siUNR or with siRNAs targeting the indicated proteins, alone or in combination, and 48 h later GFP–LC3VAC cells were quantified (mean values±s.d., n=4; *P<0.01 versus siUNR-transfected cells). (H) Inhibition of autophagy by dominant-negative (DN) TAK1. HeLa cells stably expressing GFP–LC3 were co-transfected with pcDNA3.1 (empty vector) or with plasmids encoding WT (TAK1WT) or a DN TAK1 variant (TAK1K63W) together with the indicated siRNAs for 24 h, followed by the quantification of GFP–LC3VAC cells (mean values±s.d., n=3, *P<0.01 versus siUNR-, pcDNA3.1-transfected cells). Download figure Download PowerPoint Dissociation of TAB2 and TAB3 from Beclin 1 induces autophagy Overexpression of full-length TAB2 or TAB3 inhibited starvation-, rapamycin-}, number={24}, journal={EMBO JOURNAL}, author={Criollo, Alfredo and Niso-Santano, Mireia and Malik, Shoaib Ahmad and Michaud, Mickael and Morselli, Eugenia and Marino, Guillermo and Lachkar, Sylvie and Arkhipenko, Alexander V. and Harper, Francis and Pierron, Gerard and et al.}, year={2011}, month={Dec}, pages={4908–4920} }
 @article{omori_matsumoto_ninomiya-tsuji_2011, title={Non-canonical beta-catenin degradation mediates reactive oxygen species-induced epidermal cell death}, volume={30}, ISSN={["0950-9232"]}, DOI={10.1038/onc.2011.49}, abstractNote={β-Catenin is constantly degraded through the ubiquitin-proteasomal pathway. In this study, we report that a different type of β-catenin degradation is causally involved in epidermal cell death. We observed that reactive oxygen species (ROS) caused β-catenin degradation in the epidermal cells through a caspase-dependent mechanism, which results in disruption of cell adhesion. Disruption of cell adhesion increased ROS and activated caspases. Upregulation of the intact β-catenin blocked ROS accumulation and caspase activation. These results indicate that a feed-forward loop consisting of ROS, caspases activation and β-catenin degradation induces epidermal cell death.}, number={30}, journal={ONCOGENE}, author={Omori, E. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2011}, month={Jul}, pages={3336–3344} }
 @article{omori_matsumoto_zhu_smart_ninomiya-tsuji_2010, title={Ablation of TAK1 Upregulates Reactive Oxygen Species and Selectively Kills Tumor Cells}, volume={70}, ISSN={0008-5472 1538-7445}, url={http://dx.doi.org/10.1158/0008-5472.can-10-1227}, DOI={10.1158/0008-5472.can-10-1227}, abstractNote={Abstract TAK1 kinase activates multiple transcription factors and regulates the level of reactive oxygen species (ROS). We have previously reported that ablation of TAK1 in keratinocytes causes hypersensitivity to ROS-induced cell apoptosis. It is known that some tumor cells produce ROS at higher levels compared with normal cells. We used inducible epidermal-specific TAK1 knockout mice and examined whether ablation of TAK1 in preexisting skin tumors could cause an increase in ROS and result in tumor cell death. Deletion of tak1 gene in skin tumors caused the accumulation of ROS and increased apoptosis, and skin tumors totally regressed within 5 to 10 days. Normal skin did not exhibit any significant abnormality on tak1 gene deletion. Thus, TAK1 kinase could be a new and effective molecular target for ROS-based tumor killing. Cancer Res; 70(21); 8417–25. ©2010 AACR.}, number={21}, journal={Cancer Research}, publisher={American Association for Cancer Research (AACR)}, author={Omori, Emily and Matsumoto, Kunihiro and Zhu, Songyun and Smart, Robert C. and Ninomiya-Tsuji, Jun}, year={2010}, month={Oct}, pages={8417–8425} }
 @article{sakamoto_huang_iwasaki_hailemariam_ninomiya-tsuji_tsuji_2010, title={Regulation of Genotoxic Stress Response by Homeodomain-interacting Protein Kinase 2 through Phosphorylation of Cyclic AMP Response Element-binding Protein at Serine 271}, volume={21}, ISSN={["1939-4586"]}, DOI={10.1091/mbc.e10-01-0015}, abstractNote={CREB (cyclic AMP response element-binding protein) is a stimulus-induced transcription factor that plays pivotal roles in cell survival and proliferation. The transactivation function of CREB is primarily regulated through Ser-133 phosphorylation by cAMP-dependent protein kinase A (PKA) and related kinases. Here we found that homeodomain-interacting protein kinase 2 (HIPK2), a DNA-damage responsive nuclear kinase, is a new CREB kinase for phosphorylation at Ser-271 but not Ser-133, and activates CREB transactivation function including brain-derived neurotrophic factor (BDNF) mRNA expression. Ser-271 to Glu-271 substitution potentiated the CREB transactivation function. ChIP assays in SH-SY5Y neuroblastoma cells demonstrated that CREB Ser-271 phosphorylation by HIPK2 increased recruitment of a transcriptional coactivator CBP (CREB binding protein) without modulation of CREB binding to the BDNF CRE sequence. HIPK2−/− MEF cells were more susceptible to apoptosis induced by etoposide, a DNA-damaging agent, than HIPK2+/+ cells. Etoposide activated CRE-dependent transcription in HIPK2+/+ MEF cells but not in HIPK2−/− cells. HIPK2 knockdown in SH-SY5Y cells decreased etoposide-induced BDNF mRNA expression. These results demonstrate that HIPK2 is a new CREB kinase that regulates CREB-dependent transcription in genotoxic stress.}, number={16}, journal={MOLECULAR BIOLOGY OF THE CELL}, author={Sakamoto, Kensuke and Huang, Bo-Wen and Iwasaki, Kenta and Hailemariam, Kiros and Ninomiya-Tsuji, Jun and Tsuji, Yoshiaki}, year={2010}, month={Aug}, pages={2966–2974} }
 @article{kajino-sakamoto_omori_nighot_blikslager_matsumoto_ninomiya-tsuji_2010, title={TGF-β–Activated Kinase 1 Signaling Maintains Intestinal Integrity by Preventing Accumulation of Reactive Oxygen Species in the Intestinal Epithelium}, volume={185}, ISSN={0022-1767 1550-6606}, url={http://dx.doi.org/10.4049/jimmunol.0903587}, DOI={10.4049/jimmunol.0903587}, abstractNote={The intestinal epithelium is constantly exposed to inducers of reactive oxygen species (ROS), such as commensal microorganisms. Levels of ROS are normally maintained at nontoxic levels, but dysregulation of ROS is involved in intestinal inflammatory diseases. In this article, we report that TGF-β-activated kinase 1 (TAK1) is a key regulator of ROS in the intestinal epithelium. tak1 gene deletion in the mouse intestinal epithelium caused tissue damage involving enterocyte apoptosis, disruption of tight junctions, and inflammation. Disruption of TNF signaling, which is a major intestinal damage inducer, rescued the inflammatory conditions but not apoptosis or disruption of tight junctions in the TAK1-deficient intestinal epithelium, suggesting that TNF is not a primary inducer of the damage noted in TAK1-deficient intestinal epithelium. We found that TAK1 deficiency resulted in reduced expression of several antioxidant-responsive genes and reduced the protein level of a key antioxidant transcription factor NF-E2-related factor 2, which resulted in accumulation of ROS. Exogenous antioxidant treatment reduced apoptosis and disruption of tight junctions in the TAK1-deficient intestinal epithelium. Thus, TAK1 signaling regulates ROS through transcription factor NF-E2-related factor 2, which is important for intestinal epithelial integrity.}, number={8}, journal={The Journal of Immunology}, publisher={The American Association of Immunologists}, author={Kajino-Sakamoto, Rie and Omori, Emily and Nighot, Prashant K. and Blikslager, Anthony T. and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2010}, month={Sep}, pages={4729–4737} }
 @article{broglie_matsumoto_akira_brautigan_ninomiya-tsuji_2010, title={Transforming Growth Factor beta-activated Kinase 1 (TAK1) Kinase Adaptor, TAK1-binding Protein 2, Plays Dual Roles in TAK1 Signaling by Recruiting Both an Activator and an Inhibitor of TAK1 Kinase in Tumor Necrosis Factor Signaling Pathway}, volume={285}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M109.090522}, abstractNote={Transforming growth factor β-activated kinase 1 (TAK1) kinase is an indispensable signaling intermediate in tumor necrosis factor (TNF), interleukin 1, and Toll-like receptor signaling pathways. TAK1-binding protein 2 (TAB2) and its closely related protein, TAB3, are binding partners of TAK1 and have previously been identified as adaptors of TAK1 that recruit TAK1 to a TNF receptor signaling complex. TAB2 and TAB3 redundantly mediate activation of TAK1. In this study, we investigated the role of TAB2 by analyzing fibroblasts having targeted deletion of the tab2 gene. In TAB2-deficient fibroblasts, TAK1 was associated with TAB3 and was activated following TNF stimulation. However, TAB2-deficient fibroblasts displayed a significantly prolonged activation of TAK1 compared with wild type control cells. This suggests that TAB2 mediates deactivation of TAK1. We found that a TAK1-negative regulator, protein phosphatase 6 (PP6), was recruited to the TAK1 complex in wild type but not in TAB2-deficient fibroblasts. Furthermore, we demonstrated that both PP6 and TAB2 interacted with the polyubiquitin chains and this interaction mediated the assembly with TAK1. Our results indicate that TAB2 not only activates TAK1 but also plays an essential role in the deactivation of TAK1 by recruiting PP6 through a polyubiquitin chain-dependent mechanism.}, number={4}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Broglie, Peter and Matsumoto, Kunihiro and Akira, Shizuo and Brautigan, David L. and Ninomiya-Tsuji, Jun}, year={2010}, month={Jan}, pages={2333–2339} }
 @article{kim_kajino-sakamoto_omori_jobin_ninomiya-tsuji_2009, title={Intestinal Epithelial-Derived TAK1 Signaling Is Essential for Cytoprotection against Chemical-Induced Colitis}, volume={4}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0004561}, abstractNote={Background We have previously reported that intestinal epithelium-specific TAK1 deleted mice exhibit severe inflammation and mortality at postnatal day 1 due to TNF-induced epithelial cell death. Although deletion of TNF receptor 1 (TNFR1) can largely rescue those neonatal phenotypes, mice harboring double deletion of TNF receptor 1 (TNFR1) and intestinal epithelium-specific deletion of TAK1 (TNFR1KO/TAK1IEKO) still occasionally show increased inflammation. This indicates that TAK1 is important for TNF-independent regulation of intestinal integrity. Methodology/Principal Findings In this study, we investigated the TNF-independent role of TAK1 in the intestinal epithelium. Because the inflammatory conditions were sporadically developed in the double mutant TNFR1KO/TAK1IEKO mice, we hypothesize that epithelial TAK1 signaling is important for preventing stress-induced barrier dysfunction. To test this hypothesis, the TNFR1KO/TAK1IEKO mice were subjected to acute colitis by administration of dextran sulfate sodium (DSS). We found that loss of TAK1 significantly augments DSS-induced experimental colitis. DSS induced weight loss, intestinal damages and inflammatory markers in TNFR1KO/TAK1IEKO mice at higher levels compared to the TNFR1KO control mice. Apoptosis was strongly induced and epithelial cell proliferation was decreased in the TAK1-deficient intestinal epithelium upon DSS exposure. These suggest that epithelial-derived TAK1 signaling is important for cytoprotection and repair against injury. Finally, we showed that TAK1 is essential for interleukin 1- and bacterial components-induced expression of cytoprotective factors such as interleukin 6 and cycloxygenase 2. Conclusions Homeostatic cytokines and microbes-induced intestinal epithelial TAK1 signaling regulates cytoprotective factors and cell proliferation, which is pivotal for protecting the intestinal epithelium against injury.}, number={2}, journal={PLOS ONE}, author={Kim, Jae-Young and Kajino-Sakamoto, Rie and Omori, Emily and Jobin, Christian and Ninomiya-Tsuji, Jun}, year={2009}, month={Feb} }
 @article{morioka_omori_kajino_kajino-sakamoto_matsumoto_ninomiya-tsuji_2009, title={TAK1 kinase determines TRAIL sensitivity by modulating reactive oxygen species and cIAP}, volume={28}, ISSN={["1476-5594"]}, DOI={10.1038/onc.2009.110}, abstractNote={TNF-related apoptosis-inducing ligand (TRAIL) is a potent inducer of cell death in several cancer cells, but many cells are resistant to TRAIL. The mechanism that determines sensitivity to TRAIL-killing is still elusive. Here we report that deletion of TAK1 kinase greatly increased activation of caspase-3 and cell death after TRAIL stimulation in keratinocytes, fibroblasts and cancer cells. Although TAK1 kinase is involved in NF-κB pathway, ablation of NF-κB did not alter sensitivity to TRAIL. We found that TRAIL could induce accumulation of reactive oxygen species (ROS) when TAK1 was deleted. Furthermore, we found that TAK1 deletion induced TRAIL-dependent downregulation of cIAP, which enhanced activation of caspase-3. These results show that TAK1 deletion facilitates TRAIL-induced cell death by activating caspase through ROS and downregulation of cIAP. Thus, inhibition of TAK1 can be an effective approach to increase TRAIL sensitivity.}, number={23}, journal={ONCOGENE}, author={Morioka, S. and Omori, E. and Kajino, T. and Kajino-Sakamoto, R. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2009}, month={Jun}, pages={2257–2265} }
 @article{kajino-sakamoto_inagaki_kim_robine_matsumoto_jobin_ninomiya-tsuji_2008, title={203 TAK1 Is Essential for Intestinal Epithelial Cell Survival and Regulates Intestinal Integrity}, volume={134}, ISSN={0016-5085}, url={http://dx.doi.org/10.1016/S0016-5085(08)60172-9}, DOI={10.1016/S0016-5085(08)60172-9}, number={4}, journal={Gastroenterology}, publisher={Elsevier BV}, author={Kajino-Sakamoto, Rie and Inagaki, Maiko and Kim, Jae-Young and Robine, Sylvie and Matsumoto, Kunihiro and Jobin, Christian and Ninomiya-Tsuji, Jun}, year={2008}, month={Apr}, pages={A-35-A-36} }
 @article{kajino-sakamoto_inagaki_lippert_akira_robine_matsumoto_jobin_ninomiya-tsuji_2008, title={Enterocyte-derived TAK1 signaling prevents epithelium apoptosis and the development of ileitis and colitis}, volume={181}, ISSN={["1550-6606"]}, DOI={10.4049/jimmunol.181.2.1143}, abstractNote={Abstract Recent studies have revealed that TAK1 kinase is an essential intermediate in several innate immune signaling pathways. In this study, we investigated the role of TAK1 signaling in maintaining intestinal homeostasis by generating enterocyte-specific constitutive and inducible gene-deleted TAK1 mice. We found that enterocyte-specific constitutive TAK1-deleted mice spontaneously developed intestinal inflammation as observed by histological analysis and enhanced expression of IL-1β, MIP-2, and IL-6 around the time of birth, which was accompanied by significant enterocyte apoptosis. When TAK1 was deleted in the intestinal epithelium of 4-wk-old mice using an inducible knockout system, enterocytes underwent apoptosis and intestinal inflammation developed within 2–3 days following the initiation of gene deletion. We found that enterocyte apoptosis and intestinal inflammation were strongly attenuated when enterocyte-specific constitutive TAK1-deleted mice were crossed to TNF receptor 1−/− mice. However, these mice later (>14 days) developed ileitis and colitis. Thus, TAK1 signaling in enterocytes is essential for preventing TNF-dependent epithelium apoptosis and the TNF-independent development of ileitis and colitis. We propose that aberration in TAK1 signaling might disrupt intestinal homeostasis and favor the development of inflammatory disease.}, number={2}, journal={JOURNAL OF IMMUNOLOGY}, author={Kajino-Sakamoto, Rie and Inagaki, Maiko and Lippert, Elisabeth and Akira, Shizuo and Robine, Sylvie and Matsumoto, Kunihiro and Jobin, Christian and Ninomiya-Tsuji, Jun}, year={2008}, month={Jul}, pages={1143–1152} }
 @article{inagaki_komatsu_scott_yamada_ray_ninomiya-tsuji_mishina_2008, title={Generation of a conditional mutant allele for Tab1 in mouse}, volume={46}, ISSN={["1526-968X"]}, DOI={10.1002/dvg.20418}, abstractNote={TAK1 binding protein 1 (TAB1) binds and induces autophosphorylation of TGF-β activating kinase (TAK1). TAK1, a mitogen-activated kinase kinase kinase, is involved in several distinct signaling pathways including non-Smad pathways for TGF-β superfamily members and inflammatory responses caused by cytokines. Conventional disruption of the murine Tab1 gene results in late gestational lethality showing intraventricular septum defects and underdeveloped lung alveoli. To gain a better understanding of the roles of TAB1 in different tissues, at different stages of development, and in pathological conditions, we generated Tab1 floxed mice in which the loxP sites flank Exons 9 and 10 to remove the C-terminal region of TAB1 protein necessary for activation of TAK1. We demonstrate that Cre-mediated recombination using Sox2-Cre, a Cre line expressed in the epiblast during early embryogenesis, results in deletion of the gene and protein. These homozygous Cre-recombined null embryos display an identical phenotype to conventional null embryos. This animal model will be useful in revealing distinct roles of TAB1 in different tissues at different stages. genesis 46:431–439, 2008. Published 2008 Wiley-Liss, Inc.}, number={8}, journal={GENESIS}, author={Inagaki, Maiko and Komatsu, Yoshihiro and Scott, Greg and Yamada, Gen and Ray, Manas and Ninomiya-Tsuji, Jun and Mishina, Yuji}, year={2008}, month={Aug}, pages={431–439} }
 @article{prickett_ninomiya-tsuji_broglie_muratore-schroeder_shabanowitz_hunt_brautigan_2008, title={TAB4 stimulates TAK1-TAB1 phosphorylation and binds polyubiquitin to direct signaling to NF-kappa B}, volume={283}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.m800943200}, abstractNote={Responses to transforming growth factor β and multiple cytokines involve activation of transforming growth factor β-activated kinase-1 (TAK1) kinase, which activates kinases IκB kinase (IKK) and MKK3/6, leading to the parallel activation of NF-κB and p38 MAPK. Activation of TAK1 by autophosphorylation is known to involve three different TAK1-binding proteins (TABs). Here we report a protein phosphatase subunit known as type 2A phosphatase-interacting protein (TIP) that also acts as a TAB because it co-precipitates with and directly binds to TAK1, enhances TAK1 autophosphorylation at unique sites, and promotes TAK1 phosphorylation of IKKβ and signaling to NF-κB. Mass spectrometry demonstrated that co-expression of TAB4 protein significantly increased phosphorylation of four sites in TAK1, in a linker region between the kinase and TAB2/3 binding domains, and two sites in TAB1. Recombinant GST-TAB4 bound in an overlay assay directly to inactive TAK1 and activated TAK1 but not TAK1 phosphorylated in the linker sites, suggesting a bind and release mechanism. In kinase assays using TAK1 immune complexes, added GST-TAB4 selectively stimulated IKK phosphorylation. TAB4 co-precipitated polyubiquitinated proteins dependent on a Phe-Pro motif that was required to enhance phosphorylation of TAK1. TAB4 mutated at Phe-Pro dominantly interfered with IL-1β activation of NF-κB involving IKK-dependent but not p38 MAPK-dependent signaling. The results show that TAB4 binds TAK1 and polyubiquitin chains to promote specific sites of phosphorylation in TAK1-TAB1, which activates IKK signaling to NF-κB. Responses to transforming growth factor β and multiple cytokines involve activation of transforming growth factor β-activated kinase-1 (TAK1) kinase, which activates kinases IκB kinase (IKK) and MKK3/6, leading to the parallel activation of NF-κB and p38 MAPK. Activation of TAK1 by autophosphorylation is known to involve three different TAK1-binding proteins (TABs). Here we report a protein phosphatase subunit known as type 2A phosphatase-interacting protein (TIP) that also acts as a TAB because it co-precipitates with and directly binds to TAK1, enhances TAK1 autophosphorylation at unique sites, and promotes TAK1 phosphorylation of IKKβ and signaling to NF-κB. Mass spectrometry demonstrated that co-expression of TAB4 protein significantly increased phosphorylation of four sites in TAK1, in a linker region between the kinase and TAB2/3 binding domains, and two sites in TAB1. Recombinant GST-TAB4 bound in an overlay assay directly to inactive TAK1 and activated TAK1 but not TAK1 phosphorylated in the linker sites, suggesting a bind and release mechanism. In kinase assays using TAK1 immune complexes, added GST-TAB4 selectively stimulated IKK phosphorylation. TAB4 co-precipitated polyubiquitinated proteins dependent on a Phe-Pro motif that was required to enhance phosphorylation of TAK1. TAB4 mutated at Phe-Pro dominantly interfered with IL-1β activation of NF-κB involving IKK-dependent but not p38 MAPK-dependent signaling. The results show that TAB4 binds TAK1 and polyubiquitin chains to promote specific sites of phosphorylation in TAK1-TAB1, which activates IKK signaling to NF-κB. Inflammatory cytokines tumor necrosis factor α and IL-1β activate cellular pathways involved in cell proliferation and apoptosis. IL-1β binding to its cognate receptor IL-1R induces recruitment of MyD88, IRAK1, IRAK4, and TRAF6 (1Martin M.U. Wesche H. Biochim. Biophys. Acta. 2002; 1592: 265-280Crossref PubMed Scopus (337) Google Scholar). IRAK4 functions in this complex to phosphorylate IRAK1, thereby triggering release of IRAK1 and TRAF6 into the cytoplasm and subsequent activation of IKK, 2The abbreviations used are: IKK, IκB kinase; MAPK, mitogen-activated protein kinase; TAK1, transforming growth factor β-activated kinase-1; TAB, TAK1-binding protein; TIP, type 2A phosphatase-interacting protein; GST, glutathione S-transferase; E2, ubiquitin carrier protein; E3, ubiquitin-protein isopeptide ligase; PP, protein phosphatase; HA, hemagglutinin; MOPS, 4-morpholinepropanesulfonic acid; MBP, myelin basic protein; wt, wild type; FP-AA, F254A/P255A; NF-κB, nuclear factor-κB. 2The abbreviations used are: IKK, IκB kinase; MAPK, mitogen-activated protein kinase; TAK1, transforming growth factor β-activated kinase-1; TAB, TAK1-binding protein; TIP, type 2A phosphatase-interacting protein; GST, glutathione S-transferase; E2, ubiquitin carrier protein; E3, ubiquitin-protein isopeptide ligase; PP, protein phosphatase; HA, hemagglutinin; MOPS, 4-morpholinepropanesulfonic acid; MBP, myelin basic protein; wt, wild type; FP-AA, F254A/P255A; NF-κB, nuclear factor-κB. c-Jun N-terminal kinase (JNK), and p38 MAPK (2Sakurai H. Shigemori N. Hasegawa K. Sugita T. Biochem. Biophys. Res. Commun. 1998; 243: 545-549Crossref PubMed Scopus (89) Google Scholar, 3Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar). The IKK complex consists of IKKα and IKKβ, the two catalytic subunits, and the regulatory subunit IKKγ (known as NEMO), which binds polyubiquitin chains and is ubiquitinated itself (4Pomerantz J.L. Baltimore D. Mol. Cell. 2002; 10: 693-695Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar). It is proposed that polyubiquitin chains act as a scaffold to allow for assembly of a signaling complex (5Crosetto N. Bienko M. Dikic I. Mol. Cancer Res. 2006; 4: 899-904Crossref PubMed Scopus (15) Google Scholar, 6Mukhopadhyay D. Riezman H. Science. 2007; 315: 201-205Crossref PubMed Scopus (955) Google Scholar). Genetic studies have implicated IKKβ and IKKγ in regulating activation of nuclear factor-κB (NF-κB) via phosphorylation of IκB and its subsequent degradation by the 26 S proteasome (7Perkins N.D. Nat. Rev. Mol. Cell Biol. 2007; 8: 49-62Crossref PubMed Scopus (1927) Google Scholar). Activation of IKK involves two complexes called TRIKA1 and TRIKA2 (8Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1633) Google Scholar, 9Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar). The first complex, TRIKA1, contains Ubc13/Uev1A (an E2 conjugating enzyme) and TRAF6 (an E3 ligase) (8Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1633) Google Scholar, 9Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar). The second complex, TRIKA2, contains TAK1, TAB1 (TAK1 activator), and TAB2/3 (ubiquitin-binding proteins) (8Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1633) Google Scholar, 9Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar). TRAF6 functions with Ubc13/Uev1A to catalyze the addition of polyubiquitin chains to TRAF6 and possibly other proteins via Lys63 linkages in ubiquitin (8Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1633) Google Scholar, 9Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar, 10Deng L. Wang C. Spencer E. Yang L. Braun A. You J. Slaughter C. Pickart C. Chen Z.J. Cell. 2000; 103: 351-361Abstract Full Text Full Text PDF PubMed Scopus (1504) Google Scholar). TAK1 is activated by TAK1-binding proteins (TABs). TAB1 binds TAK1 and promotes autophosphorylation of the activation loop (11Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (519) Google Scholar, 12Sakurai H. Miyoshi H. Mizukami J. Sugita T. FEBS Lett. 2000; 474: 141-145Crossref PubMed Scopus (141) Google Scholar, 13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar, 14Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). TAB2 and TAB3 activate TAK1 indirectly by binding polyubiquitinated proteins, possibly stabilizing a larger complex (15Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar, 16Kishida S. Sanjo H. Akira S. Matsumoto K. Ninomiya-Tsuji J. Genes Cells. 2005; 10: 447-454Crossref PubMed Scopus (72) Google Scholar, 17Kanayama A. Seth R.B. Sun L. Ea C.K. Hong M. Shaito A. Chiu Y.H. Deng L. Chen Z.J. Mol. Cell. 2004; 15: 535-548Abstract Full Text Full Text PDF PubMed Scopus (696) Google Scholar, 18Besse A. Lamothe B. Campos A.D. Webster W.K. Maddineni U. Lin S.C. Wu H. Darnay B.G. J. Biol. Chem. 2007; 282: 3918-3928Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 19Cheung P.C. Nebreda A.R. Cohen P. Biochem. J. 2004; 378: 27-34Crossref PubMed Scopus (134) Google Scholar). TAK1 associates with and is inactivated by multiple protein-Ser/Thr phosphatases, including different isoforms of the MPP phosphatases previously called PP2C (20Li M.G. Katsura K. Nomiyama H. Komaki K. Ninomiya-Tsuji J. Matsumoto K. Kobayashi T. Tamura S. J. Biol. Chem. 2003; 278: 12013-12021Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 21Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 22Hanada M. Ninomiya-Tsuji J. Komaki K. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar) as well as by protein phosphatase 6 (PP6), which dephosphorylates Thr187 in the activation loop of TAK1 (21Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). Our interest in PP6 raised a question about inactivation of TAK1. Studies of the TOR pathway in yeast led to the discovery of Tap42, a protein that binds all of the yeast type 2A phosphatases: Sit4 (PP6), Pph3, and Pph21/22 (PP2A) (23Di Como C.J. Arndt K.T. Genes Dev. 1996; 10: 1904-1916Crossref PubMed Scopus (440) Google Scholar). However, Tap42 action on phosphatases is not understood and is controversial. One group claims Tap42 is phosphorylated directly by TOR to increase Tap42 binding to Pph21/22 or Sit4 (24Duvel K. Broach J.R. Curr. Top. Microbiol. Immunol. 2004; 279: 19-38PubMed Google Scholar, 25Jiang Y. Broach J.R. EMBO J. 1999; 18: 2782-2792Crossref PubMed Scopus (274) Google Scholar). Another group suggests that Tap42 is restricted from binding to phosphatases by instead binding a protein called Tip41 (Tap42-interacting protein of 41 kDa) and that the Tip41-Tap42 complex is disrupted by TOR phosphorylation of Tip41 (26Jacinto E. Guo B. Arndt K.T. Schmelzle T. Hall M.N. Mol. Cell. 2001; 8: 1017-1026Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar). Yet a third scenario arose when it was reported that yeast Tip41 interacted with yeast phosphatases Pph21/22 and Pph3 in a two-hybrid assay (27Gingras A.C. Caballero M. Zarske M. Sanchez A. Hazbun T.R. Fields S. Sonenberg N. Hafen E. Raught B. Aebersold R. Mol. Cell. Proteomics. 2005; 4: 1725-1740Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). While our work was in progress another group published that the human orthologue of yeast Tip41 called type 2A phosphatase-interacting protein (TIP) binds human PP2A, PP4, and PP6 (28McConnell J.L. Gomez R.J. McCorvey L.R. Law B.K. Wadzinski B.E. Oncogene. 2007; 26: 6021-6030Crossref PubMed Scopus (64) Google Scholar). Thus, type 2 phosphatases, including PP6, can bind to yeast and human orthologues of both Tap42 (α-4Pomerantz J.L. Baltimore D. Mol. Cell. 2002; 10: 693-695Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar) and Tip41 (TIP). We showed that the human version of Tap42 called α-4 acts as a targeting subunit for PP2A, binding to MEK3 to promote selective dephosphorylation of one of two sites in the activation loop in that way opposing activation of p38 MAPK by cytokines (29Prickett T.D. Brautigan D.L. Mol. Cell. Biol. 2007; 27: 4217-4227Crossref PubMed Scopus (47) Google Scholar). Here because of the relationship to PP6 we investigated the function of the human TIP protein (NP_690866) relative to TAK1 and discovered properties that qualify this protein as a TAB and led us to call it TAB4. We show that, like TAB1, TAB4 directly binds and activates TAK1 by inducing autophosphorylation of TAK1. The activated TAK1 phosphorylates TAB1 and shows specificity toward the endogenous substrate IKKβ.A Phe-Pro sequence motif found in TAB2/3 is present in the C-terminal region of TAB4. Mutation of Phe254 and Pro255 in TAB4 eliminated binding of polyubiquitinated proteins and activation and phosphorylation of TAK1 and TAB1 without reduction in PP6 binding. These mutations separate multiple functions of TAB4. We propose that TAB4 is a multifunctional protein that promotes the activation of NF-κB using separate domains that bind TAK1 and polyubiquitin chains. cDNA Constructs, Plasmids, and Antibodies—Full-length human TAB4 was cloned downstream of GST in pGEX-4T2 using BamHI and EcoRI restriction sites for production of recombinant protein in bacteria. Recombinant GST-TAB4 was used to raise polyclonal antibodies in rabbits. Antibodies were purified using a two-step procedure. 1) GST-conjugated Affi-Gel-15 was used to preclear anti-GST antibodies followed by 2) purification with GST-TAB4-conjugated Affi-Gel-15 using 0.1 m glycine elution-2 m Tris-HCl neutralization as described in the manufacturer's protocol (Bio-Rad). TAB4 was also cloned downstream of HA epitope tag (pKHA vector) and FLAG epitope tag (pcDNA3-FLAG2 vector) using BamHI and EcoRI for expression in mammalian cells. Site-directed mutagenesis of TAB4 was done following the manufacturers' protocol. FLAG-TAK1, HA-TAK1, HA-TAK1(K63W), FLAG-TAB1, and T7-TAB1 were described previously (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar). FLAG-Ub vector was a kind gift from Dr. David Wotton at the University of Virginia. Antibodies (dilutions) used in this study are as follows: anti-FLAG (1:3,000) (Sigma-Aldrich), anti-HA (1:5,000) (12CA5), anti-T7 (1:10,000) (Novagen), anti-PP6 (1:5,000) (30Stefansson B. Brautigan D.L. J. Biol. Chem. 2006; 281: 22624-22634Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar), anti-(Thr(P)184/Thr(P)187) TAK1 (1:1,000) and anti-(Ser(P)177/Ser(P)181) IKKβ (1:1,000) (Cell Signaling Technology Inc.), anti-GST and anti-TAB4 (1:5,000) (described above), and anti-(Ser(P)187) MEK3/(Ser(P)207) MEK6 (1:1,000) (Santa Cruz Biotechnology, Inc.). Cell Culture, Transfection, Immunoprecipitation, and Pulldown Assays—HEK293, HEK293T, and 293IL-1R1 cells were grown in Dulbecco's modified Eagle's medium and 10% fetal bovine serum at 37 °C in a humidified incubator with 5% CO2. HEK293T cells were transfected using Arrest-In (Open Biosystems) as suggested by the manufacturer. In every case, HEK293T cells were seeded into 10-cm dishes at ∼40% confluence the day before transfection. Cells were transfected using ∼5 μg of plasmid for each construct and incubated for 24–48 h before harvesting. Cell extracts were made using a 1% Nonidet P-40 (Igepal CA-630, Sigma) lysis buffer (1% Nonidet P-40, 50 mm MOPS, pH 7.4, 150 mm NaCl, 1 μm microcystin-LR (Alexis Biochemicals), 1 mm sodium orthovanadate, 1 mm sodium fluoride, 1 mm Pefabloc, 1 mg/ml leupeptin, 1 mg/ml pepstatin, 1 mm dithiothreitol). Extracts were immunoprecipitated using either anti-FLAG M2 beads (Sigma-Aldrich), anti-HA beads (Sigma-Aldrich), or anti-TAB4 bound to protein A-agarose (Amersham Biosciences). Immunoprecipitations and pulldowns were done using approximately the same volume of extracts with 10–15 μl of a 50% slurry of anti-FLAG, anti-HA, and microcystin-LR-agarose beads. Immunoprecipitations and pulldowns were incubated at 4 °C for 2 h and then washed with Nonidet P-40 buffer two to three times. Complexes were eluted using 35 μl of 2× SDS sample buffer and boiled for 5 min. Extracts and immunoprecipitates were analyzed by immunoblotting using the antibodies described earlier and the LI-COR Odyssey infrared scanner and software. Recombinant λ-Phosphatase Treatment—HEK293T cells were transfected with 1) FLAG-TAK1 and T7-TAB1 or 2) FLAG-TAK1 and T7-TAB1 plus HA-TAB4, and extracts were made with RIPA buffer (1% Nonidet P-40, 0.25% sodium deoxycholate, 0.1% SDS, 50 mm MOPS, pH 7.4, 150 mm NaCl, 1 mm EDTA, 1 μm microcystin-LR, 1 mm sodium orthovanadate, 1 mm sodium fluoride, 20 mm β-glycerophosphate, 1 mm Pefabloc, 1 mg/ml leupeptin, 1 mg/ml pepstatin, 1 mm dithiothreitol). Immunoprecipitates were collected after 2 h at 4 °C and washed three times with RIPA buffer followed by two washes with 50 mm Tris-HCl, pH 7.5, 0.1 mm EDTA, 2 mm MnCl2, 5 mm dithiothreitol (λ-phosphatase buffer). Immunoprecipitates were taken up in 30 ml of λ-phosphatase buffer and treated with 0, 0.2, or 1 μl of MBP-λ-phosphatase (∼8,330 units/mg) for 2 h at 30 °C. Samples were then analyzed by SDS-PAGE and immunoblotted to detect mobility shifts of TAK1 and/or TAB1. Far-Western (Overlay) Assay—HEK293T cells were transfected with 1) FLAG-TAK1, 2) FLAG-TAK1 and T7-TAB1, 3) FLAG-TAK1 and T7-TAB1 plus HA-TAB4, or 4) empty vector control. Extracts were made using RIPA buffer and immunoprecipitated using anti-FLAG beads for 2 h at 4 °C. Immunoprecipitates were washed three times with RIPA buffer, eluted with 35 μl of 2× SDS sample buffer, and boiled for 5 min. Proteins were resolved by SDS-PAGE and transferred to nitrocellulose. Membranes were blocked in 1% blocking buffer (1% bovine serum albumin in Tris-buffered saline/Tween 20) for 2 h. Probes were diluted in 1% blocking buffer at a concentration of 5 mg/ml and incubated overnight at 4 °C. Membranes were washed two to three times with 1× phosphate-buffered saline for 1–2 min followed by fixation using 0.5% paraformaldehyde for 30 min at room temperature. Membranes were then rinsed quickly twice with 1× phosphate-buffered saline and quenched using 2% glycine in phosphate-buffered saline for 10 min at room temperature. The membrane was incubated with anti-GST plus secondary antibody and analyzed using the LI-COR Odyssey system and software. FLAG-Ub Binding Assay—HEK293T cells were transfected with HA-TAB4(wt), HA-TAB4(F254A), or HA-TAB4(FP-AA) or empty vector control along with FLAG-Ub. Extracts were prepared using 1% Nonidet P-40 lysis buffer described above and immunoprecipitated using anti-HA beads for 2 h at 4 °C and washed 2–3 times with Nonidet P-40 buffer. HA-FLAG complexes were eluted using 35 μl 2X SDS sample buffer and boiled for 5 min. Samples were analyzed by SDS-PAGE and immunoblotted with anti-FLAG and anti-HA. Immunoblots were analyzed using the LI-COR Odyssey system and software. In Vitro TAK1 Kinase Assay with MKK6 or IKKβ—HEK293T cells were transfected with 1) FLAG-TAK1, 2) FLAG-TAK1 and T7-TAB1, or 3) FLAG-TAK1 and T7-TAB1 plus either HA-TAB4(wt), 4) HA-TAB4(F254A), or 5) HA-TAB4(FP-AA). Extracts were prepared using a 1% Nonidet P-40 lysis buffer described above and immunoprecipitated using anti-FLAG beads. Immunoprecipitates were collected after 2 h at 4 °C, washed two to three times with Nonidet P-40 buffer, and then washed twice in 20 mm Tris-HCl, pH 7.5, 500 mm NaCl, 10 mm MgCl2. Immunoprecipitates were taken up in 30 ml of 20 mm Tris-HCl, pH 7.5, 10 mm MgCl2. Kinase assays were done using 1 μg of recombinant His6-MKK6 or GST-IKKβ (Upstate-Chemicon), 5 μl of immunoprecipitate, 2 μl of 5× kinase buffer (50 mm Tris-HCl, pH 7.5, 5 mm dithiothreitol, 25 mm MgCl2), 5 μCi of [γ-32P]ATP at 30 °C for 2 min. Kinase reactions were stopped by adding an equal volume of 2× SDS sample buffer and resolved by SDS-PAGE followed by staining with Gel-Code Blue (Pierce) to visualize bands. Bands corresponding to His6-MKK6 or GST-IKKβ were excised from the stained gel, and 32P was analyzed using a liquid scintillation counter. NF-κB Luciferase Assays—HEK293T cells were seeded at 30–40% confluence in 12-well dishes and transfected 16 h later with 100 ng of F254A, FP-AA, or empty vector plus 100 ng of NF-κB firefly luciferase and 10 ng of Renilla luciferase vectors or with 100 ng of FLAG-TAB4(wt) or empty vector and HA-TAK1(wt) or HA-TAK1(K63W) plus 100 ng of NF-κB luciferase and 10 ng of Renilla vectors. Cells were incubated for 16 h before changing the medium to serum-free conditions (0.5% fetal bovine serum, Dulbecco's modified Eagle's medium) for the remainder of the experiment. Cells were pretreated with curcumin or SB203580 for 30 min prior to stimulation for 6 h with 10 ng/ml IL-1β or vehicle alone. Cells were harvested and analyzed as described previously (29Prickett T.D. Brautigan D.L. Mol. Cell. Biol. 2007; 27: 4217-4227Crossref PubMed Scopus (47) Google Scholar) to test for luciferase activities in extracts. TAB4 Enhances Activation of TAK1-TAB1—The human protein NP_690866 has been reported to bind protein phosphatase catalytic subunits PP2A, PP4, and PP6 (27Gingras A.C. Caballero M. Zarske M. Sanchez A. Hazbun T.R. Fields S. Sonenberg N. Hafen E. Raught B. Aebersold R. Mol. Cell. Proteomics. 2005; 4: 1725-1740Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar, 28McConnell J.L. Gomez R.J. McCorvey L.R. Law B.K. Wadzinski B.E. Oncogene. 2007; 26: 6021-6030Crossref PubMed Scopus (64) Google Scholar) and is referred to as TIP. We found that TIP bound type 2 phosphatases in a yeast two-hybrid assay and noted that it showed preferential binding to the C-terminal region of PP6 (residues 177–305) compared with PP2A. Because PP6 dephosphorylates and inactivates TAK1 kinase (21Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar), we tested whether overexpression of this PP6-binding protein (which we called TAB4) would affect TAK1. Activation of TAK1 and its substrate IKKβ were assayed in whole cell extracts by immunoblotting with phosphosite-specific antibodies (Fig. 1A). Neither TAK1 nor IKKβ were phosphorylated in cells transfected with FLAG-TAK1 alone (lane 1) or T7-TAB1 alone (lane 2). However, cells co-expressing FLAG-TAK1 with T7-TAB1 exhibited phospho-TAK1, with retarded migration of the FLAG-TAK1, and increased phosphorylation of endogenous IKKβ (lane 3). Compared with this, co-expression with HA-TAB4 (lane 6) caused more reduced migration of FLAG-TAK1 and greatly increased the phosphorylation of endogenous IKKβ at Ser177/Ser181 with appearance of multiple IKK bands presumably due to other sites of phosphorylation. Co-expression of TAB4 with either FLAG-TAK1 alone (lane 4) or T7-TAB1 alone (lane 5) as controls did not induce phosphorylation of either TAK1 or IKKβ. This shows TAB1 dependence of TAK1 activation by TAB4, the same as for activation of TAK1 by TAB2/3. The effects were specific for TAB4 and not mimicked by overexpression of another PP2A/PP4/PP6-binding protein, α-4 (Fig. 1A). HA-α-4 was expressed with FLAG-TAK1 (lane 7) or T7-TAB1 (lane 8) but produced no increase in phospho-TAK1, no gel shift of FLAG-TAK1, and no detectable phospho-IKKβ. Triple expression of HA-α-4, FLAG-TAK1, and T7-TAB1 (lane 9) was no different from dual expression of FLAG-TAK1 and T7-TAB1 (lane 3). The level of HA-α-4 expressed in these controls was even higher than the levels of HA-TAB4 in parallel samples based on anti-HA immunoblotting (Fig. 2A, lanes 4–6 and 7–9). Together these results showed that TAB4 expression enhanced TAB1-dependent TAK1 phosphorylation and TAK1 activity toward the endogenous substrate IKKβ.FIGURE 2Phosphorylation sites in TAK1 and TAB1. Phosphorylation sites in TAK1 (top) and TAB1 (bottom) are shown as vertical lines, and those sites significantly increased by co-expression of TAB4 are indicated with a P above the boxes. The kinase domain with three sites of activating phosphorylation and the TAB2/3 binding region in TAK1 and the PP2C-like domain and TAK1 binding domain in TAB1 are shown as hatched boxes within the entire sequence. TGFβ, transforming growth factor β.View Large Image Figure ViewerDownload Hi-res image Download (PPT) TAB4 Significantly Increases Multiple Sites of Phosphorylation in TAK1 and TAB1—The reduced mobility of FLAG-TAK1 and T7-TAB1 in SDS-PAGE was due to phosphorylation that was induced by TAB4 and reversed by λ-phosphatase (Fig. 1B). FLAG-TAK1 and T7-TAB1 were expressed in HEK293T cells with and without HA-TAB4, and complexes were immunoprecipitated using anti-FLAG M2 beads. Immunoblotting with anti-FLAG and anti-T7 showed reduced mobility of both TAK1 and TAB1 proteins due to TAB4 co-expression (Fig. 1B; also see Fig. 3A below). Incubation of immunoprecipitates with increasing amounts of recombinant λ-phosphatase-MBP fusion protein dephosphorylated both FLAG-TAK1 and T7-TAB1 as evident from their increased mobility (Fig. 1B). After dephosphorylation by MBP-λ-phosphatase the FLAG-TAK1 and T7-TAB1 had the same mobility whether they originated from cells expressing or not expressing TAB4. This demonstrated that the extra reduced mobility of TAK1 and TAB1 during co-expression with TAB4 was due to phosphorylation. We noted that migration of TAB4 itself in SDS-PAGE was not affected by co-expression with TAK1-TAB1 or incubation with MBP-λ-phosphatase, suggesting that it was not phosphorylated. The results demonstrate that TAB4 increased phosphorylation and kinase activity of TAK1-TAB1 complexes. Phosphorylation sites in both TAK1 and TAB1 induced by co-expression of TAB4 were mapped by mass spectrometry. Cells were transfected to express TAK1-TAB1 with and without TAB4, FLAG-TAK1 complexes were immunoprecipitated, and the tryptic peptides were analyzed by a linear quadrupole ion trap-Fourier transform mass spectrometer (ThermoScientific) (Table 1). A total of at least 16 phosphorylation sites were identified in FLAG-TAK1, including the well known sites at Thr184, Thr187, and Ser192 in the kinase activation loop (Fig. 2). Phosphorylation of 14 sites in T7-TAB1 were identified. Co-expression of TAB4 induced a significant increase (>5-fold) in phosphorylation of at least four sites in TAK1: 1) residue Thr344 in peptide residues 331–347; 2) peptide 373–386 with residues Ser374, Ser375, and Ser382; 3) peptide 388–398 containing residues Ser389 and Ser393; and 4) peptide 412–429 containing residues Ser412, Thr421, and Ser428. These all mapped to a region C-terminal to the kinase domain (Fig. 2). Likewise co-expression of TAB4 significantly increased at least two sites of phosphorylation in TAB1: 1) peptide 364–386 containing phosphorylated residues Ser273 and Ser278 and 2) peptide 464–477 phosphorylated at residue Ser464 or Ser469. Thus, TAB4 co-expression significantly increased phosphorylation of specific sites in both TAK1 and TAB1.TABLE 1Phosphopeptide analysis of TAK1 and TAB1 by mass spectrometrySitesPeptidesaPeptides with significantly increased phosphorylation (>5-fold) determined by peak area from co-expression of TAB4 are in boldface font.SequencebListing of TAK1 and TAB1 phosphopeptides detected in single letter code. Confirmed phosphorylation sites (phosphoserine (pS) or phosphothreonine (pT)) are in boldface font. “p()” indicates that a phosphorylation site is located within the parentheses but could not be defined further by the observed fragmentation.FLAG-TAK1 Thr184 or Thr187173-190ICDFGTACDIQp (THMT) NNK Thr184 and Thr187ICDFGTACDIQpTHMpTNNK triplephos (Thr178 or Thr184 or Thr187 or Ser192)173-209ICDFGppp (TACDIQTHMTNNKGS) AAWMAPEVFEGSNYSEK Thr344331-347SDTNMEQVPATNDpTIKR Ser374 or Ser375373-386cCoelution of more than one phosphorylated form of the peptide collectively contributed to the increased abundance.Gp (SS) VESLPPTSEGK Thr382GSSVESLPPpTSEGK Ser389388-398cCoelution of more than one phosphorylated form of the peptide collectively contributed to the increased abundance.MpSADMSEIEAR Ser393MSADMpSEIEAR Thr402399-409IVApTAGNGQPR Ser412 and (Thr419 or Thr421) and (Ser427 or Ser428)410-429RRpSIQDLTVp (TGT) EPGQVp (SS) R Ser412412-429pSIQDLTVTGTEPGQVSSR Ser412 and Thr421412-429cCoelution of more than one phosphorylated form of the peptide collectively contributed to the increased abundance.pSIQDLTVTGpTEPGQVSSR Ser412 and Ser428pSIQDLTVTGTEPGQVSpSR Thr440437-450MIpTTSGPTSEKPAR Thr444 or Ser445MITTSGPp (TS) EKPAR Thr440 and (Thr444 or Ser445)MIpTTSGPp (TS) EKPAR Thr537520-539KQELVAELDQDEKDQQNpTSRT7-TAB1 Ser77-35pSLLQSEQQPSWTDDLPLCHLSGVGSASNR Ser16 or Thr18SLLQSEQQPp (SWT) DDLPLCHLSGVGSASNR Ser7 and Ser16pSLLQSEQQPpSWTDDLPLCHLSGVGSASNR Ser7 and Thr18pSLLQSEQQPSWpTDDLPLCHLSGVGSASNR Thr4436-55SYSADGKGpTESHPPEDSWLK Ser120116-128SFLEpSIDDALAEK Ser263 or Thr282263-294p (SKPIIAEPEIHGAQPLDGVT) GFLVLMSEGLYK Ser344337-348IHSDTFApSGGER Ser373364-386cCoelution of more than one phosphorylated form of the peptide collectively contributed to the increased abundance.NFGYPLGEMpSQPTPSPAPAAGGR Ser378NFGYPLGEMSQPTPpSPAPAAGGR Ser373 and Ser378NFGYPLGEMpSQPTPpSPAPAAGGR Ser396387-402VYPVSVPYSpSAQSTSK Ser399, Thr400, or Ser401VYPVSVPYSSAQp (STS) K Ser396 and (Ser399 or Thr400 or Ser401)VYPVSV}, number={28}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Prickett, Todd D. and Ninomiya-Tsuji, Jun and Broglie, Peter and Muratore-Schroeder, Tara L. and Shabanowitz, Jeffrey and Hunt, Donald F. and Brautigan, David L.}, year={2008}, month={Jul}, pages={19245–19254} }
 @article{kim_omori_matsumoto_nunez_ninomiya-tsuji_2008, title={TAK1 is a central mediator of NOD2 signaling in epidermal cells}, volume={283}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M704746200}, abstractNote={Muramyl dipeptide (MDP) is a peptidoglycan moiety derived from commensal and pathogenic bacteria, and a ligand of its intracellular sensor NOD2. Mutations in NOD2 are highly associated with Crohn disease, which is characterized by dysregulated inflammation in the intestine. However, the mechanism linking abnormality of NOD2 signaling and inflammation has yet to be elucidated. Here we show that transforming growth factor β-activated kinase 1 (TAK1) is an essential intermediate of NOD2 signaling. We found that TAK1 deletion completely abolished MDP-NOD2 signaling, activation of NF-κB and MAPKs, and subsequent induction of cytokines/chemokines in keratinocytes. NOD2 and its downstream effector RICK associated with and activated TAK1. TAK1 deficiency also abolished MDP-induced NOD2 expression. Because mice with epidermis-specific deletion of TAK1 develop severe inflammatory conditions, we propose that TAK1 and NOD2 signaling are important for maintaining normal homeostasis of the skin, and its ablation may impair the skin barrier function leading to inflammation. Muramyl dipeptide (MDP) is a peptidoglycan moiety derived from commensal and pathogenic bacteria, and a ligand of its intracellular sensor NOD2. Mutations in NOD2 are highly associated with Crohn disease, which is characterized by dysregulated inflammation in the intestine. However, the mechanism linking abnormality of NOD2 signaling and inflammation has yet to be elucidated. Here we show that transforming growth factor β-activated kinase 1 (TAK1) is an essential intermediate of NOD2 signaling. We found that TAK1 deletion completely abolished MDP-NOD2 signaling, activation of NF-κB and MAPKs, and subsequent induction of cytokines/chemokines in keratinocytes. NOD2 and its downstream effector RICK associated with and activated TAK1. TAK1 deficiency also abolished MDP-induced NOD2 expression. Because mice with epidermis-specific deletion of TAK1 develop severe inflammatory conditions, we propose that TAK1 and NOD2 signaling are important for maintaining normal homeostasis of the skin, and its ablation may impair the skin barrier function leading to inflammation. Animals are constantly exposed to microorganisms present on the skin and in the gastrointestinal tract. Detecting microorganisms and activating host immune systems to prevent their invasion are crucial for animal survival. The innate immune system, the first line of defense against invading microbial pathogens, uses pattern recognition receptors such as Toll-like receptors (TLRs) 2The abbreviations used are:TLRToll-like receptorMDPmuramyl dipeptideNODnucleotide-binding and oligomerization domainCARDcaspase recruitment domainTAKtransforming growth factor β-activated kinaseTNFtumor necrosis factorTRAFTNF receptor-associated factorIKKIκB kinaseLPSlipopolysaccharideMAPKmitogen-activated protein kinaseMAPKKMAPK kinaseMAPKKKMAPKK kinaseILinterleukinJNKc-Jun NH2-terminal kinaseHAhemagglutininDTTdithiothreitolEMSAelectrophoretic mobility shift assay 2The abbreviations used are:TLRToll-like receptorMDPmuramyl dipeptideNODnucleotide-binding and oligomerization domainCARDcaspase recruitment domainTAKtransforming growth factor β-activated kinaseTNFtumor necrosis factorTRAFTNF receptor-associated factorIKKIκB kinaseLPSlipopolysaccharideMAPKmitogen-activated protein kinaseMAPKKMAPK kinaseMAPKKKMAPKK kinaseILinterleukinJNKc-Jun NH2-terminal kinaseHAhemagglutininDTTdithiothreitolEMSAelectrophoretic mobility shift assay to recognize microorganisms or their products on the cell membranes (1Akira S. Uematsu S. Takeuchi O. Cell. 2006; 124: 783-801Abstract Full Text Full Text PDF PubMed Scopus (8554) Google Scholar, 2Takeda K. Akira S. Int. Immunol. 2005; 17: 1-14Crossref PubMed Scopus (2663) Google Scholar). In addition to TLRs, there is increasing evidence that intracellular recognition of bacteria is equally important in innate immune responses (3Inohara N. Chamaillard M. McDonald C. Nunez G. Annu. Rev. Biochem. 2005; 74: 355-383Crossref PubMed Scopus (803) Google Scholar, 4Kobayashi K.S. Eynon E.E. Flavell R.A. Nat. Immunol. 2003; 4: 652-654Crossref PubMed Scopus (11) Google Scholar). NOD-like receptors are a family of cytosolic proteins that are involved in the recognition of intracellular bacteria (3Inohara N. Chamaillard M. McDonald C. Nunez G. Annu. Rev. Biochem. 2005; 74: 355-383Crossref PubMed Scopus (803) Google Scholar, 4Kobayashi K.S. Eynon E.E. Flavell R.A. Nat. Immunol. 2003; 4: 652-654Crossref PubMed Scopus (11) Google Scholar). NOD2 is a member of the NOD-like receptors protein family that contains a caspase recruitment domain (CARD) in the N-terminal region, a nucleotide-binding and oligomerization domain (NOD) in the central region, and leucine-rich repeats in the C terminus (3Inohara N. Chamaillard M. McDonald C. Nunez G. Annu. Rev. Biochem. 2005; 74: 355-383Crossref PubMed Scopus (803) Google Scholar, 4Kobayashi K.S. Eynon E.E. Flavell R.A. Nat. Immunol. 2003; 4: 652-654Crossref PubMed Scopus (11) Google Scholar, 5Ogura Y. Inohara N. Benito A. Chen F.F. Yamaoka S. Nunez G. J. Biol. Chem. 2001; 276: 4812-4818Abstract Full Text Full Text PDF PubMed Scopus (1159) Google Scholar). NOD2 senses muramyl dipeptide (MDP), the minimal peptidoglycan motif common to both Gram-positive and -negative bacteria, via the leucine-rich repeat domain (6Inohara N. Ogura Y. Fontalba A. Gutierrez O. Pons F. Crespo J. Fukase K. Inamura S. Kusumoto S. Hashimoto M. Foster S.J. Moran A.P. Fernandez-Luna J.L. Nunez G. J. Biol. Chem. 2003; 278: 5509-5512Abstract Full Text Full Text PDF PubMed Scopus (1386) Google Scholar, 7Girardin S.E. Boneca I.G. Viala J. Chamaillard M. Labigne A. Thomas G. Philpott D.J. Sansonetti P.J. J. Biol. Chem. 2003; 278: 8869-8872Abstract Full Text Full Text PDF PubMed Scopus (1886) Google Scholar). Upon MDP stimulation, NOD2 is oligomerized via the central nucleotide-binding and oligomerization domain and recruits RICK, a serine/threonine kinase carrying a caspase recruitment domain at its C terminus, through CARD-CARD interactions (8Inohara N. del Peso L. Koseki T. Chen S. Nunez G. J. Biol. Chem. 1998; 273: 12296-12300Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar, 9McCarthy J.V. Ni J. Dixit V.M. J. Biol. Chem. 1998; 273: 16968-16975Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar, 10Thome M. Hofmann K. Burns K. Martinon F. Bodmer J.L. Mattmann C. Tschopp J. Curr. Biol. 1998; 8: 885-888Abstract Full Text Full Text PDF PubMed Google Scholar, 11Medzhitov R. Janeway Jr., C. Immunol. Rev. 2000; 173: 89-97Crossref PubMed Scopus (1106) Google Scholar). The induction of NOD2-RICK signaling leads to activation of proinflammatory transcription factors such as NF-κB and AP-1 (5Ogura Y. Inohara N. Benito A. Chen F.F. Yamaoka S. Nunez G. J. Biol. Chem. 2001; 276: 4812-4818Abstract Full Text Full Text PDF PubMed Scopus (1159) Google Scholar, 8Inohara N. del Peso L. Koseki T. Chen S. Nunez G. J. Biol. Chem. 1998; 273: 12296-12300Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar, 11Medzhitov R. Janeway Jr., C. Immunol. Rev. 2000; 173: 89-97Crossref PubMed Scopus (1106) Google Scholar). Studies using mice deficient in RICK have revealed that this kinase is essential for eliciting innate immunity in response to MDP (12Park J.H. Kim Y.G. McDonald C. Kanneganti T.D. Hasegawa M. Body-Malapel M. Inohara N. Nunez G. J. Immunol. 2007; 178: 2380-2386Crossref PubMed Scopus (384) Google Scholar). RICK has been also reported to function as a scaffold protein bringing NOD2 and IκB kinase (IKK) into close proximity (13Inohara N. Koseki T. Lin J. del Peso L. Lucas P.C. Chen F.F. Ogura Y. Nunez G. J. Biol. Chem. 2000; 275: 27823-27831Abstract Full Text Full Text PDF PubMed Scopus (449) Google Scholar) and to mediate ubiquitination of NEMO/IKKγ, a key component of NF-κB signaling complex (14Abbott D.W. Wilkins A. Asara J.M. Cantley L.C. Curr. Biol. 2004; 14: 2217-2227Abstract Full Text Full Text PDF PubMed Scopus (314) Google Scholar). However, the exact molecular mechanism by which NOD2-RICK activates IKK-NF-κB and MAPK pathways remains undefined.Initial studies revealed that NOD2 expression was restricted to monocytes/macrophages (5Ogura Y. Inohara N. Benito A. Chen F.F. Yamaoka S. Nunez G. J. Biol. Chem. 2001; 276: 4812-4818Abstract Full Text Full Text PDF PubMed Scopus (1159) Google Scholar). However, additional studies showed that NOD2 is also expressed in several epithelial cells including enterocytes (15Gutierrez O. Pipaon C. Inohara N. Fontalba A. Ogura Y. Prosper F. Nunez G. Fernandez-Luna J.L. J. Biol. Chem. 2002; 277: 41701-41705Abstract Full Text Full Text PDF PubMed Scopus (395) Google Scholar) and keratinocytes (16Voss E. Wehkamp J. Wehkamp K. Stange E.F. Schroder J.M. Harder J. J. Biol. Chem. 2006; 281: 2005-2011Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar). Both enterocytes and keratinocytes are normally exposed to commensal bacteria, and they are activated by bacterial components including MDP (16Voss E. Wehkamp J. Wehkamp K. Stange E.F. Schroder J.M. Harder J. J. Biol. Chem. 2006; 281: 2005-2011Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar, 17Kobayashi K.S. Chamaillard M. Ogura Y. Henegariu O. Inohara N. Nunez G. Flavell R.A. Science. 2005; 307: 731-734Crossref PubMed Scopus (1461) Google Scholar). Upon stimulation, enterocytes and keratinocytes produce antibacterial peptides as well as many cytokines/chemokines to recruit and activate immune cells in the intestine and skin, thereby preventing bacterial invasion and proliferation (17Kobayashi K.S. Chamaillard M. Ogura Y. Henegariu O. Inohara N. Nunez G. Flavell R.A. Science. 2005; 307: 731-734Crossref PubMed Scopus (1461) Google Scholar, 18Wehkamp J. Harder J. Weichenthal M. Schwab M. Schaffeler E. Schlee M. Herrlinger K.R. Stallmach A. Noack F. Fritz P. Schroder J.M. Bevins C.L. Fellermann K. Stange E.F. Gut. 2004; 53: 1658-1664Crossref PubMed Scopus (673) Google Scholar). Loss-of-function mutations of NOD2 are highly correlated with susceptibility of Crohn disease, a subtype of inflammatory bowel disease that is characterized by chronic inflammation in the intestine (19Bouma G. Strober W. Nat. Rev. Immunol. 2003; 3: 521-533Crossref PubMed Scopus (1475) Google Scholar, 20Kobayashi K. Inohara N. Hernandez L.D. Galan J.E. Nunez G. Janeway C.A. Medzhitov R. Flavell R.A. Nature. 2002; 416: 194-199Crossref PubMed Scopus (740) Google Scholar). The mechanism by which ablation of MDP-NOD2 signaling can enhance inflammation in vivo has been a much debated subject (21Eckmann L. Karin M. Immunity. 2005; 22: 661-667Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 22Hugot J.P. Ann. N. Y. Acad. Sci. 2006; 1072: 9-18Crossref PubMed Scopus (75) Google Scholar, 23Kelsall B. Nat. Med. 2005; 11: 383-384Crossref PubMed Scopus (25) Google Scholar). One plausible mechanism is that failure of up-regulation of antimicrobial peptides and/or cytokines/chemokines via MDP derived from commensal bacteria increases susceptibility to bacterial invasion, which may impair the epithelial barrier function and ultimately induce chronic inflammation. However, it has not been established whether loss of NOD2 signaling is causally involved in loss of epithelial barrier function in vivo.Transforming growth factor β-activated kinase 1 (TAK1) is a member of the MAPKKK family and plays an essential role in tumor necrosis factor (TNF), interleukin 1 (IL-1), and TLR signaling pathways (24Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1011) Google Scholar, 25Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (740) Google Scholar, 26Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (582) Google Scholar, 27Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (315) Google Scholar). In response to proinflammatory cytokines or TLR ligands, TAK1 is recruited to TNF receptor-associated factors (TRAFs) and TAK1-binding proteins, which serve as adaptor proteins, and TAK1 in turn phosphorylates and activates IKKs as well as MAPKKs, which subsequently activate the MAPKs JNK and p38. These pathways ultimately activate transcription factors NF-κB and AP-1. Besides its well established role in proinflammatory cytokines and TLR signaling, TAK1 is also reported to be involved in NOD2 signaling (28Chen C.M. Gong Y. Zhang M. Chen J.J. J. Biol. Chem. 2004; 279: 25876-25882Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). TAK1 interacts with NOD2, and overexpression of dominant negative TAK1 inhibits NOD2-induced NF-κB activation. Recently, Windheim et al. (29Windheim M. Lang C. Peggie M. Cummings L. Cohen P. Biochem. J. 2007; 404: 179-190Crossref PubMed Scopus (154) Google Scholar) reported that TAK1 is important for MDP signaling by using a selective inhibitor of TAK1 as well as using TAK1 knock-out embryonic fibroblasts. However, the physiological roles of TAK1 in NOD2 signaling remain to be elucidated.In this study, we determined the role of TAK1 in NOD2 signaling by utilizing TAK1 FL/FL (floxed) and Δ/Δ (knock-out) keratinocytes generated by the Cre-LoxP system (30Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). We found that NOD2-induced innate immune responses are completely abolished in TAK1 Δ/Δ cells and that TAK1 was activated upon stimulation of the MDP-NOD2-RICK pathway. In addition, we found that ablation of TAK1 blocked MDP-induced up-regulation of NOD2. Our results indicate that TAK1 is not only an essential downstream molecule of NOD2-RICK signaling but also is involved in the regulation of NOD2 expression.EXPERIMENTAL PROCEDURESCells—TAK1 FL/FL and Δ/Δ keratinocytes were isolated from TAK1 FL/FL and epidermis-specific TAK1 deletion mice described in our previous publication (30Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). Spontaneously immortalized keratinocytes derived from the skin of postnatal day 0–2 mice were cultured in Ca2+-free minimal essential medium (Sigma) supplemented with 4% Chelex-treated bovine growth serum, 10 ng/ml human epidermal growth factor (Invitrogen), 0.05 mm calcium chloride, and 1% penicillin/streptomycin at 33 °C in 8% CO2. Human embryonic kidney 293 and human colorectal adenocarcinoma HT-29 cells were cultured in Dulbecco's modified Eagle's medium containing 10% bovine growth serum (HyClone). 293 cells were transfected by the standard calcium phosphate precipitation method.Antibodies, Plasmids, and Reagents—Anti-NF-κB p65 (F-6), anti-NF-κB p50 (H-119), anti-NF-κB p52 (K-27), anti-IKKα (H-744), anti-IKKα/β (H-470), JNK (FL), anti-p38 (N-20) and anti-RICK (H-300) antibodies were purchased from Santa Cruz Biotechnology. Antibodies to phosphorylated JNK, phosphorylated p38, and phosphorylated TAK1 (Thr-187) were purchased from Cell Signaling Technology. Anti-FLAG (Sigma) and Anti-HA (Covance) were used. Anti-TAK1 was described previously (24Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1011) Google Scholar). Anti-human NOD2 affinity-purified rabbit polyclonal antibody was produced by immunizing a peptide DEEERASVLLGHSPGE (amino acids 11–26 of human NOD2). Human NOD2 cDNAs were subcloned to pCMV-HA vector. FLAG-tagged RICK plasmids were described previously (20Kobayashi K. Inohara N. Hernandez L.D. Galan J.E. Nunez G. Janeway C.A. Medzhitov R. Flavell R.A. Nature. 2002; 416: 194-199Crossref PubMed Scopus (740) Google Scholar). pMX-puro-TAK1, -NOD2, and -RICK were generated by inserting the cDNAs into the pMX-puro vectors (31Kitamura T. Int. J. Hematol. 1998; 67: 351-359Crossref PubMed Google Scholar). MDP-LD, MDP-LL, and lipopolysaccharide (LPS) were purchased from Sigma.Real-time PCR Analysis—Total RNA was prepared from cultured keratinocytes using the RNeasy Protect mini kit (Qiagen). To obtain cDNA, 200 ng of each RNA samples were reverse transcribed using TaqMan reverse transcription reagents (Applied Biosystems). Real-time PCR analysis was performed using the ABI PRISM 7000 sequence detection system. An Assays-on-Demand gene expression kit (Applied Biosystems) was used for detecting the expression of MIP2, TNF, and NOD2. All samples were normalized to the signal generated from glyceraldehyde-3-phosphate dehydrogenase.Immunoprecipitation and Immunoblotting—Cells were washed once with ice-cold phosphate-buffered saline, and whole cell extracts were prepared using lysis buffer (20 mm HEPES, pH 7.4, 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mm MgCl2, 2 mm EGTA, 10 mm NaF, 2 mm dithiothreitol (DTT), 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 20 μm aprotinin, 0.5% Triton X-100). For coprecipitation assay, cell lysates were immunoprecipitated with 1 μg of various antibodies and 15 μl of protein G-Sepharose (GE Healthcare). The immunoprecipitates were washed three times with washing buffer (20 mm HEPES, 10 mm MgCl2, 500 mm NaCl), resuspended in 2× SDS sample buffer, and boiled. For detecting endogenous interaction between TAK1 and RICK, HT-29 cells were resuspended in hypotonic buffer (20 mm HEPES-KOH, 10 mm KCl, 1 mm MgCl2, 1 mm EDTA, 1 mm EGTA, 1 mm DTT, pH 7.5) supplemented with protease inhibitors (10 mm NaF, 1 mm phenylmethylsulfonyl fluoride, and 20 μm aprotinin). Resuspended cells were lysed by passing through a 22-gauge needle 10 times and adding an equivalent volume of hypotonic buffer containing 0.1% Nonidet P-40 and 300 mm NaCl. Cell lysates were immunoprecipitated with 1.5 μg of control IgG or anti-RICK antibody. For immunoblotting, the immunoprecipitates or whole cell extracts were resolved on SDS-PAGE and transferred to Hybond-P membranes (GE Healthcare). The membranes were immunoblotted with various antibodies, and the bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against rabbit or mouse IgG using the ECL Western blotting system (GE Healthcare).Electrophoretic Mobility Shift Assay (EMSA)—Whole cell extracts were prepared from keratinocytes stimulated with MDP for indicated time points. 32P-Labeled NF-κB oligonucleotides (Promega) were used for generating radiolabeled probe. 30 μg of whole cell extracts were incubated with radiolabeled probe, 4% glycerol, 1 mm MgCl2, 0.5 mm EDTA, 0.5 mm DTT, 50 mm NaCl, 10 mm Tris-HCl (pH 7.5), 500 ng of poly(dI·dC) (GE Healthcare), and 10 μg of bovine serum albumin in a final volume of 20 μl for 20 min and subjected to electrophoresis on a 4% (w/v) polyacrylamide gel. For supershift assay, the whole cell extracts were incubated with 2 μgof NF-κB antibodies or control IgGs for 15 min prior to the addition of the labeled probe.In Vitro Kinase Assay—IKK complex was immunoprecipitated with anti-IKKα, and the immunoprecipitates were incubated with 5 μCi of [γ-32P]ATP (3,000 Ci/mmol) and 1 μgof bacterially expressed GST-IκB in 10 μl of kinase buffer containing 10 mm HEPES (pH 7.4), 1 mm DTT, and 5 mm MgCl2 at 30 °C for 30 min. Samples were then separated by 10% SDS-PAGE and visualized by autoradiography.Retroviral Infection—To obtain retrovirus carrying TAK1, NOD2, and RICK, EP2-293 cells (BD Biosciences) were transiently transfected with retroviral vectors, pMX-puro-TAK1, -NOD2, and -RICK. After a 48-h culture, growth medium containing retrovirus was collected and centrifuged at 1000 rpm for 10 min to remove packaging cells. Keratinocytes were incubated with the collected virus-containing EP2-293 medium with 8 μg/ml Polybrene for 24 h. Uninfected cells were removed by puromycin selection.RESULTSMDP-mediated Innate Immune Response Is Impaired in TAK1 Δ/Δ Keratinocytes—We have previously generated TAK1 Δ/Δ keratinocytes in which 37 amino acids, including the ATP binding region of TAK1, were deleted by the Cre-LoxP system resulting in the expression of kinase-dead TAK1 (TAK1 Δ) (30Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). To investigate the role of TAK1 in NOD2-mediated immune responses in epithelial cells, we used these TAK1 Δ/Δ and control TAK1 FL/FL keratinocytes as a model system. Keratinocytes were stimulated with MDP (MDP-LD, an active isomer), and the expression of cytokine TNF and chemokine MIP2 (IL-8 in humans) was measured using quantitative real-time PCR. We found that MDP was a potent inducer of cytokines/chemokines in keratinocytes (Fig. 1A). MDP-induced TNF and MIP2 expression was impaired in TAK1 Δ/Δ keratinocytes when compared with that observed in FL/FL keratinocytes (Fig. 1A). To confirm whether this impairment is caused by TAK1 deletion, we reintroduced wild-type TAK1 in TAK1 Δ/Δ cells by infection of retrovirus expressing wild-type TAK1. TAK1 Δ/Δ keratinocytes expressed the kinase-dead TAK1 at low levels presumably because of the unstable nature of mutant TAK1. The ectopically introduced TAK1 was expressed at levels similar to those found in TAK1 FL/FL keratinocytes (Fig. 2A). Notably, the reintroduction of TAK1 into TAK1 Δ/Δ keratinocytes restored MDP-induced proinflammatory cytokine expressions (Fig. 1A), which demonstrates that TAK1 is essential for MDP-mediated innate immune responses in keratinocytes. To confirm that MDP, but not contaminated bacterial component(s) such as LPS, mediated these responses, we examined the effect of a biologically inactive isomer of MDP, MDP-LL, and LPS on keratinocytes. Even at very high concentration, neither MDP-LL nor LPS induced expression of TNF or MIP2 in control TAK1 FL/FL keratinocytes (Fig. 1B). These results indicate that TAK1 is an essential intermediate for MDP signaling in keratinocytes leading to innate immune responses.FIGURE 2MDP-induced activation of NF-κB and MAPKs in keratinocytes.A, TAK1 FL/FL, TAK1 Δ/Δ, and TAK1 Δ/Δ+TAK1 keratinocytes were stimulated with MDP (20 μg/ml) for the indicated times. Whole cell extracts were harvested from treated cells, and the NF-κ B-DNA binding activity was examined by EMSA. p65 immunoblotting (IB) was used for loading control for EMSA. The asterisk indicates a nonspecific band. B, whole cell extracts from TAK1 FL/FL cells 6 h after MDP (10 μg/ml) stimulation were incubated with antibodies (Ab) against NF-κB family proteins, as well as control mouse or rabbit IgGs (mIgG and rIgG, respectively), and subjected to EMSA. C, whole cell extracts were immunoprecipitated with anti-IKKα, and the IKK complex was subjected to an in vitro kinase assay using GST-IκB as an exogenous substrate. The amount of IKKα was analyzed by immunoblotting. D and E, the whole cell extracts used for EMSA were subjected to immunoblotting using phospho-JNK, phospho-p38, JNK, and p38 antibodies. All results are representative of three independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)MDP-induced Activation of NF-κB, JNK, and p38 Is Impaired in TAK1 Δ/Δ Keratinocytes—To investigate the role of TAK1 in MDP-mediated intracellular signaling pathways, we examined the activation of NF-κB and MAPKs in TAK1 FL/FL and Δ/Δ keratinocytes. In TAK1 FL/FL keratinocytes, MDP markedly activated NF-κB DNA binding after 2–6 h of incubation (Fig. 2A), and this was associated with translocation of the NF-κB subunit p65 into the nucleus (supplemental Fig. S1). In contrast, MDP-induced NF-κB activation was not observed in TAK1 Δ/Δ keratinocytes (Fig. 2A and supplemental Fig. S1). Notably, the reintroduction of TAK1 restored the activation of NF-κB in TAK1 Δ/Δ keratinocytes (Fig. 2A). Gel supershift assay revealed that p65 homodimer is a major NF-κB complex in MDP-stimulated keratinocytes (Fig. 2B). To confirm further whether MDP-induced NF-κB pathway is TAK1-dependent, we examined activation of IKK by in vitro kinase assay (Fig. 2C). IKK was activated 2–6 h after MDP stimulation in TAK1 FL/FL keratinocytes, whereas no activation was detected in TAK1 Δ/Δ keratinocytes. Activation of JNK and p38 MAPKs was determined by detecting the activated forms of JNK and p38 using phospho-specific antibodies. MDP activated JNK and p38 with a time course similar to that of NF-κB activation in control TAK1 FL/FL keratinocytes, but the activation was completely abolished in TAK1 Δ/Δ keratinocytes (Fig. 2, D and E). The reintroduction of TAK1 restored the activation of JNK and p38 (Fig. 2, D and E). These results demonstrate that TAK1 is essential for the activation of both NF-κB and JNK/p38 following MDP stimulation in keratinocytes.The time course of activation of NF-κB, JNK, and p38 in MDP-stimulated keratinocytes was slow compared with that observed in TNF- or IL-1-stimulated cells. They are normally activated within 10–30 min after TNF or IL-1 treatment and down-regulated afterward (25Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (740) Google Scholar, 27Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (315) Google Scholar). Because MDP strongly induces TNF (Fig. 1), but not IL-1 (data not shown), one possibility is that MDP-induced TNF may be responsible for this delayed activation. However, we found that MDP could activate NF-κB, JNK, and p38 even in TNF receptor knock-out keratinocytes with a time course similar to that observed in wild-type keratinocytes (supplemental Fig. S2). Therefore, it is likely that MDP slowly induces TAK1 activation and subsequent downstream events.NOD2 and RICK Interact with TAK1—Our results indicate that TAK1 is a critical downstream target molecule of the MDP-NOD2-RICK signaling pathway. We examined next whether TAK1 can physically interact with NOD2 and RICK. Earlier studies reported that TAK1 interacts with NOD2 (28Chen C.M. Gong Y. Zhang M. Chen J.J. J. Biol. Chem. 2004; 279: 25876-25882Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). We confirmed that TAK1 was coprecipitated with NOD2 when ectopically expressed in 293 cells (Fig. 3A, left panels). The reciprocal precipitation assay verified the TAK1-NOD2 interaction (Fig. 3A, right panels). TAK1 and RICK were also ectopically expressed in 293 cells, and the coprecipitation assay revealed that RICK associated with TAK1 (Fig. 3B). To verify further this interaction under physiological conditions, we examined the association of endogenous TAK1 with RICK in epithelial cells. For this purpose, we used the human colorectal adenocarcinoma cell line HT-29 because we found that HT-29 cells expressed RICK at higher levels than in keratinocytes (data not shown). Endogenous TAK1 was weakly coprecipitated with RICK in HT-29 cells, and the interaction was enhanced by MDP treatment (Fig. 3C). Thus, TAK1 associates with RICK in epithelial cells, and MDP may enhance the interaction.FIGURE 3NOD2 and RICK interact with TAK1.A, 293 cells were transiently transfected with FLAG-tagged TAK1 along with HA-tagged NOD2 or an equal amount of empty vector. HA-NOD2 was immunoprecipitated, and immunoprecipitates (IP) and whole cell extracts (WCE) were analyzed by immunoblotting (IB) (left panels). The interaction was confirmed by reciprocal co-immunoprecipitation assay (right panels). B, 293 cells were transiently transfected with FLAG-tagged RICK along with HA-tagged TAK1 or an equal amount of empty vector. TAK1-RICK interaction was tested as described above. C, HT-29 cells were treated with MDP (10μg/ml) for 6 h or left untreated, and whole cell extracts were immunoprecipitated with anti-RICK antibody or the same amount of control IgG. The immunoprecipitates were analyzed by immunoblotting.View Large Image Figure ViewerDownload Hi-res image Download (PPT)NOD2 and RICK Activate TAK1—Although RICK is a kinase, it has been shown that its kinase activity is dispensable for activation of downstream events (32Lu C. Wang A. Dorsch M. Tian J. Nagashima K. Coyle A.J. Jaffee B. Ocain T.D. Xu Y. J. Biol. Chem. 2005; 280: 16278-16283Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). This suggests that an unidentified kinase is responsible for phosphorylation of IKKs and MAPKKs leading to activation of NF-κB and MAPKs in the NOD2-RICK pathway. TAK1 is a kinase that activates both IKK and MAPKKs in IL-1, TNF, and TLR signaling pathways (24Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1011) Google Scholar, 25Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (740) Google Scholar, 26Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (582) Google Scholar). Taken together with the results shown above, it is likely that TAK1 is activated by NOD2-RICK and that TAK1 activation mediates both NF-κB and MAPK pathwa}, number={1}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Kim, Jae-Young and Omori, Emily and Matsumoto, Kunihiro and Nunez, Gabriel and Ninomiya-Tsuji, Jun}, year={2008}, month={Jan}, pages={137–144} }
 @article{omori_morioka_matsumoto_ninomiya-tsuji_2008, title={TAK1 regulates reactive oxygen species and cell death in keratinocytes, which is essential for skin integrity}, volume={283}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M804513200}, abstractNote={Mice with a keratinocyte-specific deletion of Tak1 exhibit severe skin inflammation due to hypersensitivity to tumor necrosis factor (TNF) killing. Here we have examined the mechanisms underlying this hypersensitivity. We found that TAK1 deficiency up-regulates reactive oxygen species (ROS) resulting in cell death upon TNF or oxidative stress challenge. Because blockade of NF-κB did not increase ROS or did not sensitize cells to oxidative stress in keratinocytes TAK1 regulates ROS mainly through the mechanisms other than those mediated by NF-κB. We found that c-Jun was decreased in TAK1-deficient keratinocytes and that ectopic expression of c-Jun could partially inhibit TNF-induced increase of ROS and cell death. Finally, we show that, in an in vivo setting, the antioxidant treatment could reduce an inflammatory condition in keratinocyte-specific Tak1 deletion mice. Thus, TAK1 regulates ROS partially through c-Jun, which is important for preventing ROS-induced skin inflammation. Mice with a keratinocyte-specific deletion of Tak1 exhibit severe skin inflammation due to hypersensitivity to tumor necrosis factor (TNF) killing. Here we have examined the mechanisms underlying this hypersensitivity. We found that TAK1 deficiency up-regulates reactive oxygen species (ROS) resulting in cell death upon TNF or oxidative stress challenge. Because blockade of NF-κB did not increase ROS or did not sensitize cells to oxidative stress in keratinocytes TAK1 regulates ROS mainly through the mechanisms other than those mediated by NF-κB. We found that c-Jun was decreased in TAK1-deficient keratinocytes and that ectopic expression of c-Jun could partially inhibit TNF-induced increase of ROS and cell death. Finally, we show that, in an in vivo setting, the antioxidant treatment could reduce an inflammatory condition in keratinocyte-specific Tak1 deletion mice. Thus, TAK1 regulates ROS partially through c-Jun, which is important for preventing ROS-induced skin inflammation. Tumor necrosis factor (TNF) 2The abbreviations used are: TNFtumor necrosis factorBHAbutylated hydroxyanisolec-FLIPcellular FADD-like interleukin-1β-converting enzyme inhibitory proteinFADDFas-associated death domainMEFmouse embryonic fibroblastsROSreactive oxygen speciestBHPtertbutyl hydroperoxideMnSODmanganese superoxide dismutaseJNKc-Jun NH2-terminal kinaseCREBcAMP-response element-binding protein4-OHT4-hydroxytamoxifenCM-H2DCFDA5 (6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester. plays a central role in inflammation, and also regulates cell death and survival (1Aggarwal B.B. Nat. Rev. Immunol. 2003; 3: 745-756Crossref PubMed Scopus (2166) Google Scholar, 2Karin M. Lin A. Nat. Immunol. 2002; 3: 221-227Crossref PubMed Scopus (2452) Google Scholar, 3Ashkenazi A. Nat. Rev. Cancer. 2002; 2: 420-430Crossref PubMed Scopus (1109) Google Scholar). TNF initiates intracellular signaling by binding to its receptor, initiating the formation of the TNF receptor complex, which consists of several proteins including RIP1 kinase, Fas-associated death domain (FADD), and pro-caspase-8 (also called FLICE). The TNF receptor complex in turn activates two opposing intracellular signaling pathways; one leads to up-regulation of the expression of anti-apoptotic genes such as cellular FLICE-inhibitory protein (c-FLIP) (4Micheau O. Lens S. Gaide O. Alevizopoulos K. Tschopp J. Mol. Cell. Biol. 2001; 21: 5299-5305Crossref PubMed Scopus (687) Google Scholar) and caspase inhibitor IAPs (inhibitor of apoptosis proteins) (5Wang C.-Y. Mayo M.W. Korneluk R.G. Goeddel D.V. Baldwin Jr., A.S. Science. 1998; 281: 1680-1683Crossref PubMed Scopus (2580) Google Scholar) (anti-cell death pathway); another activates the caspase cascade to execute apoptotic cell death (pro-cell death pathway). TNF-induced activation of the transcription factor NF-κB is one of the major pathways of anti-apoptotic gene up-regulation and cell death inhibition. NF-κB is activated upon degradation of IκB (inhibitor of NF-κB), which is induced by its phosphorylation by IκB kinases (6Hayden M.S. Ghosh S. Cell. 2008; 132: 344-362Abstract Full Text Full Text PDF PubMed Scopus (3570) Google Scholar). tumor necrosis factor butylated hydroxyanisole cellular FADD-like interleukin-1β-converting enzyme inhibitory protein Fas-associated death domain mouse embryonic fibroblasts reactive oxygen species tertbutyl hydroperoxide manganese superoxide dismutase c-Jun NH2-terminal kinase cAMP-response element-binding protein 4-hydroxytamoxifen 5 (6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate acetyl ester. The pro-cell death pathway is activated through FADD (1Aggarwal B.B. Nat. Rev. Immunol. 2003; 3: 745-756Crossref PubMed Scopus (2166) Google Scholar, 2Karin M. Lin A. Nat. Immunol. 2002; 3: 221-227Crossref PubMed Scopus (2452) Google Scholar, 3Ashkenazi A. Nat. Rev. Cancer. 2002; 2: 420-430Crossref PubMed Scopus (1109) Google Scholar). FADD recruits the apoptosis-initiating protease caspase-8, which is in turn autoactivated by proteolysis. Caspase-8 cleaves and activates executor caspases such as caspase-3. c-FLIP is a specific inhibitor of caspase-8 (7Thome M. Tschopp J. Nat. Rev. Immunol. 2001; 1: 50-58Crossref PubMed Scopus (352) Google Scholar). Additionally, the TNF receptor complex activates NADPH oxidase 1 and increases ROS production (8Kim Y.S. Morgan M.J. Choksi S. Liu Z.G. Mol. Cell. 2007; 26: 675-687Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). ROS causes prolonged activation of JNK (9Sakon S. Xue X. Takekawa M. Sasazuki T. Okazaki T. Kojima Y. Piao J.H. Yagita H. Okumura K. Doi T. Nakano H. EMBO J. 2003; 22: 3898-3909Crossref PubMed Scopus (455) Google Scholar, 10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar). Prolonged JNK activation down-regulates the E3 ubiquitin ligase Itch, which degrades c-FLIP (11Gallagher E. Gao M. Liu Y.C. Karin M. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 1717-1722Crossref PubMed Scopus (224) Google Scholar, 12Chang L. Kamata H. Solinas G. Luo J.L. Maeda S. Venuprasad K. Liu Y.C. Karin M. Cell. 2006; 124: 601-613Abstract Full Text Full Text PDF PubMed Scopus (595) Google Scholar). This ROS-JNK-mediated c-FLIP degradation facilitates the activation of caspase-8 (12Chang L. Kamata H. Solinas G. Luo J.L. Maeda S. Venuprasad K. Liu Y.C. Karin M. Cell. 2006; 124: 601-613Abstract Full Text Full Text PDF PubMed Scopus (595) Google Scholar). The ROS-facilitated caspase pathway is believed to be the major pathway of TNF-induced cell death. TAK1 kinase is a member of the mitogen-activated protein kinase kinase kinase family and is activated by innate immune stimuli including bacterial components and proinflammatory cytokines such as interleukin-1 and TNF (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1020) Google Scholar, 14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (764) Google Scholar). TAK1 is an ubiquitin-dependent kinase and plays an essential role in innate immune signaling by activating both IκB kinases-NF-κB and mitogen-activated protein kinase (MAPK) pathways leading to activation of transcription factor AP-1 (15Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar, 16Reiley W.W. Jin W. Lee A.J. Wright A. Wu X. Tewalt E.F. Leonard T.O. Norbury C.C. Fitzpatrick L. Zhang M. Sun S.C. J. Exp. Med. 2007; 204: 1475-1485Crossref PubMed Scopus (201) Google Scholar). We have recently generated mice harboring a skin keratinocyte (epidermal)-specific deletion of Tak1 and found that TAK1 is essential for keratinocyte survival in vivo (17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). We have found that TAK1 deficiency causes hypersensitivity to TNF-mediated killing in keratinocytes. TNF expressed in the skin kills TAK1-deficient keratinocytes and induces an inflammatory condition in the Tak1 mutant skin. However, the mechanism by which TAK1 deficiency increases the susceptibility to TNF killing has not yet determined. One plausible mechanism is that TAK1 deficiency impairs TNF-induced NF-κB resulting in activation of the pro-death caspase pathway. However, the degree of cell death is somewhat greater in TAK1-deficient mouse embryonic fibroblasts (MEFs) than NF-κB-deficient MEFs as described previously (18Shim J.-H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.-Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (595) Google Scholar). Furthermore, we have recently found that Tak1 deletion in the intestinal epithelium causes epithelial cell death at a much higher degree compared with the intestinal epithelium-specific deletion of NEMO (19Kajino-Sakamoto R. Inagaki M. Lippert E. Akira S. Robine S. Matsumoto K. Jobin C. Ninomiya-Tsuji J. J. Immunol. 2008; 180: 1143-1152Crossref Scopus (124) Google Scholar, 20Nenci A. Becker C. Wullaert A. Gareus R. van Loo G. Danese S. Huth M. Nikolaev A. Neufert C. Madison B. Gumucio D. Neurath M.F. Pasparakis M. Nature. 2007; 446: 557-561Crossref PubMed Scopus (850) Google Scholar). Therefore, we speculate that TAK1 may participate in cell survival pathways other than those mediated by NF-κB. In this study, we investigated the mechanisms by which TAK1 regulates sensitivity to TNF-induced cell death. Particularly, we are interested in whether TAK1 deficiency induces cell death through the mechanisms mediated by other than lack of NF-κB activation in TAK1-deficient keratinocytes. To this end, we generated NF-κB-deficient keratinocytes by expressing non-degradable IκB(IκBΔN) that completely blocks activation of NF-κB, and compared them with TAK1-deficient keratinocytes. We show here that TNF-induced ROS is mainly regulated by a non-NF-κB mechanism in TAK1-deficient keratinocytes, and that this TAK1-dependent ROS regulation is important for preventing the inflammatory conditions in mice having an epidermal specific Tak1 deletion. Mice—Tak1-floxed (Tak1flox/flox) mice were from Dr. Akira, Osaka University (14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (764) Google Scholar). K14-CreERT mice were obtained from the Jackson Laboratories (21Vasioukhin V. Degenstein L. Wise B. Fuchs E. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8551-8556Crossref PubMed Scopus (469) Google Scholar). Mice harboring an epidermal-specific inducible Tak1 deletion (K14-CreERT Tak1flox/flox) were generated and at 5 weeks of age were topically treated on the dorsal skin once a day for 5 consecutive days with 4-hydroxytamoxifen (1 mg/mouse). Some mice were fed with food containing 0.7% butylated hydroxyanisole (BHA) starting at 3 days prior to the tamoxifen treatment. Deletion of the Tak1 gene was confirmed by PCR using the following primer set that can detect the truncated from of Tak1 (Tak1Δ): CACCAGTGCTGGATTCTTTTTGAGGC and GGAACCCGTGGATAAGTGCACTTGAAT. TNF receptor was done as a loading control using the following primer set: TGTGAAAAGGGCACCTTTACGGC and GGCTGCAGTCCACGCACTGG. All animal experiments were done with the approval of the North Carolina State University Institutional Animal Care and Use Committee. Cell Culture—Tak1+/+ and Tak1Δ/Δ keratinocytes were isolated from Tak1flox/flox, K5-Cre Tak1flox/flox mice described previously (17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). Spontaneously immortalized keratinocytes derived from the skin of postnatal day 0-2 mice were cultured in Ca2+-free minimal essential medium (Invitrogen) supplemented with 4% Chelex-treated bovine growth serum (Hyclone), 10 ng/ml human epidermal growth factor (Invitrogen), 0.05 mm calcium chloride, and penicillin-streptomycin at 33 °C in 8% CO2. Reagents—Reagents used were TNF-α (human recombinant; Roche), N-acetyl-l-cysteine (Calbiochem), BHA (Sigma), tert-butyl hydroperoxide (tBHP; Sigma), and 4-hydroxytamoxifen (Sigma). Polyclonal antibodies were TAK1 described previously (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1020) Google Scholar), JNK1 (FL), p65 (F-6; Santa Cruz), caspase-3 (Cell Signaling), CREB (Santa Cruz), and phospho-c-Jun (Ser73; Cell Signaling). Monoclonal antibodies were c-FLIP (Abcam), phospho-JNK (Thr183/Tyr185; Cell Signaling), c-Jun (BD Bioscience), β-actin (Sigma), and nidogen (Chemicon). Annexin V Binding Assay—To determine apoptotic cells, Annexin V-Alexa Fluor 488 binding and propidium iodide staining were performed according to the manufacturer's protocol (Invitrogen). Images were taken using an inverted fluorescent microscope (TE2000-S; Nikon). 3-5 randomly selected areas were photographed with the same exposure time. The images were processed using the fixed threshold in all samples in each experiment, and more than 1000 cells were counted for each sample. Crystal Violet Assay—The viable adherent cells were fixed with 10% formalin and stained with 0.1% crystal violet. The stain was solubilized by adding 25% ethanol containing 50 mm sodium citrate, and the absorbance of each plate was determined at 595 nm. Real-time PCR Analysis—Total RNA was prepared from keratinocytes using the RNeasy protect mini kit (Qiagen). cDNA was synthesized using the reverse transcription reagents (Applied Biosystems). Real-time PCR analysis was performed using the ABI PRISM 7000 sequence detection system and the Assays-on-Demand gene expression kit (Applied Biosystems). All samples were normalized to the signal generated from glyceraldehyde-3-phosphate dehydrogenase. Electrophoretic Mobility Shift Assay—The binding reactions contained radiolabeled 32P-NF-κB oligonucleotide probe (Pro-mega), cell extracts, 4% glycerol, 1 mm MgCl2, 0.5 mm EDTA, 0.5 mm dithiothreitol, 50 mm NaCl, 10 mm Tris-HCl (pH 7.5), 500 ng of poly(dI-dC) (GE Healthcare), and 10 μg of bovine serum albumin to a final volume of 15 μl. The reaction mixtures were incubated at 25 °C for 30 min, separated by 5% (w/v) polyacrylamide gel, and visualized by autoradiography. ROS Measurement—Keratinocytes were stimulated with TNF and incubated with 10 μm CM-H2DCFDA (Invitrogen) for 30 min at 37 °C, harvested, and analyzed by flow cytometry. Immunoblotting—Cells were washed once with ice-cold phosphate-buffered saline and whole cell extracts were prepared using a lysis buffer (20 mm HEPES (pH 7.4), 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mm MgCl2, 2 mm EGTA, 10 mm sodium fluoride, 2 mm dithiothreitol, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 20 μm aprotinin, 0.5% Triton X-100). Cell extracts were resolved on SDS-PAGE and transferred to Hybond-P membranes (GE Healthcare). The membranes were immunoblotted with various antibodies, and the bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against rabbit or mouse IgG using the ECL Western blotting system (GE Healthcare). Analysis of Cytochrome c Release—Cytosolic fraction was obtained using cytochrome c release apoptosis assay kit (Calbiochem). Briefly, keratinocytes were collected by trypsinization and sonicated in cytosol extraction buffer. Homogenates were fractionated into cytosolic and mitochondrial fractions. Immunoblot was performed using monoclonal antibody against cytochrome c (BD Bioscience). Retroviral Infection—Retroviral vectors for c-Jun (pMX-puro-c-Jun) and IκbΔn (pQCXIP-IκBΔN) was generated by inserting c-Jun cDNA into the retroviral vector pMX-puro (22Kitamura T. Int. J. Hematol. 1998; 67: 351-359Crossref PubMed Google Scholar) or IκBΔN into the retroviral vector pQCXIP (Clontech). IκBΔN cDNA was a gift from Dr. Ballard, Vanderbilt University (23Brockman J.A. Scherer D.C. McKinsey T.A. Hall S.M. Qi X. Lee W.Y. Ballard D.W. Mol. Cell. Biol. 1995; 15: 2809-2818Crossref PubMed Google Scholar). EcoPack293 cells (BD Biosciences) were transiently transfected with pMX-puro-c-Jun or pQCXIP-IκBΔN. After 48 h culture, growth medium containing retrovirus was collected and filtered with 0.45-μm cellulose acetate membrane to remove packaging cells. Keratinocytes were incubated with the collected virus-containing medium with 8 μg/ml Polybrene for 24 h. Uninfected cells were removed by puromycin selection. Histology and TUNEL Staining—Paraffin sections were stained with hematoxylin and eosin for histological analysis. dUTP nick-end labeling (TUNEL) assay was performed on frozen sections using an apoptotic cell death detection kit (Pro-mega) according to the manufacturer's instructions. Immunohistochemical analysis was performed on paraffin sections using polyclonal antibodies against K5, K6, Loricrin (Convance), and cleaved caspase-3 (Cell Signaling). Sections were counterstained with hematoxylin. TNF Induces Pro-cell Death Events in Tak1Δ/Δ Keratinocytes—We first determined which cell signaling events were induced in Tak1Δ/Δ keratinocytes following TNF stimulation. Tak1 wild-type and Δ/Δ keratinocytes were isolated from Tak1flox/flox or K5-Cre Tak1flox/flox mice, respectively. In this floxed Tak1 system, Cre recombinase catalyzes the deletion of the TAK1 ATP binding site, amino acids 41-77, resulting in the generation of a truncated form of TAK1 (TAK1Δ) (Fig. 1A, bottom panel). As reported previously (17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar), TNF activated NF-κBin Tak1 wild-type keratinocytes, but this activation was largely abolished in Tak1Δ/Δ keratinocytes (Fig. 1A, top panel). We next examined pro-cell death events, including activation of JNK, degradation of c-FLIP, and activation of caspase in Tak1 wild-type and Δ/Δ keratinocytes. TNF activated JNK in a transient manner, peaking at 10 min post-stimulation in Tak1 wild-type keratinocytes, whereas no transient JNK activation was detected in Tak1Δ/Δ keratinocytes (Fig. 1A, third panel). Thus, TAK1 is essential for TNF-induced transient JNK activation, consistent with earlier studies using TAK1-deficient MEFs (14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (764) Google Scholar, 18Shim J.-H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.-Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (595) Google Scholar). However, JNK was greatly activated at 3-6 h after TNF stimulation in Tak1Δ/Δ but not in wild-type keratinocytes. It has been reported that ROS accumulation activates JNK in a prolonged manner following TNF stimulation (9Sakon S. Xue X. Takekawa M. Sasazuki T. Okazaki T. Kojima Y. Piao J.H. Yagita H. Okumura K. Doi T. Nakano H. EMBO J. 2003; 22: 3898-3909Crossref PubMed Scopus (455) Google Scholar, 10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar). Prolonged activation of JNK has been linked to c-FLIP degradation and subsequent caspase activation (10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar). We examined c-FILP degradation and caspase-3 activation (Fig. 1A, fifth and sixth panels). As anticipated, c-FLIP was degraded and caspase-3 was activated in Tak1Δ/Δ but not in wild-type keratinocytes. We measured ROS production using CM-H2DCFDA, a substrate that exhibits increased fluorescence when oxidized by intracellular ROS (Fig. 1B). The levels of ROS were greatly increased in Tak1Δ/Δ but not in wild-type keratinocytes following TNF stimulation. We also examined whether cell death is through the apoptotic or necrotic pathways. Apoptosis and necrosis were assessed by Annexin V binding and propidium iodide staining (Fig. 1C). The numbers of both apoptotic and necrotic cells were greatly increased in Tak1Δ/Δ keratinocytes at 2-6 h post-TNF stimulation. Cytochrome c was increased in the cytoplasm in TNF-stimulated Tak1Δ/Δ but not in wild-type keratinocytes (Fig. 1D), suggesting that TNF activates the mitochondrial apoptosis pathway in Tak1Δ/Δ keratinocytes. Collectively, these results demonstrate that TNF induces pro-cell death events including activation of JNK and caspase-3 in TAK1Δ/Δ keratinocytes, which occur concomitantly with accumulation of ROS, resulting in apoptotic and necrotic cell death. Inhibition of ROS Completely Blocks TNF-induced Cell Death in Tak1Δ/Δ Keratinocytes—It is known that ROS activates JNK resulting in activation of caspases through c-FLIP degradation. Furthermore, the activation of JNK and caspase-3 in Tak1Δ/Δ keratinocytes occurred concomitantly with ROS accumulation. Therefore, we assume that ROS is the cause of these pro-cell death events. We examined the effect of inhibiting ROS with antioxidants on TNF-induced pro-cell death events. Cells were treated with the antioxidant BHA and the activation of JNK and caspase-3 and c-FLIP degradation examined (Fig. 2A). BHA could abolish all these pro-cell death events. We also measured apoptosis and cell viability. BHA could completely inhibit an increase of apoptotic cells following TNF stimulation in Tak1Δ/Δ keratinocytes (Fig. 2B). Furthermore, BHA and another antioxidant N-acetylcysteine could totally block TNF-induced cell death (Fig. 2C). These results suggest that ROS is the major mediator of TNF-induced cell death in Tak1Δ/Δ keratinocytes. NF-κB Deficiency Does Not Effectively Induce ROS or Apoptosis in TNF-stimulated Keratinocytes—Our results thus far demonstrated that TAK1 deficiency causes ROS accumulation upon TNF stimulation, which results in apoptotic and necrotic cell death. One likely mechanism by which TAK1 deficiency causes ROS accumulation is a lack of activation of NF-κB. It is known that NF-κB regulates several enzymes and molecules that are involved in ROS metabolism such as manganese superoxide dismutase (MnSOD) and ferritin heavy chain (10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar, 24Pham C.G. Bubici C. Zazzeroni F. Papa S. Jones J. Alvarez K. Jayawardena S. De Smaele E. Cong R. Beaumont C. Torti F.M. Torti S.V. Franzoso G. Cell. 2004; 119: 529-542Abstract Full Text Full Text PDF PubMed Scopus (536) Google Scholar). To examine the role of NF-κB in TNF-induced cell death in keratinocytes, we generated wild-type keratinocytes stably expressing the repressor of NF-κB, IκBΔN(IκBΔN keratinotyes). We used Tak1 wild-type keratinocytes isolated from the littermate mice of those we isolated from our Tak1Δ/Δ keratinocytes. Therefore, the backgrounds of Tak1Δ/Δ and IκBΔN keratinocytes are similar. We confirmed that TNF-induced NF-κB activation was completely abolished in IκBΔN keratinocytes (Fig. 3A). We examined TNF-induced ROS accumulation, apoptosis, and cell death. Tak1Δ/Δ keratinocytes exhibited a large increase of ROS at 5 h and ROS could not be measured due to cell death at 16 h after TNF stimulation (Fig. 3B). In contrast, ROS was not increased even at 16 h in IκBΔN keratinocytes (Fig. 3B). Annexin V-binding positive cells were also not increased in IκBΔN keratinocytes (Fig. 3C). These results indicate that TAK1 regulates ROS and cell death not through NF-κB. In MEFs, MnSOD is one of the major targets of NF-κB and regulates ROS (10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar). To further examine the involvement of NF-κB in ROS regulation in keratinocytes, we observed the expression levels of MnSOD following TNF stimulation (Fig. 3D). A chemokine MIP2, which is a NF-κB target, was greatly increased by TNF in Tak1 wild-type keratinocytes, indicating that NF-κB was activated under this experimental condition. However, unlike MEFs, MnSOD was not increased by TNF in keratinocytes and TAK1 deficiency did not decrease the level of MnSOD. Collectively, we conclude that NF-κB is not primarily important for ROS regulation at least in keratinocytes. Finally, we examined TNF-induced cell death at 24 h after stimulation. Cell death was moderately increased in IκBΔN keratinocytes, however, cell death was significantly less compared with that in Tak1Δ/Δ keratinocytes (Fig. 3E). These results suggest that TAK1 deficiency causes an increase of ROS and cell death mainly not through the lack of NF-κB activation. We next examined the relationship between TAK1 and ROS. If TAK1 regulates ROS, TAK1 deficiency should cause an increase of sensitivity not only to TNF but also to ROS-induced cell death. We treated keratinocytes with tBHP, a prototypical organic oxidant. Tak1Δ/Δ keratinocytes died by 0.3 mm tBHP treatment (Fig. 3E, left panel), whereas Tak1 wild-type and IκBΔN keratinocytes were resistant to 0.5 mm tBHA and died with 1.0 mm tBHP treatment (Fig. 3F, right panel). These results demonstrate that TAK1 but not NF-κB affects sensitivity to ROS-induced cell death in keratinocytes, suggesting that TAK1 regulates ROS mainly through non-NF-κB mechanisms. c-Jun Is Partially Involved in TAK1 Regulation of ROS—We next attempted to determine the mechanism by which TAK1 regulates ROS. TAK1 can activate two groups of transcription factors, namely NF-κB and AP1. As described above, we found that ROS is regulated through non-NF-κB mechanisms. Therefore, we examined the levels of AP1 family transcription factors including the Jun family and c-Fos. We also examined CREB. Among these, we found that the levels of c-Jun were reduced in TAK1-deficient keratinocytes under the basal condition (Fig. 4, A and B). The level of c-Jun was not significantly altered by TNF stimulation both in wild-type and Tak1Δ/Δ keratinocytes. Thus, only the basal level of c-Jun is regulated by TAK1. TAK1 is activated by the number of stimuli including cytokines and stresses (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1020) Google Scholar, 25HuangFu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 26Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (322) Google Scholar), which presumably are constitutively present at low levels even in unstimulated conditions. We speculate that TAK1 may be constitutively activated at a low level under the normal culture conditions, and this constitutive activity of TAK1 is important to maintain the basal level of c-Jun. We hypothesized that TAK1-dependent basal expression of c-Jun is involved in ROS regulation and cell survival. To examine this possibility, we generated Tak1Δ/Δ keratinocytes that ectopically express c-Jun (Fig. 4C), and examined accumulation of ROS, apoptosis, and cell death following TNF stimulation. We found that the levels of ROS were reduced by c-Jun expression in TNF-treated Tak1Δ/Δ keratinocytes (Fig. 4D). Concomitantly, TNF-induced apoptosis was significantly reduced in c-Jun expressing keratinocytes (Fig. 4E). However, cell viability at 24 h after TNF stimulation was not greatly rescued by c-Jun expression (Fig. 4F). We note that higher levels of c-Jun expression did not increase the level of rescuing the TNF-induced cell death (data not shown). These results suggest that the TAK1-c-Jun pathway participates in ROS regulation but is not sufficient to rescue cell death at later time points. Antioxidants Rescue the Skin Disorder in Mice Caused by Epidermal-specific Deletion of TAK1—Our results in cultured keratinocytes indicate that TAK1-dependent ROS regulation is important for cell survival. Finally, we asked whether ROS are the cause of keratinocyte death and subsequent skin inflammation in mice harboring an epidermal-specific deletion of TAK1. Mice with an epidermal-specific deletion of Tak1 were born at the expected Mendelian ratio but developed a severe skin inflammatory condition and were lethal by postnatal days 6-7. Because small pups are difficult to effectively treat with antioxidants, we generated mice with epidermal-specific inducible Tak1 deletion. We crossed homozygous Tak1-floxed (Tak1flox/flox) mice to transgenic mice expressing the tamoxifen-dependent Cre-ERT recombinase under the control of the cytokeratin K14 promoter (K14-CreERT) (21Vasioukhin V. Degenstein L. Wise B. Fuchs E. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8551-8556Crossref PubMed Scopus (469) Google Scholar). The resulting mice (K14-CreERT Tak1flox/flox) were born at the expected Mendelian ratio and grew normally, at least until the age of 6-7 months. To induce deletion of the Tak1 gene, we topically treated the K14-CreERT Tak1flox/flox mice with 4-hydroxytamoxifen (4-OHT), an active metabolite of tamoxifen. We confirmed that this treatment induced deletion of TAK1 by PCR, using a primer set that could only detect the deleted allele of Tak1 (Fig. 5B). The mutant mice harboring an epidermal-specific Tak1 deletion developed an inflammatory skin condition 2-5 days after treatment with 4-OHT. The inflammatory conditions were severe and similar to the conditions in the constitutive epidermal specific Tak1 deletion mice at postnatal days 5-7 (17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). The mutant epidermis was hyperplastic, hypertophic, and hyperkeratotic, and microabscesses were commonly found (supplementary Fig. S1A). An inflamed skin marker K6 was highly expressed in the entire area where 4-OHT was treated (supplementary Fig. S1B). Expression of the epidermal differentiation marker loricrin was diminished and apoptotic keratinocytes are greatly increased all over the 4-OHT-treated skin (supplementary Fig. S1B). To examine whether ROS are the cause of this inflammation, we fed the mice food containing BHA. The mice consuming food containing BHA showed less flaky skin compared with the TAK1-deficient littermates who did not consume BHA (Fig. 5A). Histological analysis revealed that BHA decreased epidermal hyperplasia, infiltration of immune cells, and hyperkeratotic stratum corneum that are frequently observed in TAK1-deficient epidermis (Fig. 5C). Importantly, keratinocyte death was significantly reduced in BHA-treated mice (Fig. 5C). These results demonstrated that ROS are the cause of the skin inflammation in mice having TAK1-deficient epidermis. TNF induces ROS, activation of JNK, degradation of c-FLIP, and activation of caspases in Tak1Δ/Δ keratinocytes, and all of these events cooperatively promote cell death. Because inhibition of ROS could abolish pro-cell death events and ultimately blocked cell death in Tak1Δ/Δ keratinocytes, we surmise that accumulation of ROS in the TAK1-deficient keratinocytes is the central mediator of keratinocyte death. How Does TAK1 Regulate ROS?—ROS are regulated by a number of enzymes including NF-κB target gene products such as MnSOD and ferritin heavy chain (10Kamata H. Honda S. Maeda S. Chang L. Hirata H. Karin M. Cell. 2005; 120: 649-661Abstract Full Text Full Text PDF PubMed Scopus (1509) Google Scholar, 24Pham C.G. Bubici C. Zazzeroni F. Papa S. Jones J. Alvarez K. Jayawardena S. De Smaele E. Cong R. Beaumont C. Torti F.M. Torti S.V. Franzoso G. Cell. 2004; 119: 529-542Abstract Full Text Full Text PDF PubMed Scopus (536) Google Scholar, 27Winyard P.G. Moody C.J. Jacob C. Trends Biochem. Sci. 2005; 30: 453-461Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar). TAK1 is an essential intermediate in the TNF signaling pathway leading to activation of NF-κB transcription factors (Fig. 1A). Therefore, it was anticipated that TAK1 would influence the expression of MnSOD and/or ferritin heavy chain. However, we found that deletion of TAK1 did not affect their expression (Fig. 3D and data not shown). Moreover, we found that NF-κB-deficiency did not induce ROS following TNF stimulation (Fig. 3B). Thus, NF-κB does not regulate the level of ROS in keratinocytes, and the mechanisms mediated by other than NF-κB should be important for ROS regulation. We found that TAK1-dependent c-Jun expression may partially contribute to ROS regulation in keratinocytes. However, we could not totally block either TNF-induced ROS accumulation or cell death by ectopic expression of c-Jun. Therefore, TAK1 activates several mediators including c-Jun, and unidentified factors that may cooperatively regulate the levels of ROS in keratinocytes. We have recently found that intestinal epithelial specific Tak1 mutant mice die immediately after birth and they show massive epithelial cell death (19Kajino-Sakamoto R. Inagaki M. Lippert E. Akira S. Robine S. Matsumoto K. Jobin C. Ninomiya-Tsuji J. J. Immunol. 2008; 180: 1143-1152Crossref Scopus (124) Google Scholar). In contrast, intestinal epithelial specific NF-κB-deficient (NEMO deletion) mice slowly develop intestinal inflammation by 6 weeks of age (20Nenci A. Becker C. Wullaert A. Gareus R. van Loo G. Danese S. Huth M. Nikolaev A. Neufert C. Madison B. Gumucio D. Neurath M.F. Pasparakis M. Nature. 2007; 446: 557-561Crossref PubMed Scopus (850) Google Scholar). Our current results raise the possibility that Tak1 deletion increases ROS, thereby inducing cell death and tissue damage in intestinal epithelial specific Tak1 deletion mice more severely compared with the epithelial specific NEMO deletion mice. TAK1, ROS, and Psoriasis—ROS has been associated with psoriasis; however, it has not been determined whether ROS is the cause or the consequence of inflammation (28Bickers D.R. Athar M. J. Investig. Dermatol. 2006; 126: 2565-2575Abstract Full Text Full Text PDF PubMed Scopus (826) Google Scholar). We have shown here that Tak1 deletion causes dysregulation of ROS in keratinocytes, which is causally associated with skin inflammation (Ref. 17Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar and Fig. 5). TAK1 can be activated by cytokines and innate immune stimuli including interleukin-1, TNF, and microbial components and stress conditions (13Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1020) Google Scholar, 25HuangFu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 26Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (322) Google Scholar). The levels of those TAK1 stimuli in the epithelial tissues may be fluctuated in vivo. For example, reduction of commensal bacteria decreases TAK1 activity, thereby increasing the accumulation of ROS. Such dysregulation in TAK1 activity may contribute to ROS-mediated epithelial inflammation. Our results warrant further studies on the relationship of the TAK1 signaling pathway, ROS metabolism, and psoriasis. We thank S. Akira for Tak1-floxed mice, D. Ballard for IκBΔN cDNA, and Y. Tsuji for discussion, J. Dow, B. J. Welker, and M. Mattmuler for support. Download .pdf (1.65 MB) Help with pdf files}, number={38}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Omori, Emily and Morioka, Sho and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2008}, month={Sep}, pages={26161–26168} }
 @article{inagaki_omori_kim_komatsu_scott_ray_yamada_matsumoto_mishina_ninomiya-tsuji_2008, title={TAK1-binding Protein 1, TAB1, Mediates Osmotic Stress-induced TAK1 Activation but Is Dispensable for TAK1-mediated Cytokine Signaling}, volume={283}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M807574200}, abstractNote={TAK1 kinase is an indispensable intermediate in several cytokine signaling pathways including tumor necrosis factor, interleukin-1, and transforming growth factor-β signaling pathways. TAK1 also participates in stress-activated intracellular signaling pathways such as osmotic stress signaling pathway. TAK1-binding protein 1 (TAB1) is constitutively associated with TAK1 through its C-terminal region. Although TAB1 is known to augment TAK1 catalytic activity when it is overexpressed, the role of TAB1 under physiological conditions has not yet been identified. In this study, we determined the role of TAB1 in TAK1 signaling by analyzing TAB1-deficient mouse embryonic fibroblasts (MEFs). Tumor necrosis factor- and interleukin-1-induced activation of TAK1 was entirely normal in Tab1-deficient MEFs and could activate both mitogen-activated protein kinases and NF-κB. In contrast, we found that osmotic stress-induced activation of TAK1 was largely impaired in Tab1-deficient MEFs. Furthermore, we showed that the C-terminal 68 amino acids of TAB1 were sufficient to mediate osmotic stress-induced TAK1 activation. Finally, we attempted to determine the mechanism by which TAB1 activates TAK1. We found that TAK1 is spontaneously activated when the concentration is increased and that it is totally dependent on TAB1. Cell shrinkage under the osmotic stress condition increases the concentration of TAB1-TAK1 and may oligomerize and activate TAK1 in a TAB1-dependent manner. These results demonstrate that TAB1 mediates TAK1 activation only in a subset of TAK1 pathways that are mediated through spontaneous oligomerization of TAB1-TAK1. TAK1 kinase is an indispensable intermediate in several cytokine signaling pathways including tumor necrosis factor, interleukin-1, and transforming growth factor-β signaling pathways. TAK1 also participates in stress-activated intracellular signaling pathways such as osmotic stress signaling pathway. TAK1-binding protein 1 (TAB1) is constitutively associated with TAK1 through its C-terminal region. Although TAB1 is known to augment TAK1 catalytic activity when it is overexpressed, the role of TAB1 under physiological conditions has not yet been identified. In this study, we determined the role of TAB1 in TAK1 signaling by analyzing TAB1-deficient mouse embryonic fibroblasts (MEFs). Tumor necrosis factor- and interleukin-1-induced activation of TAK1 was entirely normal in Tab1-deficient MEFs and could activate both mitogen-activated protein kinases and NF-κB. In contrast, we found that osmotic stress-induced activation of TAK1 was largely impaired in Tab1-deficient MEFs. Furthermore, we showed that the C-terminal 68 amino acids of TAB1 were sufficient to mediate osmotic stress-induced TAK1 activation. Finally, we attempted to determine the mechanism by which TAB1 activates TAK1. We found that TAK1 is spontaneously activated when the concentration is increased and that it is totally dependent on TAB1. Cell shrinkage under the osmotic stress condition increases the concentration of TAB1-TAK1 and may oligomerize and activate TAK1 in a TAB1-dependent manner. These results demonstrate that TAB1 mediates TAK1 activation only in a subset of TAK1 pathways that are mediated through spontaneous oligomerization of TAB1-TAK1. TAK1 kinase is an indispensable intermediate of several innate immune signaling pathways including cytokines TNF 2The abbreviations used are: TNF, tumor necrosis factor; AMPK, AMP-activated protein kinase; HA, hemagglutinin; MEF, mouse embryonic fibroblasts; TAB, TAK1-binding protein; IL, interleukin; TGF, transforming growth factor; MAPK, mitogen-activated protein kinase; MEKK, MAPK/extracellular signal-regulated kinase kinase kinase; JNK, c-Jun N-terminal kinase. and IL-1 as well as Toll-like receptors and intracellular bacterial sensor NOD-like receptor NOD1/2 pathways (1Hasegawa M. Fujimoto Y. Lucas P.C. Nakano H. Fukase K. Nunez G. Inohara N. EMBO J. 2008; 27: 373-383Crossref PubMed Scopus (402) Google Scholar, 2Kim J.Y. Omori E. Matsumoto K. Nunez G. Ninomiya-Tsuji J. J. Biol. Chem. 2008; 283: 137-144Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 3Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1025) Google Scholar, 5Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (324) Google Scholar). In those pathways, TAK1 is recruited into the IκB kinase (IKK) complex through a polyubiquitin chain and activates transcription factor NF-κB (6Adhikari A. Xu M. Chen Z.J. Oncogene. 2007; 26: 3214-3226Crossref PubMed Scopus (355) Google Scholar). The innate stimuli-activated TAK1 also induces activation of transcription factor AP-1 through MAPKs such as c-Jun N-terminal kinase (JNK) and p38. NF-κB and AP-1 cooperatively modulate gene expression to induce inflammation and cell survival (7Karin M. Nature. 2006; 441: 431-436Crossref PubMed Scopus (3042) Google Scholar, 8Weston C.R. Davis R.J. Curr. Opin. Cell Biol. 2007; 19: 142-149Crossref PubMed Scopus (842) Google Scholar). TAK1 is involved in several other signaling pathways, for example, in TGF-β signaling pathways, TAK1 participates in the non-Smad pathway by activating p38 and SnoN degradation (9Hanafusa H. Ninomiya-Tsuji J. Masuyama N. Nishita M. Fujisawa J.-I. Shibuya H. Matsumoto K. Nishida E. J. Biol. Chem. 1999; 274: 27161-27167Abstract Full Text Full Text PDF PubMed Scopus (387) Google Scholar, 10Kajino T. Omori E. Ishii S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2007; 282: 9475-9481Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). TAK1 is critically involved in stress-activated cell signaling (11Chen W. White M.A. Cobb M.H. J. Biol. Chem. 2002; 277: 49105-49110Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 12Huangfu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 13Singhirunnusorn P. Suzuki S. Kawasaki N. Saiki I. Sakurai H. J. Biol. Chem. 2005; 280: 7359-7368Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar). Among the stress conditions, we found that osmotic stress-induced JNK activation requires TAK1 (12Huangfu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). We have identified several TAK1-binding proteins including TAK1-binding protein 1 (TAB1) (14Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar) and TAK1-binding protein 2/3 (TAB2/3) (15Ishitani T. Takaesu G. Ninomiya-Tsuji J. Shibuya H. Gaynor R.B. Matsumoto K. EMBO J. 2003; 22: 6277-6288Crossref PubMed Scopus (219) Google Scholar, 16Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (497) Google Scholar). TAB1 and TAB2 are isolated by the yeast two-hybrid screening using TAK1 protein as a bait, and both endogenous TAB1 and TAB2 are coprecipitated with endogenous TAK1 in many types of cells. TAB2 and its homolog TAB3 are found to bind to ubiquitin and function as an adaptor tethering TAK1 to the IKK complex (17Kanayama A. Seth R.B. Sun L. Ea C.K. Hong M. Shaito A. Chiu Y.H. Deng L. Chen Z.J. Mol. Cell. 2004; 15: 535-548Abstract Full Text Full Text PDF PubMed Scopus (706) Google Scholar, 18Kishida S. Sanjo H. Akira S. Matsumoto K. Ninomiya-Tsuji J. Genes Cells. 2005; 10: 447-454Crossref PubMed Scopus (74) Google Scholar). In contrast, the role of TAB1 in TAK1 signaling under the physiological setting has not yet been explored. In culture cells, TAB1 is found to be constitutively associated with TAK1 (19Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar). Ectopic expression of TAB1 together with TAK1 induces TAK1 autophosphorylation and thereby activates TAK1 kinase in vitro (19Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar). Only 68 amino acid residues of C-terminal TAB1 are essential and sufficient for binding to TAK1 and induction of autophosphorylation/activation of TAK1 (20Ono K. Ohtomo T. Sato S. Sugamata Y. Suzuki M. Hisamoto N. Ninomiya-Tsuji J. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2001; 276: 24396-24400Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Disruption of Tab1 causes embryonic lethality with several developmental dysregulations including failure of cardiovascular morphogenesis (21Komatsu Y. Shibuya H. Takeda N. Ninomiya-Tsuji J. Yasui T. Miyado K. Sekimoto T. Ueno N. Matsumoto K. Yamada G. Mech. Dev. 2002; 119: 239-249Crossref PubMed Scopus (77) Google Scholar). Disruption of Tak1 also causes early embryonic lethality presumably because of its importance for regulating multiple cytokine signaling pathways (4Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (602) Google Scholar, 22Jadrich J.L. O'Connor M.B. Coucouvanis E. Development. 2006; 133: 1529-1541Crossref PubMed Scopus (112) Google Scholar, 23Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (773) Google Scholar). These facts raise the possibility that TAB1 may be involved in TAK1-mediated signaling pathways during development. However, Tab1-deficient embryos are largely normal by embryonic day 14.5 (21Komatsu Y. Shibuya H. Takeda N. Ninomiya-Tsuji J. Yasui T. Miyado K. Sekimoto T. Ueno N. Matsumoto K. Yamada G. Mech. Dev. 2002; 119: 239-249Crossref PubMed Scopus (77) Google Scholar), which is different from Tak1-deficient embryos that are lethal by embryonic day 9.5 (4Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (602) Google Scholar, 22Jadrich J.L. O'Connor M.B. Coucouvanis E. Development. 2006; 133: 1529-1541Crossref PubMed Scopus (112) Google Scholar, 23Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (773) Google Scholar). This reveals that TAB1 is not essential for all of the TAK1-mediated signaling pathways, or functions of TAB1 can be compensated by other gene products. An earlier study using Tab1-deficient MEFs has reported that TNF-, and IL-1-induced activation of NF-κB, JNK and p38 is not affected by Tab1 deletion (4Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (602) Google Scholar). However, Mendoza et al. (24Mendoza H. Campbell D.G. Burness K. Hastie J. Ronkina N. Shim J.H. Arthur J.S. Davis R.J. Gaestel M. Johnson G.L. Ghosh S. Cohen P. Biochem. J. 2008; 409: 711-722Crossref PubMed Scopus (55) Google Scholar) have recently reported that IL-1-induced TAK1 activation may be reduced in Tab1-deficient MEFs. Our goal is to define the essential roles of TAB1 under physiological conditions. We have recently generated a Tab1-floxed mouse line that allows us to investigate the role of TAB1 in several different tissues (25Inagaki M. Komatsu Y. Scott G. Yamada G. Ray M. Ninomiya-Tsuji J. Mishina Y. Genesis. 2008; 46: 431-439Crossref PubMed Scopus (14) Google Scholar). In the current study, we started determining the TAB1-mediated signaling and investigated which types of TAK1 pathways require TAB1 by using TAB1-deficient MEFs prepared from our newly generated Tab1-floxed mice. Cell Culture and Transfection—Heterozygous mice for the Cre-recombined allele of Tab1 were generated by crossing Sox2-Cre mice and Tab1-floxed (Tab1flox/flox) mice (25Inagaki M. Komatsu Y. Scott G. Yamada G. Ray M. Ninomiya-Tsuji J. Mishina Y. Genesis. 2008; 46: 431-439Crossref PubMed Scopus (14) Google Scholar). The heterozygous mice were intercrossed, and Tab1 control and Tab1-deficient MEFs were isolated from wild type and homozygous mutant embryos at embryonic day 14.5 and spontaneously immortalized by the standard method. Preparation of TAK1+/+ and TAK1Δ/Δ MEFs were described previously (23Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (773) Google Scholar). MEFs and 293 cells were cultured in Dulbecco's modified Eagle's medium with 10% bovine growth serum (Hyclone) and penicillin-streptomycin at 37 °C in 5% CO2. 293 cells were transfected with expression vectors for hemagglutinin (HA)-tagged TAK1 (pCMV-HA-TAK1) and TAB1 (pCMV-TAB1) as described previously (26Uemura N. Kajino T. Sanjo H. Sato S. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 7863-7872Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Reagents—The reagents used were IL-1β (mouse recombinant; Roche Applied Science), TNFα, TGF-β (human recombinant, Roche), calyculin A, and okadaic acid (Calbiochem). The following polyclonal antibodies were used: TAK1 and Tab1 described previously (3Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1025) Google Scholar), Thr(P)187 TAK1 (27Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar) (Cell Signaling), JNK1 (FL), p38 (N-20), IκBα, p65 (Santa Cruz), phospho-IκB, phospho-p38 (Thr180/Tyr182), and AMPK (Cell Signaling). Rabbit monoclonal antibody phospho-AMPK (Cell Signaling) and mouse monoclonal antibodies phospho-JNK (Thr183/Tyr185) (Cell Signaling) and FLAG-M2 (Sigma) were also used. Electrophoretic Mobility Shift Assay—The binding reactions contained radiolabeled 32P-NF-κB oligonucleotide probe (Promega), cell extracts, 4% glycerol, 1 mm MgCl2, 0.5 mm EDTA, 0.5 mm dithiothreitol, 50 mm NaCl, 10 mm Tris-HCl (pH 7.5), 500 ng of poly(dI-dC) (GE Healthcare), and 10 μg of bovine serum albumin to a final volume of 10 μl. The reaction mixtures were incubated at 25 °C for 15 min, separated by 5% (w/v) polyacrylamide gel, and visualized by autoradiography. Immunoblotting—The cells were washed once with ice-cold phosphate-buffered saline, and whole cell extracts were prepared using lysis buffer (20 mm HEPES, pH 7.4, 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mm MgCl2, 2 mm EGTA, 10 mm NaF, 2 mm dithiothreitol, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 20 μm aprotinin, 0.5% Triton X-100). The cell extracts were resolved on SDS-PAGE and transferred to Hybond-P membranes (GE Healthcare). The membranes were immunoblotted with various antibodies, and the bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against rabbit or mouse IgG using the ECL Western blotting system (GE Healthcare). Retroviral Infection—Retroviral vectors for Tab1 (pMXs-neo-Tab1) was generated by inserting human TAB1 cDNAs into the retroviral vector pMXs-neo (28Kitamura T. Int. J. Hematol. 1998; 67: 351-359Crossref PubMed Google Scholar). To generate retroviral vectors for FLAG-TAB1N (pMXs-puro-FLAG-TAB1N), the ClaI-HincII fragment of pCMV-FLAG-TAB1 (encodes FLAG-tagged TAB1 N terminus 1–418 amino acids) (29Yamaguchi K. Nagai S. Ninomiya-Tsuji J. Nishita M. Tamai K. Irie K. Ueno N. Nishida E. Shibuya H. Matsumoto K. EMBO J. 1999; 18: 179-187Crossref PubMed Scopus (326) Google Scholar) was inserted into pMXs-puro. To generate retroviral vectors for FLAG-TAB1C (pMXs-puro-FLAG-TAB1C), the FLAG tag was fused to C terminus of TAB1 (437–504 amino acids) and inserted into pMXs-puro. EcoPack293 cells (BD Biosciences) were transiently transfected with pMX-neo-TAB1, pMX-puro-FLAG-TAB1N or pMX-puro-FLAG-TAB1C. After 48 h of culture, the growth medium containing retrovirus was collected and filtered with a 0.45-μm cellulose acetate membrane to remove packaging cells. MEFs were incubated with the collected virus-containing medium with 8 μg/ml polybrene for 24 h. The uninfected cells were removed by G418 or puromycin selection. Concentration-dependent Activation of TAK1—Cell lysates from Tab1+/+ and –/– MEFs were incubated and immunoprecipitated with anti-TAK1 at a high protein concentration (10 mg proteins/ml) or at a low protein concentration (2 mg protein/ml) at room temperature for 3 h. Immunoprecipitates were incubated in a kinase buffer (20 mm HEPES, pH 7.4, 1 mm dithiothreitol, 10 mm MgCl, 1 mm ATP) at 37 °C for 20 min and subjected to an immunoblot analysis and kinase assay described previously (12Huangfu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). Loading amounts of immunoprecipitates were adjusted to yield the same loading of TAK1. Conventional Tab1 knock-out mice have demonstrated that TAB1 is essential for proper embryogenesis (21Komatsu Y. Shibuya H. Takeda N. Ninomiya-Tsuji J. Yasui T. Miyado K. Sekimoto T. Ueno N. Matsumoto K. Yamada G. Mech. Dev. 2002; 119: 239-249Crossref PubMed Scopus (77) Google Scholar). However, the roles of TAB1 at the molecular level in cell signaling and morphogenesis are still elusive. To define the in vivo role of TAB1 in several different cell types and tissues, we have recently generated the floxed Tab1 mouse (25Inagaki M. Komatsu Y. Scott G. Yamada G. Ray M. Ninomiya-Tsuji J. Mishina Y. Genesis. 2008; 46: 431-439Crossref PubMed Scopus (14) Google Scholar). In this mouse with floxed Tab1, Cre-dependent recombination results in deletion of C-terminal amino acid residues 308–504 of TAB1 protein. Because TAB1 C terminus contains the TAK1-binding domain (20Ono K. Ohtomo T. Sato S. Sugamata Y. Suzuki M. Hisamoto N. Ninomiya-Tsuji J. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2001; 276: 24396-24400Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), the C-terminal truncated TAB1, if produced from the Cre recombined allele, should be functionally inactive in TAK1-mediated signaling pathways. To begin characterizing the role of TAB1, Cre-dependent DNA recombination was introduced to generate heterozygous mice for Tab1. Intercross of the resulted heterozygous mice for Tab1 was set up, and subsequently Tab1-deficient MEFs were isolated from the homozygous embryos for Cre-recombined Tab1 allele at embryonic day 14.5. These cells along with MEFs from control littermates were utilized to determine the essential role of TAB1 in TAK1 signaling pathways. TAK1 is activated by IL-1 and TNF and plays a central role in inflammatory responses by activating JNK, p38, and NF-κB (30Hayden M.S. Ghosh S. Cell. 2008; 132: 344-362Abstract Full Text Full Text PDF PubMed Scopus (3638) Google Scholar). We first examined whether TAB1 participates in IL-1- and TNF-induced TAK1 signaling pathway. Because it is a formal possibility that immortalization process may genetically and epigenetically alter cells, we generated Tab1 restored Tab1-deficient MEFs (Tab1-restored) to determine whether the alteration found is truly TAB1-dependent. To generate Tab1-restored cells, we infected Tab1-deficient MEFs with retrovirus expressing Tab1, and a pool of Tab1 expressing cells was used for the following experiments. We treated Tab1 control, -deficient, and -restored MEFs with IL-1 or TNF and determined the activation of JNK, p38, and NF-κB (Fig. 1). Inconsistent with the earlier study (4Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (602) Google Scholar), we found that IL-1- and TNF-induced activation of JNK, p38, and NF-κB was not altered by TAB1 deficiency. We asked whether IL-1 and TNF could activate TAK1 in our Tab1-deficient MEFs. We detected an active form of TAK1 by using the Thr(P)187-specific TAK1 antibody (27Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). The levels of TAK1 activation in response to IL-1 or TNF were not significantly reduced by TAB1 deficiency (Fig. 2A). IL-1 and TNF activate TAK1 in MEFs not as strongly as in other types of cells such as 293 that we have previously shown (27Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 31Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (162) Google Scholar). Therefore, to further confirm the activation of TAK1, we pretreated MEFs with type 2A protein phosphatases inhibitor calyculin A, which inhibits down-regulation of TAK1 (27Kajino T. Ren H. Iemura S. Natsume T. Stefansson B. Brautigan D.L. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 39891-39896Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar), and examined activation of TAK1 in response to IL-1. The activation of TAK1 in the presence of calyculin A was also not reduced by Tab1 deletion (Fig. 2B). Thus, TAB1 is dispensable for TNF- and IL-1-induced activation of TAK1.FIGURE 2TAB1 is dispensable for TNF- and IL-1-induced activation of TAK1. A, MEFs were stimulated with 5 ng/ml IL-1 (left panels) or 20 ng/ml TNF (right panels). Activation of TAK1 was monitored by immunoblotting with anti-phospho-TAK1. TAK1 and TAB1 were detected with anti-TAK1 and anti-TAB1. The asterisks indicate nonspecific bands. B, MEFs were pretreated with 10 nm calyculin A for 1 h and stimulated with 5 ng/ml IL-1 for 10 min. Activation of TAK1 was analyzed by immunoblots.View Large Image Figure ViewerDownload Hi-res image Download (PPT) TAK1 is also activated by stress conditions such as osmotic stress (12Huangfu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar) and arsenic treatment. 3M. Inagaki, E. Omori, J.-Y. Kim, Y. Komatsu, G. Scott, M. K. Ray, G. Yamada, K. Matsumoto, Y. Mishina, and J. Ninomiya-Tsuji, unpublished results. Among the stress conditions, we have previously found that stringent osmotic stress using 0.5–0.7 m NaCl strongly activates TAK1 and that TAK1 is essential for NaCl-induced JNK activation (12Huangfu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). We examined whether osmotic stress-induced signaling events are altered by Tab1 deletion, and measured the osmotic stress-induced activation of TAK1 (Fig. 3A). TAK1 was activated at 5–15 min following 0.5 m NaCl treatment in Tab1 control MEFs, whereas osmotic stress-induced activation of TAK1 was greatly impaired in Tab1-deficient MEFs (Fig. 3A). Expression of exogenous TAB1 in the Tab1-deficient MEFs was able to restore the activation of TAK1. These results demonstrate that TAB1 is essential for osmotic stress-induced TAK1 activation. TAB1 consists of 504 amino acid residues in humans. TAB1 binds to TAK1 through its C-terminal amino acid residues 480–495 (20Ono K. Ohtomo T. Sato S. Sugamata Y. Suzuki M. Hisamoto N. Ninomiya-Tsuji J. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2001; 276: 24396-24400Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar) (Fig. 3B). TAB1 also binds to and activates p38α through the amino acid residues 373–418 (32Ge B. Gram H. Di Padova F. Huang B. New L. Ulevitch R.J. Luo Y. Han J. Science. 2002; 295: 1291-1294Crossref PubMed Scopus (463) Google Scholar). Therefore, besides direct interaction between TAB1 and TAK1, TAB1 might indirectly mediate TAK1 activation through p38α. We next asked which possibility is more likely for activation of TAK1 in osmotic stress signaling. We infected Tab1-deficient MEFs with retrovirus expressing the N-terminal amino acid residues 1–418 of Tab1 (Tab1N), which include p38α but not the TAK1-binding region, or the C-terminal amino acid residues 437–504 of TAB1 (TAB1C), which only binds to TAK1. Subsequently, pools of the MEFs expressing Tab1Nor Tab1C were treated with 0.5 m NaCl (Fig. 3C). We found that TAB1C but not TAB1N was able to restore the activation of TAK1 in response to the osmotic stress. TAB1C is only 68 amino acids, and we could not detect the TAB1C protein by immunoblotting. To confirm whether TAB1C mediates TAK1 activation, we utilized other Tab1-deficient MEFs isolated from conventional Tab1 knock-out embryos (21Komatsu Y. Shibuya H. Takeda N. Ninomiya-Tsuji J. Yasui T. Miyado K. Sekimoto T. Ueno N. Matsumoto K. Yamada G. Mech. Dev. 2002; 119: 239-249Crossref PubMed Scopus (77) Google Scholar), which are completely different source from the MEFs used in this study and generated Tab1C expressing Tab1-deficient. Those Tab1C expressing MEFs but not the Tab1-deficient MEFs activate TAK1 in response to the osmotic stress (data not shown). These results suggest that TAB1 association with TAK1 is important for osmotic stress-induced activation of TAK1. Moreover, this demonstrates that the C-terminal 68 amino acid residues of TAB1 are sufficient to mediate osmotic stress-induced TAK1 activation. We next investigated the cellular responses involving osmotic stress induction that are mediated by the TAB1-TAK1 pathway. We examined activation of JNK and p38 in Tab1 control and Tab1-deficient MEFs (Fig. 4A). Activation of JNK but not of p38 was impaired in Tab1-deficient MEFs. We confirmed that TAB1C but not TAB1N was able to restore osmotic stress-induced JNK activation (Fig. 4B). We have previously reported that osmotic stress-induced activation of JNK but not the p38 is impaired in TAK1-deficient cells (12Huangfu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). Therefore, TAB1-TAK1 is predominantly function upstream of JNK but not of p38 in osmotic stress signaling pathway. It has been reported that another MAPK kinase, MEKK3, is important for osmotic stress-induced activation of p38 (33Uhlik M.T. Abell A.N. Johnson N.L. Sun W. Cuevas B.D. Lobel-Rice K.E. Horne E.A. Dell'Acqua M.L. Johnson G.L. Nat. Cell Biol. 2003; 5: 1104-1110Crossref PubMed Scopus (316) Google Scholar). Thus, it is likely that TAB1-TAK1 is the major mediator of JNK activation, whereas MEKK3 is the major mediator of p38 activation. We also examined activation of NF-κB (Fig. 4C). Although TAK1 is capable of activating NF-κB and is highly activated under osmotic stress conditions, NF-κB pathway was not activated at all even in wild type MEFs, which is consistent with our previous observation (12Huangfu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). We think that TAK1 is directed to the JNK pathway in response to osmotic stress by binding to TAO2 kinase as described in our previous report (12Huangfu W.-C. Omori E. Akira S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 28802-28810Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar). In addition to JNK and p38, many stress conditions activate the AMPK pathway that regulates energy metabolism (34Hardie D.G. Nat. Rev. Mol. Cell Biol. 2007; 8: 774-785Crossref PubMed Scopus (1799) Google Scholar). TAK1 is previously implicated in activation of AMPK (35Xie M. Zhang D. Dyck J.R. Li Y. Zhang H. Morishima M. Mann D.L. Taffet G.E. Baldini A. Khoury D.S. Schneider M.D. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 17378-17383Crossref PubMed Scopus (292) Google Scholar). We would like to note that AMPK was activated upon 0.5 m NaCl treatment, and the level of activation was not markedly reduced either by Tab1 deletion or by Tak1 deletion (supplemental Fig. S1). These results demonstrate that osmotic stress activates TAK1 in a TAB1-dependent manner, which is essential for activation of JNK but not of p38 or AMPK. Our results demonstrated that among the TAK1 stimuli, only osmotic stress signaling utilizes TAB1 to activate TAK1. We then attempted to determine the mechanism by which TAB1 activates TAK1 in response to osmotic stress. In IL-1 and TNF pathways, it has been demonstrated that TAK1 is associated with a large signaling complex consisting of a number of proteins including TAB2/3 and TNF receptor-associated factors (36Chen Z.J. Bhoj V. Seth R.B. Cell Death Differ. 2006; 13: 687-692Crossref PubMed Scopus (102) Google Scholar). TAK1 oligomerization in the signaling complexes is essential for activation of TAK1. In contrast to cytokine signaling, formation of such signaling complexes has not been identified in the osmotic stress pathway. Because oligomerization is one of common mechanisms of enzymatic activation of kinases, we speculated that TAK1 might be oligomerized and activated under an osmotic stress condition in a TAB1-dependent manner. How is TAK1 oligomerized by osmotic stress? There is no specific sensor molecule for osmotic stress in mammalian cells. It has been well known that osmotic stress shrinks cells and that the reduced cell volume is the trigger of cell signaling (37Burg M.B. Ferraris J.D. Dmitrieva N.I. Physiol. Rev. 2007; 87: 1441-1474Crossref PubMed Scopus (585) Google Scholar, 38Roger F. Martin P.-Y. Rousselot M. Favre H. Feraille E. J. Biol. Chem. 1999; 274: 34103-34110Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Thus, we speculated that the TAB1-TAK1 complex might be spontaneously oligomerized and activated when the concentration of TAB1-TAK1 is increased. To test this possibility, we examined whether TAB1-TAK1 can be spontaneously activated when the protein concentration is increased. We incubated cell lysates from Tab1 control or Tab1-deficient MEFs at a high (10 mg protein/ml) or low (2 mg protein/ml) concentration and measured TAK1 activity (Fig. 5, A and B). A slowly migrating TAK1 on SDS-PAGE, which was phosphorylated, was detected when incubated at the high concentration in the presence of TAB1. In contrast, TAK1 was not phosphorylated at any concentrations in the lysate from Tab1-deficient MEFs. We confirmed that catalytic activity of TAK1 was greatly increased after incubation at the high concentration in a TAB1-dependent manner (Fig. 5B), which suggests that when TAB1-TAK1 concentration is increased, TAK1 is oligomerized and thereby activated. further test this idea, we utilized 293 cells to overexpress HA-tagged TAK1 with TAB1 to increase the concentration of TAB1-TAK1. If an increase of TAB1-TAK1 concentration causes oligomerization and activation of TAK1, exogenously overexpressed HA-TAK1-TAB1 could activate not only HA-TAK1 but also endogenous TAK1. Because HA-tagged TAK1 is significantly bigger than endogenous TAK1, we were able to detect a slower migrating HA-TAK1 band on SDS-PAGE when HA-TAK1 alone was overexpressed (Fig. 5C, top panel, lane 1). We found that when cells were transfected with HA-TAK1 and TAB1, both HA-TAK1 and endogenous TAK1 migrated as slower smear bands on SDS-PAGE (Fig. 5C, top panel, lane 2). The slowly migrated HA-TAK1 and endogenous TAK1 were confirmed as phosphorylated forms (Fig. 5C, middle panel). This suggests that exogenously overexpressed TAB1-TAK1 can interact with and induced activation of endogenous TAK1. These results indicate that TAB1 is essential for concentration-dependent spontaneous activation of TAK1, which may be mediated by TAB1-TAK1 oligomerization. We next attempted to determine whether TAB1-TAK1 is oligomerized under osmotic stress conditions. However, the interaction of TAK1 with TAB1 was not altered by osmotic stress (data not shown), and TAB1 was always coprecipitated with TAK1 regardless of treatment of stimuli including osmotic stress and IL-1, which is consistent with our previous observation (19Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar). We assume that TAB1-TAK1 complexes are preformed and that some of the complexes may be oligomerized upon stimuli challenges. The necessity of overexpression of both TAK1 and TAB1 for activation of TAK1 (Fig. 5C) supports this idea. We speculate that cell shrinkage under osmotic stress conditions increases the TAB1-TAK1 concentration, which may be sufficient to induce oligomerization of some TAB1-TAK1 in the cells. In summary, TAB1 is essential for osmotic stress-induced activation of TAK1, which may be mediated by concentration-dependent oligomerization of TAK1. In contrast, TAK1 is activated in a TAB1-independent manner in response to IL-1 and TNF, which is presumably because TAK1 is oligomerized through other adaptor molecules including TAB2. In addition to these pathways, TAB1 is known to be critically involved in TGF-β family signaling pathways. TAB1 is associated with X-linked inhibitor of apoptosis protein and thereby recruiting TAK1 to the TGF-β receptor complex (29Yamaguchi K. Nagai S. Ninomiya-Tsuji J. Nishita M. Tamai K. Irie K. Ueno N. Nishida E. Shibuya H. Matsumoto K. EMBO J. 1999; 18: 179-187Crossref PubMed Scopus (326) Google Scholar, 39Lu M. Lin S.C. Huang Y. Kang Y.J. Rich R. Lo Y.C. Myszka D. Han J. Wu H. Mol. Cell. 2007; 26: 689-702Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). We examined TGF-β-induced activation of plasminogen activator inhibitor 1, which was previously identified as one of the TAK1-dependent events in TGF-β signaling pathways (10Kajino T. Omori E. Ishii S. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2007; 282: 9475-9481Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). We found that the induction of plasminogen activator inhibitor 1 mRNA was not impaired in Tab1-deficient MEFs (supplemental Fig. S2). This suggests that TAB1 is dispensable at least for TGF-β-induced plasminogen activator inhibitor 1 induction in MEFs. Because TGF-β family ligand-induced cellular responses are not effectively detected in MEFs, we have not yet determined whether other TGF-β signaling pathways are mediated by TAB1. Mendoza et al. (24Mendoza H. Campbell D.G. Burness K. Hastie J. Ronkina N. Shim J.H. Arthur J.S. Davis R.J. Gaestel M. Johnson G.L. Ghosh S. Cohen P. Biochem. J. 2008; 409: 711-722Crossref PubMed Scopus (55) Google Scholar) have recently reported that IL-1-induced TAK1 activation is impaired in Tab1-deficient MEFs. In contrast, our results demonstrated that TAB1 is dispensable for IL-1-induced TAK1 activation. Mendoza et al. used MEFs from the conventional Tab1 knock-out embryos (21Komatsu Y. Shibuya H. Takeda N. Ninomiya-Tsuji J. Yasui T. Miyado K. Sekimoto T. Ueno N. Matsumoto K. Yamada G. Mech. Dev. 2002; 119: 239-249Crossref PubMed Scopus (77) Google Scholar). This Tab1 knock-out embryo lacks exons 10 and 11 of Tab1, which presumably express a C-terminal truncated form of TAB1 that is almost identical to the truncated TAB1 generated in our Cre-mediated Tab1 deletion system. We would like to note that we conducted most of the experiments in this study not only using our Tab1-deficient MEFs but also MEFs from the conventional Tab1 knock-out embryos and that all of the results were the same in both Tab1-deficient MEFs. Therefore, we do not know the reason for the discrepancy between their and our results. It might be possible that MEFs respond differently to IL-1 because of genetic or epigenetic alterations generated during immortalization but not because of TAB1 deficiency. In our study, we utilized Tab1-restored MEFs to confirm the TAB1-dependent cellular responses and found that Tab1 deletion does not significantly affect TNF and IL-1 signaling pathways. It has been well documented that TAK1 deletion almost completely abolishes TNF- and IL-1-induced JNK, p38, and NF-κB activation in several types of cells (4Shim J.H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (602) Google Scholar, 5Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (324) Google Scholar, 23Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (773) Google Scholar, 40Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). This suggests that there is no compensatory mechanism that can activate JNK, p38, and NF-κB in the absence of TAK1 in IL-1 and TNF signaling pathways, which is consistent with our results that activation of TAK1, NF-κB, JNK, and p38 was all intact in Tab1-deficient MEFs. Thus, we conclude that TAB1 is dispensable for TAK1 activation, at least in TNF and IL-1 signaling pathways. In this study, we identified that the C-terminal region of TAB1 is essential and sufficient for osmotic stress-induced activation of TAK1. The C-terminal region of TAB1 binding to TAK1 may be important for oligomerization of TAK1, which in turn activates TAK1. Further studies to define the molecular mechanism by which such a small region of TAB1 mediates TAK1 activation in response to osmotic stress will be important. We show here that TAB1 is totally dispensable for IL-1 and TNF signaling pathways but essential for osmotic stress-induced JNK activation. Based on these findings, we assume that TAB1-TAK1 signaling is involved in a subset of stress responses but not in IL-1 or TNF signaling in vivo. Utilizing our Tab1-floxed mice, we anticipate that we can explore the role of TAB1-TAK1 signaling in an in vivo setting. We thank S. Akira for materials. Download .pdf (.49 MB) Help with pdf files}, number={48}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Inagaki, Maiko and Omori, Emily and Kim, Jae-Young and Komatsu, Yoshihiro and Scott, Greg and Ray, Manas K. and Yamada, Gen and Matsumoto, Kunihiro and Mishina, Yuji and Ninomiya-Tsuji, Jun}, year={2008}, month={Nov}, pages={33080–33086} }
 @article{huangfu_matsumoto_ninomiya-tsuji_2007, title={Osmotic stress blocks NF-kappa B-dependent in inflammatory responses by inhibiting ubiquitination of I kappa B}, volume={581}, ISSN={["1873-3468"]}, DOI={10.1016/j.febslet.2007.11.002}, abstractNote={The inhibitory effects of hypertonic conditions on immune responses have been described in clinical studies; however, the molecular mechanism underlying this phenomenon has yet to be defined. Here we investigate osmotic stress-mediated modification of the NF-kappaB pathway, a central signaling pathway in inflammation. We unexpectedly found that osmotic stress could activate IkappaBalpha kinase but did not activate NF-kappaB. Osmotic stress-induced phosphorylated IkappaBalpha was not ubiquitinated, and osmotic stress inhibited interleukin 1-induced ubiquitination of IkappaBalpha and ultimately blocked expression of cytokine/chemokines. Thus, blockage of IkappaBalpha ubiquitination is likely to be a major mechanism for inhibition of inflammation by hypertonic conditions.}, number={29}, journal={FEBS LETTERS}, author={HuangFu, Wei-Chun and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2007}, month={Dec}, pages={5549–5554} }
 @article{kajino_omori_ishii_matsumoto_ninomiya-tsuji_2007, title={TAK1 MAPK kinase kinase mediates transforming growth factor-beta signaling by targeting SnoN oncoprotein for degradation}, volume={282}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M700875200}, abstractNote={Transforming growth factor-β (TGF-β) regulates a variety of physiologic processes through essential intracellular mediators Smads. The SnoN oncoprotein is an inhibitor of TGF-β signaling. SnoN recruits transcriptional repressor complex to block Smad-dependent transcriptional activation of TGF-β-responsive genes. Following TGF-β stimulation, SnoN is rapidly degraded, thereby allowing the activation of TGF-β target genes. Here, we report the role of TAK1 as a SnoN protein kinase. TAK1 interacted with and phosphorylated SnoN, and this phosphorylation regulated the stability of SnoN. Inactivation of TAK1 prevented TGF-β-induced SnoN degradation and impaired induction of the TGF-β-responsive genes. These data suggest that TAK1 modulates TGF-β-dependent cellular responses by targeting SnoN for degradation. Transforming growth factor-β (TGF-β) regulates a variety of physiologic processes through essential intracellular mediators Smads. The SnoN oncoprotein is an inhibitor of TGF-β signaling. SnoN recruits transcriptional repressor complex to block Smad-dependent transcriptional activation of TGF-β-responsive genes. Following TGF-β stimulation, SnoN is rapidly degraded, thereby allowing the activation of TGF-β target genes. Here, we report the role of TAK1 as a SnoN protein kinase. TAK1 interacted with and phosphorylated SnoN, and this phosphorylation regulated the stability of SnoN. Inactivation of TAK1 prevented TGF-β-induced SnoN degradation and impaired induction of the TGF-β-responsive genes. These data suggest that TAK1 modulates TGF-β-dependent cellular responses by targeting SnoN for degradation. Transforming growth factor-β (TGF-β) 2The abbreviations used are: TGF-β, transforming growth factor-β; TAK1, TGF-β-activated kinase 1; TAB1, TAK1-binding protein 1; MAPKKK, mitogen-activated protein kinase kinase kinase; HA, hemagglutinin; siRNA, small interfering RNA; GST, glutathione S-transferase. is a multifunctional cytokine involved in the regulation of proliferation, differentiation, migration, and survival of many different cell types (1Shi Y. Massague J. Cell. 2003; 113: 685-700Abstract Full Text Full Text PDF PubMed Scopus (4836) Google Scholar, 2Wakefield L.M. Roberts A.B. Curr. Opin. Genet. Dev. 2002; 12: 22-29Crossref PubMed Scopus (729) Google Scholar). TGF-β ligand binds to and activates Ser/Thr kinase receptors (3Wrana J.L. Attisano L. Wieser R. Ventura F. Massague J. Nature. 1994; 370: 341-347Crossref PubMed Scopus (2114) Google Scholar). This leads to the phosphorylation and activation of the receptor-regulated Smad family (R-Smad), Smad2 and Smad3 (4Chen X. Rubock M.J. Whitman M. Nature. 1996; 383: 691-696Crossref PubMed Scopus (632) Google Scholar). Phosphorylated R-Smad forms a functional complex with the co-mediator Smad (Co-Smad), Smad4, and this complex accumulates in the nucleus and modulates expression of the TGF-β-responsive genes such as plasminogen activator inhibitor type-1 (PAI-1) (1Shi Y. Massague J. Cell. 2003; 113: 685-700Abstract Full Text Full Text PDF PubMed Scopus (4836) Google Scholar, 5Westerhausen Jr., D.R. Hopkins W.E. Billadello J.J. J. Biol. Chem. 1991; 266: 1092-1100Abstract Full Text PDF PubMed Google Scholar, 6Nakao A. Imamura T. Souchelnytskyi S. Kawabata M. Ishisaki A. Oeda E. Tamaki K. Hanai J. Heldin C.H. Miyazono K. ten Dijke P. EMBO J. 1997; 16: 5353-5362Crossref PubMed Scopus (916) Google Scholar). The nuclear Smads complex is maintained in an inactive state via its association with Ski family oncoproteins, Ski and SnoN (7Luo K. Curr. Opin. Genet. Dev. 2004; 14: 65-70Crossref PubMed Scopus (177) Google Scholar, 8Sun Y. Liu X. Eaton E.N. Lane W.S. Lodish H.F. Weinberg R.A. Mol. Cell. 1999; 4: 499-509Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar). By binding to Smads, Ski and SnoN recruit transcriptional repressor complexes such as N-CoR/SMRT and mSin3A to TGF-β target promoters and thereby repress transcription of TGF-β-responsive genes (7Luo K. Curr. Opin. Genet. Dev. 2004; 14: 65-70Crossref PubMed Scopus (177) Google Scholar, 9Nomura T. Khan M.M. Kaul S.C. Dong H.D. Wadhwa R. Colmenares C. Kohno I. Ishii S. Genes Dev. 1999; 13: 412-423Crossref PubMed Scopus (251) Google Scholar). Upon TGF-β stimulation, SnoN is immediately down-regulated via the ubiquitin-proteasome pathway induced by anaphase-promoting complex (APC) or Smurf2 E3 ubiquitin-protein isopeptide ligases (10Bonni S. Wang H.R. Causing C.G. Kavsak P. Stroschein S.L. Luo K. Wrana J.L. Nat. Cell Biol. 2001; 3: 587-595Crossref PubMed Scopus (273) Google Scholar, 11Stroschein S.L. Bonni S. Wrana J.L. Luo K. Genes Dev. 2001; 15: 2822-2836Crossref PubMed Google Scholar, 12Wan Y. Liu X. Kirschner M.W. Mol. Cell. 2001; 8: 1027-1039Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). Degradation of SnoN initially allows the Smad heteromeric complex to activate TGF-β target genes (13Sun Y. Liu X. Ng-Eaton E. Lodish H.F. Weinberg R.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12442-12447Crossref PubMed Scopus (226) Google Scholar). However, longer TGF-β treatment leads to higher expression via transcriptional activation of the SnoN gene (14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). This functions as a negative feedback circuit to limit the effects of TGF-β. Importantly, overexpression of SnoN results in the loss of TGF-β-induced growth arrest of the cells, suggesting a potential mechanism for SnoN-mediated oncogenesis (8Sun Y. Liu X. Eaton E.N. Lane W.S. Lodish H.F. Weinberg R.A. Mol. Cell. 1999; 4: 499-509Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar, 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). TGF-β-activated kinase 1 (TAK1) is a member of mitogen-activated protein kinase kinase kinase (MAPKKK) and functions as a signaling intermediate in several intracellular signaling pathways including the TGF-β and interleukin-1 pathways (15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1175) Google Scholar, 16Shibuya H. Iwata H. Masuyama N. Gotoh Y. Yamaguchi K. Irie K. Matsumoto K. Nishida E. Ueno N. EMBO J. 1998; 17: 1019-1028Crossref PubMed Scopus (190) Google Scholar, 17Hanafusa H. Ninomiya-Tsuji J. Masuyama N. Nishita M. Fujisawa J. Shibuya H. Matsumoto K. Nishida E. J. Biol. Chem. 1999; 274: 27161-27167Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar, 18Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1019) Google Scholar). TAK1 is catalytically activated by TGF-β stimulation (15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1175) Google Scholar) and plays an essential role in TGF-β-induced p38 activation (17Hanafusa H. Ninomiya-Tsuji J. Masuyama N. Nishita M. Fujisawa J. Shibuya H. Matsumoto K. Nishida E. J. Biol. Chem. 1999; 274: 27161-27167Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar). TAK1 has also been implicated in several TGF-β-induced biological processes including apoptosis (19Edlund S. Bu S. Schuster N. Aspenstrom P. Heuchel R. Heldin N.E. ten Dijke P. Heldin C.H. Landstrom M. Mol. Biol. Cell. 2003; 14: 529-544Crossref PubMed Scopus (187) Google Scholar) and vascular development (20Jadrich J.L. O'Connor M.B. Coucouvanis E. Development (Camb.). 2006; 133: 1529-1541Crossref PubMed Scopus (111) Google Scholar). However little is known about how TAK1 mediates TGF-β signaling. In this study, we found that TAK1 interacts with SnoN and targets it for degradation. The TAK1 regulation of SnoN may participate in TGF-β-induced cellular responses. Plasmids and Protein—The mammalian expression vectors for TAK1, HA-TAK1, HA-TAK1(K63W), TAB1, and HA-ubiquitin have been described previously (15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1175) Google Scholar, 18Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1019) Google Scholar, 21Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (520) Google Scholar, 22Shimura H. Hattori N. Kubo S. Mizuno Y. Asakawa S. Minoshima S. Shimizu N. Iwai K. Chiba T. Tanaka K. Suzuki T. Nat. Genet. 2000; 25: 302-305Crossref PubMed Scopus (1706) Google Scholar). Full-length SnoN and SnoN-(1–366) were subcloned into pCMV in-frame with HA tag or FLAG tag at the N terminus. Small interference RNA (siRNA) was produced using the BS/H1 vector to direct expression of the relevant hairpin double-stranded sequence from the H1 promoter. The siRNA target sequences corresponded to nucleotides 88–106 of the TAK1 cording region. Target oligonucleotides were synthesized (5′-GATCCCCGAGATCGACTACAAGGAGATTCAAGAGATCTCCTTGTAGTCGATCTCTTTTTGGAAA-3′; and 5′-AGCTTTTCCAAAAAGAGATCGACTACAAGGAGATCTCTTGAATCTCCTTGTAGTCGATCTCGGG-3′), annealed, and cloned into BS/H1 between the BglII and HindIII sites using standard molecular cloning techniques. Generation of various point mutations of full-length SnoN and SnoN-(1–366), including full-length SnoN and SnoN-(1–366) mutated at Ser-115, Ser-117, and Thr-119 to Ala or Ser-108, Ser-112, Ser-115, Ser-117, Thr-119, Ser-126, Ser-140, and Ser-141 to Ala, were done using PCR and QuikChange II XL site-directed mutagenesis kit (Stratagene) and verified by DNA sequencing. Bacterially expressed SnoN-(1–366) fused to glutathione S-transferase (GST) (GST-SnoN-(1–366)) was purified using glutathione-Sepharose 4 Fast Flow (Amersham Biosciences) according to manufacturer's instructions. The retrovirus vectors for HA-SnoN full-length and HA-SnoN mutant full-length were generated by insertion of HA-tagged SnoN cDNAs into pQCXIP vector (Stratagene). Antibodies and Reagents—The following antibodies were used: anti-HA monoclonal antibody 16B12 (Covance), anti-FLAG monoclonal antibody M2 (Sigma), anti-Sno polyclonal antibody (Upstate Biotechnology), anti-TAK1 antibody (18Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1019) Google Scholar), anti-IκBα polyclonal antibody C-21 (Santa Cruz Biotechnology), anti-β-catenin monoclonal antibody 14 (BD Biosciences), anti-Smad2/3 polyclonal antibody (Upstate Biotechnology), anti-p53 monoclonal antibody DO-1 (Santa Cruz Biotechnology), and anti-β-actin monoclonal antibody AC-15 (Sigma). Recombinant human TGF-β1 was purchased from Roche Applied Science. (5Z)-7-Oxozeaenol was as described previously (23Ninomiya-Tsuji J. Kajino T. Ono K. Ohtomo T. Matsumoto M. Shiina M. Mihara M. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2003; 278: 18485-18490Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar). G418 (Invitrogen), hygromycin B (A. G. Scientific, Inc.), λ phosphatase (New England Biolabs), and cycloheximide (Calbiochem) were used. Cell Culture, Transfection, and Virus Infection—293 cells, HaCaT cells, and HeLa S3 cells were cultured in Dulbecco's modified Eagle's medium plus 10% fetal calf serum or bovine growth serum (HyClone). Transfection of 293 cells was carried out using the calcium phosphate precipitation method. Stable transfections of HaCaT cells and HeLa S3 cells were carried out using TransFast™ (Promega). The retrovirus for expression of HA-SnoN full-length and HA-SonN mutant full-length were generated and infected into HaCaT cells according to the manufacturer's instruction. Stable cell line selection was achieved using G418, hygromycin B, or puromycin. Yeast Two-hybrid Screening—Plasmid pGBD-C-TAK1(K63W) was used as bait to screen a mouse B cell library (in pGAD) (21Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (520) Google Scholar). The bait plasmid and the library cDNAs were co-transformed into the yeast strain PJ69-4A using the lithium acetate method. Yeast cells were plated on selective medium plates and allowed to grow at 30 °C. Positive colonies were then restreaked on selective medium plates. Plasmid DNA was rescued from positive colonies that grew on selective medium plates and subject to further sequence analysis. Immunoprecipitation and Immunoblotting—Whole cell extracts were prepared in lysis buffer (20 mm HEPES, pH 7.4, 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mm MgCl2, 2 mm EGTA, 10 mm NaF, 2 mm dithiothreitol, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 100 units/ml aprotinin, 0.5% Triton X-100). Proteins from cell lysates were immunoprecipitated with 1 μg of various antibodies and 15 μl of protein G-Sepharose (Amersham Biosciences). The immune complexes were washed three times with wash buffer containing 20 mm HEPES (pH 7.4), 500 mm NaCl, and 10 mm MgCl2 and once with rinse buffer containing 20 mm HEPES (pH 7.4), 150 mm NaCl, and 10 mm MgCl2 and suspended in 30 μl of rinse buffer. For immunoblotting, the immunoprecipitates or cell lysates were resolved on SDS-PAGE and transferred to Hybond-P membranes (Amersham Biosciences). The membranes were immunoblotted with various antibodies, and bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against mouse or rabbit IgG using the ECL Western blotting system (Amersham Biosciences). Cellular Fractionation—To isolate the nuclear and the cytoplasm fractions, cells in 10-cm dishes were treated with TGF-β (5 ng/ml) and then lysed with 500 μl of hypotonic buffer A (50 mm HEPES (pH 7.4), 10 mm KCl, 1 mm EDTA, 1 mm EGTA, 1 mm dithiothreitol, 0.2 mm phenylmethylsulfonyl fluoride, and 100 units/ml aprotinin) containing 0.1% Nonidet P-40 and homogenized in a Dounce homogenizer (30 strokes). Lysates were then centrifuged at 4,000 × g for 4 min. The supernatant was centrifuged at 12,500 × g for 4 min to obtain the cytosolic fraction. This pellet was resuspended in hypotonic buffer B (buffer A containing 1.7 m sucrose) and then centrifuged at 15,000 × g for 30 min. The pellet (nuclear fraction) was resuspended in 0.5% Triton X-100 lysis buffer and sonicated. All steps were performed on ice or at 4 °C. Protein concentrations were determined using the micro BCA protein assay kit (Pierce). The purity of the cytosolic and nuclear fractions was assessed by immunoblotting of IκB (a cytosolic marker) and lamin B (a nuclear marker). Real-time Quantitative Reverse Transcription-PCR—Real-time quantitative PCR was preformed using 7300 Real-time PCR system (PE Applied Biosystems) and SYBR Premix Ex Taq (Takara Bio Inc.). The cycling conditions were as follows: 95 °C for 10 s; 40 cycles of 95 °C for 5 s and 60 °C for 34 s. The primers for PAI-1 (forward, 5′-GCC ATG GAA CAA GGA TGA GAT C-3′; reverse, 5′-AGC CCT GGA CCA GCT TCA G-3′) and β-actin (forward, 5′-GCC GGG ACC TGA CTG ACT AC; reverse, 5′-TCC TTA ATG TCA CGC ACG ATT TC-3′) were designed using Primer Express, version 2.0. In Vitro Kinase Assay—Ectopically expressed HA-TAK1 was immunoprecipitated with anti-HA antibody as described above. Immunoprecipitates were incubated with or without 1 μg of bacterially expressed SnoN-(1–366) in 10 μl of kinase buffer containing 10 mm HEPES (pH 7.4), 1 mm dithiothreitol, 5 mm MgCl2, and 5 μCi of [γ-32P]ATP (3,000 Ci/mmol) at 30 °C for 15 min. Samples were fractionated by 10% SDS-PAGE and visualized by autoradiography. To study the role of TAK1 in TGF-β signaling, we screened for TAK1-binding proteins using the yeast two-hybrid system. A kinase-inactive mutant of TAK1, TAK1(K63W), was used as the bait to screen a mouse B cell cDNA library. From a total of 2 × 106 transformants, 28 clones were identified as potential interactors. Sequence analysis revealed that one of the positive clones encoded SnoN2 (Fig. 1A). SnoN undergoes alternative splicing, creating four splicing isoform, SnoN, SnoN2, SnoI, and SnoA (7Luo K. Curr. Opin. Genet. Dev. 2004; 14: 65-70Crossref PubMed Scopus (177) Google Scholar, 24Pearson-White S. Crittenden R. Nucleic Acids Res. 1997; 25: 2930-2937Crossref PubMed Scopus (64) Google Scholar). The N terminus of SnoN, from 1 to 366 amino acids, is identical among the four isoforms. The SnoN2 sequence is completely identical with that of SnoN except for the C-terminal 46 amino acids (Fig. 1B). As SnoN2 is the less abundantly expressed isoform in human cells (24Pearson-White S. Crittenden R. Nucleic Acids Res. 1997; 25: 2930-2937Crossref PubMed Scopus (64) Google Scholar), we focused on the interaction between TAK1 and SnoN. Interaction of TAK1 with SnoN was further confirmed in mammalian cell by co-immunoprecipitation assays. HA epitope-tagged TAK1 and FLAG-tagged SnoN were transiently co-expressed in 293 human embryonic kidney cells. The cell extracts were immunoprecipitated with anti-FLAG antibody and followed by immunoblotting analysis (Fig. 1C). When FLAG-SnoN was immunoprecipitated, both HA-TAK1 and HA-TAK1(K63W) were co-immunoprecipitated. To establish the connection between TAK1 and SnoN, we next determined the subcellular localizations of TAK1 and SnoN. We performed biochemical fractionation with human keratinocyte HaCaT cells. TGF-β-stimulated and unstimulated HaCaT cells were fractionated into the nuclear and the cytosolic extracts. Endogenous SnoN was localized only in the nucleus but was degraded upon TGF-β stimulation (Fig. 2, left panel). Endogenous TAK1 was localized primarily in the cytoplasm but also was detected in the nuclear fractions. Upon TGF-β stimulation, the amount of nuclear TAK1 was increased. The fractions were reasonably pure, as determined by the presence of IκB only in the cytosolic fraction and not in the nuclear fraction. Conversely, a nuclear protein, lamin B, was detected only in the nuclear fraction but not the cytosolic fraction (supplemental Fig. S1). These data raised the possibility that TAK1 is co-localized with SnoN in the nucleus. To examine the interaction between TAK1 and SnoN in the nucleus, endogenous TAK1 was immunoprecipitated following fractionation (Fig. 2, right panel). SnoN was found to be associated with TAK1 in the nuclear fraction independently of TGF-β stimulation, but no association could be detected in the cytosolic fraction. Thus, TGF-β stimulation induces the TAK1 accumulation in the nucleus, and this nuclear TAK1 interacts with SnoN. The observed association between TAK1 and SnoN suggested that TAK1 is involved in the TGF-β-dependent degradation of SnoN. To test the possibility, we employed siRNA to reduce the levels of endogenous TAK1 (25Elbashir S.M. Harborth J. Lendeckel W. Yalcin A. Weber K. Tuschl T. Nature. 2001; 411: 494-498Crossref PubMed Scopus (8161) Google Scholar). We generated two independent HeLa S3 cell lines stably expressing TAK1 siRNA. Expression of TAK1 in each clone was determined by immunoblotting. Expression of TAK1 siRNA greatly reduced the amount of endogenous TAK1 but not affect β-catenin (Fig. 3A). Both TAK1 knockdown cells and parent cells were then treated with TGF-β and subjected to biochemical fractionation. The nuclear fraction was further subjected to immunoblotting with anti-SnoN, anti-TAK1, and anti-Smad2/3. As shown in Fig. 3B, TGF-β induced the degradation of SnoN in HeLa S3 cells, but degradation was impaired in TAK1 knockdown cells. In contrast, TGF-β-induced nuclear accumulation of Smad2/3 was observed to be normal in cells expressing TAK1 siRNA. To assess the influence of TAK1 knockdown on the TGF-β-dependent biological events, we examined expression of a TGF-β-responsive gene, PAI-1. PAI-1 participates in wound healing processes. The mRNA levels of PAI-1 were increased at around 30–60 min, which occurred subsequent to SnoN degradation and Smad accumulation. The accumulation of PAI-1 mRNA in response to TGF-β was impaired in the TAK1 siRNA-expressing cells (Fig. 3C). These results suggest that TAK1 is involved in TGF-β-dependent biological processes. We found that the N-terminal region of SnoN-(1–366) was also associated with TAK1 in 293 cells by co-immunoprecipitation assays (Fig. 1C). This region is identical in four isoforms of SnoN and sufficient for transcriptional repression (supplemental Fig. S2 and Refs. 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar and 26Liu X. Sun Y. Weinberg R.A. Lodish H.F. Cytokine Growth Factor Rev. 2001; 12: 1-8Crossref PubMed Scopus (176) Google Scholar). To determine whether the N terminus of SnoN is sufficient for TGF-β-dependent degradation, we generated HaCaT cells stably expressing HA-tagged SnoN-(1–366). We found that TGF-β treatment induced degradation of SnoN-(1–366) (Fig. 4A). We had shown previously that (5Z)-7-oxozeaenol selectively blocks the activity of endogenous TAK1 (23Ninomiya-Tsuji J. Kajino T. Ono K. Ohtomo T. Matsumoto M. Shiina M. Mihara M. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2003; 278: 18485-18490Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar). To determine whether the decrease of the SnoN-(1–366) depends on TAK1 activity, we treated the cells with the TAK1 inhibitor. The SnoN degradation was blocked by TAK1 inhibition. Thus, SnoN-(1–366) is likely to be degraded through TAK1-dependent phosphorylation. To further dissect the role of TAK1 on SnoN degradation, we used SnoN-(1–366). To confirm whether TAK1 phosphorylates SnoN-(1–366), we prepared bacterially expressed recombinant GST-SnoN-(1–366) and preformed in vitro kinase assay using immunoprecipitated HA-TAK1 from 293 cells co-transfected with HA-TAK1 and TAB1. TAK1 is activated by co-expression of TAB1 (21Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (520) Google Scholar, 27Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). We found that TAK1, but not the kinase-inactive TAK1(K63W), could phosphorylate SnoN-(1–366) in vitro (Fig. 4B). To further confirm the phosphorylation of SnoN-(1–366) by TAK1 in vivo, we performed immunoblotting analysis and looked for a mobility shift in SDS-PAGE as an indicator of phosphorylation. In 293 cells, co-expression of TAK1 and TAB1 led to the appearance of a slower migrating form of SnoN-(1–366) (Fig. 4C). This shift in migration was reversed by treatment with phosphatase. These results suggest that TAK1 phosphorylates the N terminus of SnoN in vivo. To define the approximate region of SnoN phosphorylated by TAK1, we generated several truncated versions of SnoN-(1–366). Among the short regions of SnoN, we found that SnoN-(101–214) showed a slower migrating band with co-expression of TAK1 and TAB1 (supplemental Fig. S3A). We then generated a series of SnoN-(101–214) mutants that contain several amino acid substitutions from Ser or Thr to Ala. The analysis suggests that Ser-108, Ser-112, Ser-115, Ser-117, Thr-119, Ser-126, Ser-140, and/or Ser-141 are potential phosphorylation sites. We generated a mutant SnoN-(1–366) containing the Ser/Thr to Ala substitutions at Ser-108, Ser-112, Ser-115, Ser-117, Thr-119, Ser-126, Ser-140, and Ser-141 (SnoN-(1–366 8A)), which did not show slowly migrating band with co-expression of TAK1 and TAB1 (supplemental Fig. S3B). It has been reported that a member of the MAPKKK family phosphorylates substrates within a conserved Ser/Thr-X-X-X-Ser/Thr motif (28Cobb M.H. Goldsmith E.J. J. Biol. Chem. 1995; 270: 14843-14846Abstract Full Text Full Text PDF PubMed Scopus (1662) Google Scholar). We also generated SnoN(1–366 AAA), containing mutations of Ser-115, Ser-117, and Thr-119 to Ala and examined TAK1-dependent phosphorylation. SnoN(1–366 AAA) exhibited decreased phosphorylation by TAK1 (Fig. 4C and supplemental Fig. S3B). These results suggest that Ser-115, Ser-117, or/and Thr-119 are major sites of TAK1-dependent phosphorylation. However, we could still detect a slightly slower migrating band of SnoN-(1–366 AAA) when coexpressed with an active TAK1. It is likely that other sites among the eight amino acid residues may also be phosphorylated by TAK1. SnoN is ubiquitinated and degraded upon TGF-β stimulation (11Stroschein S.L. Bonni S. Wrana J.L. Luo K. Genes Dev. 2001; 15: 2822-2836Crossref PubMed Google Scholar, 13Sun Y. Liu X. Ng-Eaton E. Lodish H.F. Weinberg R.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12442-12447Crossref PubMed Scopus (226) Google Scholar). Our finding raised the possibility that TAK1-dependent phosphorylation of SnoN may induce SnoN ubiquitination and degradation. To investigate the relationship between SnoN phosphorylation and ubiquitination, we asked whether TAK1 induces SnoN ubiquitination. 293 cells were transfected with HA-tagged SnoN or SnoN-(1–366), TAK1, TAB1, and FLAG-ubiquitin. We immunoprecipitated SnoN followed by immunoblotting for ubiquitin (anti-FLAG) (Fig. 5A). The full-length SnoN was ubiquitinated to some extent in the absence of TAK1, and the level of ubiquitination was increased by co-expression of TAK1 + TAB1. However, the kinase-inactive TAK1(K63W) could not increase the ubiquitination. This suggests that TAK1-dependent phosphorylation of SnoN can trigger its ubiquitination. To verify the role of TAK1-dependent phosphorylation, we used the SnoN mutant lacking the phosphorylation sites SnoN(1–366 AAA). 293 cells were transfected with FLAG-tagged SnoN-(1–366), TAK1, TAB1, and HA-tagged ubiquitin. SnoN-(1–366) was immunoprecipitated with anti-FLAG antibody, and ubiquitinated SnoN-(1–366) was detected by immunoblotting with anti-HA antibody (Fig. 5B). Co-expression of TAK1 and TAB1 resulted in a marked increase in the ubiquitination of SnoN-(1–366). In contrast, SnoN(1–366 AAA) mutant, which lacks major phosphorylation sties, showed almost no ubiquitination under the same conditions. To further investigate the effect of TAK1 phosphorylation on the full-length SnoN, we generated a mutant full-length SnoN carrying the mutation at Ser-115, Ser-117, and/or Thr-119 (SnoN AAA). Although the basal level of ubiquitination was unchanged in the mutant SnoN (SnoN AAA), The TAK1 + TAB1-induced increase of ubiquitination was abrogated in SnoN AAA. These results suggest that phosphorylation of SnoN at Ser-115, Ser-117, and/or Thr-119 by TAK1 is important for SnoN ubiquitination. We next examined the effect of SnoN phosphorylation on its degradation. 293 cells were transfected with SnoN-(1–366), SnoN-(1–366) mutant SnoN-(1–366 AAA), TAK1, and TAB1, and the half-life of SnoN-(1–366) was determined following cycloheximide treatment (Fig. 6A). In the absence of the active TAK1, SnoN-(1–366) was stable and was not significantly degraded until 2 h after the cycloheximide treatment, whereas the half-life was significantly shortened when TAK1 was activated. The SnoN-(1–366 AAA) mutant showed a longer half-life compared with the wild type SnoN-(1–366) in the presence of active TAK1 (TAK1 + TAB1). These results suggest that phosphorylation at Ser-115, Ser-117, and Thr-119 is important for degradation of SnoN. To investigate whether phosphorylation of SnoN was required for TGF-β-induced degradation, we generated HaCaT cells stably expressing SnoN-(1–366), and SnoN-(1–366 AAA) mutant. Whereas SnoN-(1–366) was rapidly decreased in response to TGF-β stimulation, the SnoN-(1–366 AAA) levels decreased slowly compared with the wild type (Fig. 6B). Finally, we tested the TGF-β-induced degradation of the full-length SnoN. We generated HaCaT cells stably expressing SnoN wild type and AAA mutant and examined their levels upon TGF-β treatment (Fig. 6C). We used two independent stable clones that express SnoN or SnoN AAA at different levels. SnoN AAA decreased slowly compared with the wild type SnoN in both clones. These results suggest that TAK1-dependent phosphorylation is important for the TGF-β-induced degradation of SnoN. Our data have demonstrated that mutation of SnoN and SnoN-(1–366) at Ser-115, Ser-117, and Thr-119 reduced TGF-β-induced degradation; however, SnoN AAA and SnoN-(1–366 AAA) were still degraded at 30 min after TGF-β stimulation. This may be consistent with the fact that SnoN-(1–366 AAA) was still phosphorylated to some extent by TAK1 (Fig. 4C). Other phosphorylation sites may participate in SnoN degradation. To examine this possibility, we determined the half-life of SnoN-(1–366 8A) (supplemental Fig. S3C). SnoN-(1–366 8A) was stable even when TAK1 was activated. We also generated HaCaT cells stably expressing SnoN-(1–366 8A) and examined the effect of TGF-β treatment (supplemental Fig. S3D). SnoN-(1–366 8A) was not degraded by TGF-β and was much more stable compared with SnoN-(1–366 AAA). Thus, although Ser-115, Ser-117, and Thr-119 may be major sites of TAK1-dependent phosphorylation, phosphorylation at other sites is likely to participate in the induction of SnoN degradation. SnoN represses TGF-β signaling by recruiting transcriptional repressors to Smad complex (3Wrana J.L. Attisano L. Wieser R. Ventura F. Massague J. Nature. 1994; 370: 341-347Crossref PubMed Scopus (2114) Google Scholar, 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). We next examined whether the phosphorylation of SnoN modulates its transcriptional activity. Transient transfection experiments were performed in 293 cells with a transcriptional reporter, 3TP-lux, which contains TGF-β-responsive elements of the PAI-1 promoter region (29Wrana J.L. Attisano L. Carcamo J. Zentella A. Doody J. Laiho M. Wang X.F. Massague J. Cell. 1992; 71: 1003-1014Abstract Full Text PDF PubMed Scopus (1369) Google Scholar). At 48 h after transfection, cell lysates were prepared, and luciferase activities were measured (supplemental Fig. S2). The constitutively active form of TGF-β receptor ALK5(TD) was sufficient to induce the expression of a TGF-β-responsive gene in 293 cells, and overexpressed full-length SnoN as well as SnoN-(1–366) suppressed the TGF-β-dependent transcription as reported previously (3Wrana J.L. Attisano L. Wieser R. Ventura F. Massague J. Nature. 1994; 370: 341-347Crossref PubMed Scopus (2114) Google Scholar, 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). SnoN-(1–366 AAA and 8A) mutants could also reduce the TGF-β-dependent transcription, suggesting that the mutation does not affect binding to Smads or to transcriptional co-repressors. SnoN-(1–366) mutants may be a more potent inhibitor compared with SnoN-(1–366), because it is stable upon TGF-β stimulation. However, in the transiently transfection experiments, we could not detect the difference between SnoN-(1–366) and SnoN-(1–366 AAA and 8A), which is likely because they were highly expressed and ALK5(TD) could not effectively reduce the amount of SnoN-(1–366). Collectively, our results suggest that SnoN-(1–366 AAA and 8A) can bind to and inhibit Smads but is resistant to TAK1-mediated degradation. Therefore, TAK1 is likely to inhibit SnoN by modulating SnoN stability. In this report, we have determined the role of TAK1 MAP-KKK in TGF-β. Previous works had shown that TAK1 is activated by TGF-β (15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1175) Google Scholar) and that SnoN, an inhibitor of Smads, is degraded upon TGF-β stimulation (13Sun Y. Liu X. Ng-Eaton E. Lodish H.F. Weinberg R.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12442-12447Crossref PubMed Scopus (226) Google Scholar). This study links these two observations and suggests that TAK1 contributes to the induction of TGF-β-responsive genes by inducing the degradation of SnoN (Fig. 7). SnoN has been shown to be the important negative regulator of TGF-β signaling via its interaction with Smad proteins (7Luo K. Curr. Opin. Genet. Dev. 2004; 14: 65-70Crossref PubMed Scopus (177) Google Scholar, 8Sun Y. Liu X. Eaton E.N. Lane W.S. Lodish H.F. Weinberg R.A. Mol. Cell. 1999; 4: 499-509Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar). Upon TGF-β stimulation, SnoN is rapidly degraded by ubiquitin-dependent proteasome pathway (13Sun Y. Liu X. Ng-Eaton E. Lodish H.F. Weinberg R.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12442-12447Crossref PubMed Scopus (226) Google Scholar, 14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). Two ubiquitin ligases are reported as SnoN ubiquitin ligases. One is anaphase-promoting complex, which induces the ubiquitination of SnoN on Lys-440, Lys-446, and Lys-449 and its consequent degradation in a Smad3-dependent manner (11Stroschein S.L. Bonni S. Wrana J.L. Luo K. Genes Dev. 2001; 15: 2822-2836Crossref PubMed Google Scholar, 12Wan Y. Liu X. Kirschner M.W. Mol. Cell. 2001; 8: 1027-1039Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). Another ubiquitin ligase is Smurf2, which is recruited to SnoN by Smad2, resulting in the ubiquitination and degradation of SnoN (10Bonni S. Wang H.R. Causing C.G. Kavsak P. Stroschein S.L. Luo K. Wrana J.L. Nat. Cell Biol. 2001; 3: 587-595Crossref PubMed Scopus (273) Google Scholar). SnoN-(1–366), which lacks sites ubiquitinated by APC or Smurf2, is neither ubiquitinated nor degraded in Ba/F3 pro-B cells (14Stroschein S.L. Wang W. Zhou S. Zhou Q. Luo K. Science. 1999; 286: 771-774Crossref PubMed Scopus (437) Google Scholar). However, we show that TGF-β induces degradation of SnoN-(1–366) in human keratinocyte HaCaT cells in a manner dependent on TAK1-induced phosphorylation and ubiquitination. Mutation of TAK1-dependent phosphorylation sites on SnoN-(1–366) blocked TGF-β-dependent degradation. Moreover, when endogenous TAK1 was inactivated by a small molecule TAK1 inhibitor in keratinocyte HaCaT cells or by siRNA-mediated knockdown in epithelial-like HeLa S3 cells, degradation of endogenous SnoN was impaired. Collectively, these results suggest that TAK1 phosphorylation of SnoN is required for its ubiquitination and degradation in some epithelial cells. These results further suggest that several different pathways induce SnoN degradation, depending on the cell type. Phosphorylation-induced degradation of proteins is a widely used mechanism by which protein levels can be modulated rapidly. We have found that TAK1 phosphorylates SnoN-(1–366) at several threonine and serine residues and that the SnoN mutant, which lacks its phosphorylation sites, did not undergo ubiquitination or degradation. We should note that the mutant SnoN is still capable of inhibiting TGF-β-induced transcription (supplemental Fig. S2). This indicates that the mutations at the phosphorylation sites do not interfere with interaction of SnoN with Smads or with transcriptional co-repressors. TAK1 is likely to inhibit SnoN solely by modulating SnoN stability. TAK1 is the first kinase demonstrated to phosphorylate SnoN and target it for ubiquitin-dependent proteasomal degradation. We thank H. Shibuya for the siRNA vector and R. Smart for discussion. Download .pdf (.59 MB) Help with pdf files}, number={13}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Kajino, Taisuke and Omori, Emily and Ishii, Shunsuke and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2007}, month={Mar}, pages={9475–9481} }
 @article{huangfu_omori_akira_matsumoto_ninomiya-tsuji_2006, title={Osmotic Stress Activates the TAK1-JNK Pathway While Blocking TAK1-mediated NF-κB Activation}, volume={281}, ISSN={0021-9258 1083-351X}, url={http://dx.doi.org/10.1074/JBC.M603627200}, DOI={10.1074/JBC.M603627200}, abstractNote={Osmotic stress activates MAPKs, including JNK and p38, which play important roles in cellular stress responses. Transforming growth factor-β-activated kinase 1 (TAK1) is a member of the MAPK kinase kinase (MAPKKK) family and can activate JNK and p38. TAK1 can also activate IκB kinase (IKK) that leads to degradation of IκB and subsequent NF-κB activation. We found that TAK1 is essential for osmotic stress-induced activation of JNK but is not an exclusive mediator of p38 activation. Furthermore, we found that although TAK1 was highly activated upon osmotic stress, it could not induce degradation of IκB or activation of NF-κB. These results suggest that TAK1 activity is somehow modulated to function specifically in osmotic stress signaling, leading to the activation of JNK but not of IKK. To elucidate the mechanism underlying this modulation, we screened for potential TAK1-binding proteins. We found that TAO2 (thousand-and-one amino acid kinase 2) associates with TAK1 and can inhibit TAK1-mediated activation of NF-κB but not of JNK. We observed that TAO2 can interfere with the interaction between TAK1 and IKK and thus may regulate TAK1 function. TAK1 is activated by many distinct stimuli, including cytokines and stresses, and regulation by TAO2 may be important to activate specific intracellular signaling pathways that are unique to osmotic stress.}, number={39}, journal={Journal of Biological Chemistry}, publisher={American Society for Biochemistry & Molecular Biology (ASBMB)}, author={HuangFu, Wei-Chun and Omori, Emily and Akira, Shizuo and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2006}, month={Aug}, pages={28802–28810} }
 @article{huangfu_omori_akira_matsumoto_ninomiya-tsuji_2006, title={Osmotic stress activates the TAK1-JNK pathway while blocking TAK1-mediated NF-kappa B activation - TAO2 regulates TAK1 pathways}, volume={281}, DOI={10.1014/jbc.M60362/200}, number={39}, journal={Journal of Biological Chemistry}, author={Huangfu, W. C. and Omori, E. and Akira, S. and Matsumoto, K. and Ninomiya-Tsuji, J.}, year={2006}, pages={28802–28810} }
 @article{kajino_ren_iemura_natsume_stefansson_brautigan_matsumoto_ninomiya-tsuji_2006, title={Protein phosphatase 6 down-regulates TAK1 kinase activation in the IL-1 signaling pathway}, volume={281}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M608155200}, abstractNote={TAK1 (transforming growth factor β-activated kinase 1) is a serine/threonine kinase that is a mitogen-activated protein kinase kinase kinase and an essential intracellular signaling component in inflammatory signaling pathways. Upon stimulation of cells with inflammatory cytokines, TAK1 binds proteins that stimulate autophosphorylation within its activation loop and is thereby catalytically activated. This activation is transient; it peaks within a couple of minutes and is subsequently down-regulated rapidly to basal levels. The mechanism of down-regulation of TAK1 has not yet been elucidated. In this study, we found that toxin inhibition of type 2A protein phosphatases greatly enhances interleukin 1 (IL-1)-dependent phosphorylation of Thr-187 in the TAK1 activation loop as well as the catalytic activity of TAK1. From proteomic analysis of TAK1-binding proteins, we identified protein phosphatase 6 (PP6), a type-2A phosphatase, and demonstrated that PP6 associated with and inactivated TAK1 by dephosphorylation of Thr-187. Ectopic and endogenous PP6 co-precipitated with TAK1, and expression of PP6 reduced IL-1 activation of TAK1 but did not affect osmotic activation of MLK3, another MAPKKK. Reduction of PP6 expression by small interfering RNA enhances IL-1-induced phosphorylation of Thr-187 in TAK1. Enhancement occurred without change in levels of PP2A showing specificity for PP6. Our results demonstrate that PP6 specifically down-regulates TAK1 through dephosphorylation of Thr-187 in the activation loop, which is likely important for suppressing inflammatory responses via TAK1 signaling pathways. TAK1 (transforming growth factor β-activated kinase 1) is a serine/threonine kinase that is a mitogen-activated protein kinase kinase kinase and an essential intracellular signaling component in inflammatory signaling pathways. Upon stimulation of cells with inflammatory cytokines, TAK1 binds proteins that stimulate autophosphorylation within its activation loop and is thereby catalytically activated. This activation is transient; it peaks within a couple of minutes and is subsequently down-regulated rapidly to basal levels. The mechanism of down-regulation of TAK1 has not yet been elucidated. In this study, we found that toxin inhibition of type 2A protein phosphatases greatly enhances interleukin 1 (IL-1)-dependent phosphorylation of Thr-187 in the TAK1 activation loop as well as the catalytic activity of TAK1. From proteomic analysis of TAK1-binding proteins, we identified protein phosphatase 6 (PP6), a type-2A phosphatase, and demonstrated that PP6 associated with and inactivated TAK1 by dephosphorylation of Thr-187. Ectopic and endogenous PP6 co-precipitated with TAK1, and expression of PP6 reduced IL-1 activation of TAK1 but did not affect osmotic activation of MLK3, another MAPKKK. Reduction of PP6 expression by small interfering RNA enhances IL-1-induced phosphorylation of Thr-187 in TAK1. Enhancement occurred without change in levels of PP2A showing specificity for PP6. Our results demonstrate that PP6 specifically down-regulates TAK1 through dephosphorylation of Thr-187 in the activation loop, which is likely important for suppressing inflammatory responses via TAK1 signaling pathways. TAK1 2The abbreviations used are: TAK1, transforming growth factor β-activated kinase 1; MAPKKK, mitogen-activated protein kinase kinase kinase; IL-1, interleukin-1; TAB1, TAK1-binding protein 1; JNK, c-Jun N-terminal kinase; PP6, protein phosphatase 6; PP2A, type 2A protein phosphatase; OA, okadaic acid; MLK, mixed lineage protein kinase 3; siRNA, small interfering RNA; TRAF, tumor necrosis factor receptor-associated factor; HA, hemagglutinin. 2The abbreviations used are: TAK1, transforming growth factor β-activated kinase 1; MAPKKK, mitogen-activated protein kinase kinase kinase; IL-1, interleukin-1; TAB1, TAK1-binding protein 1; JNK, c-Jun N-terminal kinase; PP6, protein phosphatase 6; PP2A, type 2A protein phosphatase; OA, okadaic acid; MLK, mixed lineage protein kinase 3; siRNA, small interfering RNA; TRAF, tumor necrosis factor receptor-associated factor; HA, hemagglutinin. (transforming growth factor β-activated kinase 1) is a member of the mitogen-activated protein kinase kinase kinase (MAPKKK) family and is activated not only by transforming growth factor β but also by proinflammatory cytokines including interleukin-1 (IL-1) and tumor necrosis factor (1Akira S. Takeda K. Nat. Rev. Immunol. 2004; 4: 499-511Crossref PubMed Scopus (6669) Google Scholar, 2Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar, 3Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1174) Google Scholar). Genetic studies using TAK1-deficient cells have demonstrated that TAK1 is an indispensable signaling intermediate in tumor necrosis factor and IL-1 signaling pathways (4Shim J.-H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.-Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (589) Google Scholar, 5Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (752) Google Scholar, 6Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). In the proinflammatory signaling pathways, TAK1 is activated through ligand-dependent assembly of a TAK1 signaling complex containing tumor necrosis factor receptor-associated factor (TRAF) TAK1 binding partners, TAK1-binding proteins 1, 2, and 3 (TAB1, TAB2, and TAB3) (2Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar, 4Shim J.-H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.-Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (589) Google Scholar, 5Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (752) Google Scholar, 6Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar, 7Ishitani T. Takaesu G. Ninomiya-Tsuji J. Shibuya H. Gaynor R.B. Matsumoto K. EMBO J. 2003; 22: 6277-6288Crossref PubMed Scopus (219) Google Scholar, 8Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar, 9Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (519) Google Scholar, 10Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar, 11Cheung P.C. Nebreda A.R. Cohen P. Biochem. J. 2004; 378: 27-34Crossref PubMed Scopus (134) Google Scholar, 12Kanayama A. Seth R.B. Sun L. Ea C.K. Hong M. Shaito A. Chiu Y.H. Deng L. Chen Z.J. Mol. Cell. 2004; 15: 535-548Abstract Full Text Full Text PDF PubMed Scopus (697) Google Scholar, 13Jin G. Klika A. Callahan M. Faga B. Danzig J. Jiang Z. Li X. Stark G.R. Harrington J. Sherf B. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2028-2033Crossref PubMed Scopus (69) Google Scholar). TAK1, in turn, stimulates two downstream pathways; one is the MAPK cascades to activate c-Jun N-terminal kinase (JNK) and p38 MAPK, and the other is the IκB kinase pathway ultimately leading to NF-κB activation (2Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar, 4Shim J.-H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.-Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (589) Google Scholar, 5Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (752) Google Scholar, 14Cheung P.C. Campbell D.G. Nebreda A.R. Cohen P. EMBO J. 2003; 22: 5793-5805Crossref PubMed Scopus (238) Google Scholar). Many kinases are phosphorylated in the kinase activation loop located between the conserved sequence DFG of kinase subdomain VII and APE of kinase subdomain VIII (15Johnson L.N. Noble M.E. Owen D.J. Cell. 1996; 85: 149-158Abstract Full Text Full Text PDF PubMed Scopus (1172) Google Scholar). The activation loop is important for substrate recognition, and phosphorylation in this segment is required to allow correct alignment of the substrates to the catalytic site. In many cases, phosphorylation within the activation loop is mediated by upstream kinases in the kinase cascades (16Pearson G. Robinson F. Beers Gibson T. Xu B.E. Karandikar M. Berman K. Cobb M.H. Endocr. Rev. 2001; 22: 153-183Crossref PubMed Scopus (3528) Google Scholar). However, in some kinases, autophosphorylation occurs in this segment following stimuli-dependent conformational change (17Deak J.C. Templeton D.J. Biochem. J. 1997; 322: 185-192Crossref PubMed Scopus (61) Google Scholar, 18Leung I.W. Lassam N. J. Biol. Chem. 2001; 276: 1961-1967Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 19Posas F. Saito H. EMBO J. 1998; 17: 1385-1394Crossref PubMed Scopus (250) Google Scholar, 20Siow Y.L. Kalmar G.B. Sanghera J.S. Tai G. Oh S.S. Pelech S.L. J. Biol. Chem. 1997; 272: 7586-7594Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). The kinase activation loop of TAK1 contains phosphorylation sites at Thr-184, Thr-187, and Ser-192. Unphosphorylatable amino acid substitutions of any of these residues abolish the catalytic activity of TAK1 (8Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar, 21Sakurai H. Miyoshi H. Mizukami J. Sugita T. FEBS Lett. 2000; 474: 141-145Crossref PubMed Scopus (141) Google Scholar). Proinflammatory cytokines increase phosphorylation of TAK1 within the activation loop (8Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar, 21Sakurai H. Miyoshi H. Mizukami J. Sugita T. FEBS Lett. 2000; 474: 141-145Crossref PubMed Scopus (141) Google Scholar). Catalytic activity of TAK1 is required for this phosphorylation, suggesting that TAK1 autophosphorylates its activation loop. Upon cytokine stimulation, TAK1 autophosphorylation is induced presumably through the conformational change due to assembly of the signaling complex, which converts TAK1 into a catalytically active form. Among the phosphorylation sites in the TAK1 activation loop, it has so far been established that phosphorylation at Thr-187 correlates with activation of TAK1 (22Singhirunnusorn P. Suzuki S. Kawasaki N. Saiki I. Sakurai H. J. Biol. Chem. 2005; 280: 7359-7368Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). TAK1 is activated in a transient manner (23Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (159) Google Scholar). IL-1 activates TAK1 within 1–2 min, and the activation peaks at 3–5 min and declines to the basal levels within 15–30 min after stimulation. Although TAK1 activation has been determined to some extent as described above, the mechanism by which TAK1 is down-regulated remains largely unknown. In general, the level of protein phosphorylation is controlled by the balanced activities of protein kinases and protein phosphatases. Indeed, TAK1 activity is known to be regulated by protein phosphatase PP2C family members in the unstimulated state (24Hanada M. Ninomiya-Tsuji J. Komaki K.-I. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 25Li M.G. Katsura K. Nomiyama H. Komaki K.-I. Ninomiya-Tsuji J. Matsumoto K. Kobayashi T. Tamura S. J. Biol. Chem. 2003; 278: 12013-12021Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). In this study, we found that inhibition of type 2A protein phosphatases results in hyperphosphorylation and hyperactivation of TAK1 in response to IL-1 stimulation. The protein Ser/Thr phosphatase family comprises the type 1 and type 2A phosphatases, and these are the major protein phosphatases that play an important role in the regulation of cell growth and a diverse set of cellular proteins, including metabolic enzymes, ion channels, hormone receptors, and kinase cascades (26Janssens V. Goris J. Biochem. J. 2001; 353: 417-439Crossref PubMed Scopus (1532) Google Scholar). Protein phosphatase 4 (PP4) and protein phosphatase 6 (PP6) have been identified as novel phosphatases and have been classified as type 2A phosphatase family members based on their sequence homology (27Bastians H. Ponstingl H. J. Cell Sci. 1996; 109: 2865-2874PubMed Google Scholar, 28Brewis N.D. Street A.J. Prescott A.R. Cohen P.T. EMBO J. 1993; 12: 987-996Crossref PubMed Scopus (199) Google Scholar, 29Cohen P.T. Trends Biochem. Sci. 1997; 22: 245-251Abstract Full Text PDF PubMed Scopus (458) Google Scholar). However, relative to PP2A, much less is known about the functions of PP4 and PP6. Recently, PP6 has been implicated in opposing NF-κB activation by control of IκBϵ degradation (30Stefansson B. Brautigan D.L. J. Biol. Chem.,. 2006; 281: 22624-22634Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). We here found that TAK1 associates with PP6 and that PP6 dephosphorylates and inactivates TAK1. We also show that reduction of PP6 expression increases phosphorylation of IL-1-induced TAK1. Our results suggest that PP6 is a negative regulator of TAK1. Chemicals, Plasmids, and Antibodies—Tautomysin, okadaic acid, cyclosporin A, and calculin A were purchased from Calbiochem. Recombinant human IL-1β was purchased from Roche Applied Science. The mammalian expression vectors for HA-tagged TAK1 (HA-TAK1), FLAG-tagged TAK1 (FLAG-TAK1), and TAB1 have been described previously (2Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar, 10Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar, 23Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (159) Google Scholar). A catalytically inactive version of PP6, PP6-D84N, was prepared by QuikChange (Stratagene) according to the manufacturer's instruction. Anti-phospho-TAK1 (Thr-187) antibody (Cell Signaling), anti-TAK1 antibody (2Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar), anti-HA monoclonal antibody 16B12 (Covance), anti-FLAG monoclonal antibody M2 (Sigma), anti-mixed lineage protein kinase 3 (MLK3), antiphospho-MLK3 (Thr-277/Ser-281) (Cell Signaling), anti-PP2A (Santa Cruz), anti-PP6 antibody (Sigma), and anti-β-catenin (BD Biosciences) were used. Cell Cultures—293 cells, 293 IL-1RI cells, were cultured in Dulbecco's modified Eagle's medium plus 10% bovine growth serum (HyClone) or fetal bovine serum. Transfection of 293 cells was carried out according to the calcium phosphate precipitation method. siRNAs—siRNAs targeted against human PP6 were purchased from Dharmacon Inc. Two siRNA against the sequences PP6–1 (47GCA AGT ACC TGC CAG AGA A65) and PP6–2 (893GAA CGA CAA CGC CAT ATT T911) were used. A pool of three siRNAs for human PP2A was purchased from B-Bridge, (target sequences 333CAC CAT TCT TCG AGG GAA T351, 663GCA AGA TAT TTC TGA GAC A681, and 3′ untranslated region GGA AAT GGG AAG AGC AAC A). Control siRNA against unrelated nucleotide sequence was purchased from Ambion (Silencer negative Control 1 siRNA). The siRNA duplexes were transfected into 293 IL-1R cells using Oligofectamine reagent (Invitrogen). Cells were incubated in 30% fetal bovine serum for 48 h post-transfection and then stimulated with IL-1. Immunoprecipitation and Immunoblotting—Whole cell extracts were prepared in lysis buffer (20 mm HEPES, pH 7.4, 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mm MgCl2, 2 mm EGTA, 10 mm NaF, 2 mm dithiothreitol, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 20 μm aprotinin, 0.5% Triton X-100). Proteins from these cell lysates were immunoprecipitated with 1 μg of various antibodies and 15 μl of protein G-Sepharose (GE Healthcare). The immune complexes were washed three times with wash buffer containing 20 mm HEPES, pH 7.4, 500 mm NaCl, and 10 mm MgCl2 and once with rinse buffer containing 20 mm HEPES, pH 7.4, 150 mm NaCl, and 10 mm MgCl2 and suspended in 30 μl of rinse buffer. For immunoblotting, the immunoprecipitates or cell lysates were resolved on SDS-PAGE and transferred to Hybond-P membranes (GE Healthcare). The membranes were immunoblotted with various antibodies, and bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against rabbit or mouse IgG using the ECL Western blotting system (GE Healthcare) or SuperSignal West Femto sensitivity substrate (Pierce). In Vitro Kinase Assay—Immunoprecipitates were incubated with 1 μg of bacterially expressed MKK6 in 10 μl of kinase buffer containing 10 mm HEPES, pH 7.4, 1 mm dithiothreitol, 5 mm MgCl2, and 5 μCi of [γ-32P]ATP (3,000 Ci/mmol) at 25 °C for 2 min. Samples were fractionated by 10% SDS-PAGE and visualized by autoradiography. In Vitro Dephosphorylation Assay—Purified PP2A was purchased from Millipore/Upstate. HA-TAK1 was activated by co-expression of TAB1 in 293 cells and was immunoprecipitated with anti-HA, incubated with the purified PP2A for 30 min at 30 °C. Inhibition of Type 2A Phosphatase Activity Increases IL-1-induced Phosphorylation of TAK1—TAK1 is activated through its autophosphorylation within the activation loop induced by binding of proteins such as TAB1, TAB2, and TRAFs and is rapidly down-regulated (8Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar, 22Singhirunnusorn P. Suzuki S. Kawasaki N. Saiki I. Sakurai H. J. Biol. Chem. 2005; 280: 7359-7368Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar, 23Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (159) Google Scholar). The mechanism by which TAK1 is down-regulated has not yet been elucidated, but it is likely to involve protein phosphatases. Indeed, both TAK1 phosphorylation and activation are regulated by PP2C family (also known as MPP) phosphatases, which participate in silencing TAK1 basal activity in the unstimulated state (24Hanada M. Ninomiya-Tsuji J. Komaki K.-I. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 25Li M.G. Katsura K. Nomiyama H. Komaki K.-I. Ninomiya-Tsuji J. Matsumoto K. Kobayashi T. Tamura S. J. Biol. Chem. 2003; 278: 12013-12021Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). To further address which protein phosphatases reverse stimuli-induced TAK1 activation, we examined the effects of protein phosphatase inhibitors on IL-1-induced TAK1 phosphorylation. The 293 IL-1RI cell line, which stably expresses IL-1 receptor, was stimulated by IL-1 in the presence or absence of different phosphatase inhibitors: 1) tautomycin, an inhibitor of PP1; 2) okadaic acid (OA), an inhibitor of the PP2A family; 3) cyclosporin A, an inhibitor of PP2B; or 4) calyculin A, an inhibitor of both the PP1 and the PP2A families (Fig. 1). Although OA can inhibit both PP1 and PP2A at high concentrations, OA at the concentration of 100 nm was used for relatively selective inhibition of the PP2A family (31Honkanen R.E. Golden T. Curr. Med. Chem. 2002; 9: 2055-2075Crossref PubMed Scopus (230) Google Scholar). Upon IL-1 treatment TAK1 was autophosphorylated and it migrated more slowly than unstimulated TAK1 on SDS-PAGE (Fig. 1, upper panel) as described previously (8Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). Phosphorylation of TAK1 in the activation loop was monitored by immunoblotting with a phospho-specific antibody that recognized phosphorylated TAK1 at Thr-187 (anti-P-Thr-187) (Fig. 1, lower panel). IL-1-induced phosphorylation at Thr-187 was barely detected without phosphatase inhibitor, but either OA or calyculin A greatly enhanced the IL-1-dependent phosphorylation at Thr-187 and showed a large mobility shift of TAK1 on SDS-PAGE. In contrast, neither tautomycin nor cyclosporine A enhanced the TAK1 phosphorylation at Thr-187 or altered mobility in SDS-PAGE. These results suggest that inhibition of the PP2A family enhances the phosphorylation of TAK1 at Thr-187. To assess the role of PP2A family members on TAK1, we used 100 nm OA for the subsequent experiments. Inhibition of the PP2A Family Increases IL-1-induced Activation of TAK1—We examined the kinetics of TAK1 activation in the absence and presence of OA (Fig. 2). Catalytic activity of TAK1 was measured using MKK6 as a specific substrate. IL-1 addition to cells stimulated TAK1 activity at 0.5 and 1.0 min, and the activity declined rapidly thereafter, returning to basal by 5 min. Addition of OA significantly enhanced IL-1-dependent activation of TAK1. The peak levels of TAK1 catalytic activity were greatly increased, and the activity peaked at 2 min and was sustained longer (>5 min) compared with that in OA-untreated cells. The phosphorylation of TAK1 at Thr-187 enhanced by OA was correlated with the kinetics of OA-induced TAK1 activation. These data demonstrate that inhibition of PP2A family phosphatases by OA enhances IL-1-dependent phosphorylation and activation of TAK1. PP2A Can Dephosphorylate and Inactivate TAK1 in Vitro—Upon cell stimulation, TAK1 binds to the TRAF6-containing complex and autophosphorylates Thr-187 in the activation loop, thereby activating its catalytic activity (8Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). Therefore, we speculate that a PP2A family phosphatase may down-regulate TAK1 by dephosphorylating Thr-187 in the TAK1 activation loop. We examined whether PP2A could directly dephosphorylate Thr-187 and inactivate TAK1. We isolated an active form of TAK1 from cells co-expressing TAK1 together with its activator subunit TAB1. Ectopically expressed TAB1 induces autophosphorylation of TAK1 at the activation loop, as does treatment of cells with IL-1 (8Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). The activated TAK1 was immunoprecipitated and incubated with purified PP2A (Fig. 3). PP2A dephosphorylated Thr-187 in the TAK1 activation loop and inactivated TAK1. Collectively, these results suggest that a PP2A family phosphatase negatively regulates TAK1 by dephosphorylating Thr-187 in the activation loop of TAK1. PP6 Interacts with TAK1—To identify the TAK1 endogenous phosphatase, we immunoprecipitated FLAG-tagged TAK1 from transiently transfected cells. The immunocomplex was digested, and the peptides were analyzed by using a nano-scale liquid chromatography system with collision-induced dissociation tandem mass spectrometry (32Natsume T. Yamauchi Y. Nakayama H. Shinkawa T. Yanagida M. Takahashi N. Isobe T. Anal. Chem. 2002; 74: 4725-4733Crossref PubMed Scopus (181) Google Scholar). Several peptides were found to correspond to TAB1. One peptide yielded the sequence YGNANAWRYCTK, and it corresponded to protein phosphatase 6 (PP6) catalytic subunit. To confirm the interaction of TAK1 with PP6, we conducted the immunoprecipitation assay (Fig. 4A). FLAG-TAK1 and HA-tagged PP6 catalytic subunit (HA-PP6) were co-expressed in 293 cells. FLAG-TAK1 co-precipitated with HA-PP6, and the interaction was confirmed by the reciprocal anti-HA immunoprecipitation. We asked whether stimulation of TAK1 and the catalytic activity of PP6 affect the interaction. We co-expressed FLAG-TAK1 with HA-PP6 wild type and a catalytically inactive form of PP6 (PP6-D84N) in 293 IL-1RI cells and treated cells with IL-1 (Fig. 4B). TAK1 associated with PP6 independent of catalytic activity of PP6. The interaction was not altered by IL-1 stimulation. These results suggest that PP6 is a constitutive binding partner of TAK1 with or without IL-1 stimulation. To verify the physiological TAK1-PP6 interaction, we examined whether endogenous TAK1 associated with PP6. Cell extracts from cells treated with or without IL-1 were prepared and endogenous TAK1 was immunoprecipitated (Fig. 4C). PP6 was co-precipitated with TAK1 with and without IL-1 stimulation of cells. This indicated that endogenous PP6 interacts with TAK1. PP6 Dephosphorylates and Inactivates TAK1—We examined whether PP6 can dephosphorylate TAK1. PP6 wild type or catalytically inactive form of PP6 was overexpressed in 293 IL-1RI cells, and cells were stimulated with IL-1. The phosphorylation of TAK1 was monitored by anti-P-Thr-187 antibody (Fig. 5A). We found that increased expression of PP6 reduced IL-1-dependent phosphorylation at Thr-187 of TAK1. To determine whether PP6 action is specific to TAK1 among the family members of MAPKKKs, we examined the effect of PP6 overexpression on osmotic stress-induced MLK3 activation. MLK3 is phosphorylated and activated upon osmotic stress. 293 cells were treated with 0.5 m sorbitol, and the phosphorylated form of MLK3 was detected with a phospho-specific MLK3 antibody (Fig. 5B). Ectopic expression of PP6 did not alter the phosphorylation status of MLK3. We examined whether PP6 levels affected regulation of TAK1. We tested down-regulation of PP6 by siRNA in IL-1-induced activation of TAK1. Different siRNAs (PP6-1 and PP6-2) targeted against two sequences in human PP6 were used. The synthetic siRNA duplexes were transfected into 293 IL-1RI cells, and the reduction of PP6 expression was monitored by immunoblotting of PP6 (Fig. 6A). Both siRNAs resulted in a 60–80% decrease in the level of PP6 protein. Specificity of these siRNAs was confirmed by showing no change in the protein levels of PP2A and the unrelated protein β-catenin. Knock down of PP6 led to an increased phosphorylation of Thr-187 TAK1 in IL-1-stimulated cells (Fig. 6B). In contrast, siRNAs targeted against PP2A did not alter the phosphorylation of Thr-187 of TAK1 (Fig. 6C). These results confirm that PP6 is the negative regulator of TAK1 activation by IL-1 stimulation. TAK1 is an essential intermediate of IL-1 signaling pathway, and it is activated following association with the TRAF6-containing complex. This binding presumably alters TAK1 conformation and thereby induces autophosphorylation within the activation loop at Thr-187. TAK1 is in turn catalytically activated at 0.5–3 min after IL-1 stimulation. This activation is rapidly down-regulated. The mechanism of TAK1 down-regulation has not yet been defined. There are several possible mechanisms to reduce the TAK1 activity: 1) dissociation of TAK1 from the TRAF6-containing complex; 2) modification of TAK1 itself or its regulatory subunits; and 3) dephosphorylation of Thr-187 in the activation loop. We have previously reported that TAK1 is dissociated from the TRAF6-complex 10–30 min after IL-1 stimulation (23Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (159) Google Scholar). This dissociation is likely to convert TAK1 conformation from active to the inactive state and thereby blocks further autophosphorylation of TAK1. Cheung et al. (14Cheung P.C. Campbell D.G. Nebreda A.R. Cohen P. EMBO J. 2003; 22: 5793-5805Crossref PubMed Scopus (238) Google Scholar) have proposed that p38 MAPK is involved in negative regulation of TAK1. p38 is activated through TAK1 pathway in response to IL-1 stimulation. They have shown that p38 phosphorylates the TAK1 activator subunit TAB1, resulting in inactivation of TAK1 in a negative feedback loop. This modification serves to inhibit catalytically active (autophosphorylated) forms of TAK1, which may enhance the down-regulation of TAK1. We show here that PP6 interacts with TAK1, dephosphorylates Thr-187 in the activation loop of TAK1, and inactivates TAK1. Furthermore, our knock down of PP6 demonstrated that PP6 is an essential negative regulator of TAK1 activation. Therefore, TAK1 is down-regulated through several distinct mechanisms and PP6-mediated direct dephosphorylation of Thr-187 is one of the major mechanisms to inactivate TAK1. Both PP2C and PP6 can dephosphorylate and inactivate TAK1. The dephosphorylation site(s) by PP2C has not yet been defined. However, because TAK1 activity is dependent on phosphorylation at Thr-184, Thr-187, and Ser-192 within its activation loop, it is possible that both PP6 and PP2C dephosphorylate those sites. Whereas PP6 constitutively associates with TAK1, PP2C is found to dissociate from TAK1 upon IL-1 stimulation (25Li M.G. Katsura K. Nomiyama H. Komaki K.-I. Ninomiya-Tsuji J. Matsumoto K. Kobayashi T. Tamura S. J. Biol. Chem. 2003; 278: 12013-12021Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar), which suggests that PP2C functions to inhibit the TAK1 activity in the unstimulated state and releasing PP2C from the TAK1 complex may participate in TAK1 activation. In contrast, in this study we found that knock down of PP6 only affects IL-1-stimulted activation of TAK1 but it does not alter basal TAK1 activity seen without IL-1 stimulation. Therefore, PP6 is primarily involved in down-regulation of activated forms of TAK1 generated upon stimulation. Collectively, both PP6 and PP2C regulate TAK1 activity by dephosphorylation, but they seem to function on different forms of TAK1. Genetic studies using a mouse model have revealed that TAK1 plays a non-redundant role in innate immune responses as well as adaptive immunity in vivo (4Shim J.-H. Xiao C. Paschal A.E. Bailey S.T. Rao P. Hayden M.S. Lee K.-Y. Bussey C. Steckel M. Tanaka N. Yamada G. Akira S. Matsumoto K. Ghosh S. Genes Dev. 2005; 19: 2668-2681Crossref PubMed Scopus (589) Google Scholar, 5Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takeuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (752) Google Scholar, 6Omori E. Matsumoto K. Sanjo H. Sato S. Akira S. Smart R.C. Ninomiya-Tsuji J. J. Biol. Chem. 2006; 281: 19610-19617Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). TAK1 is a master regulator of both NF-κB and JNK, which are major pathways to control inflammation. Because TAK1 plays such a key role in intracellular signaling to activate inflammation, the effective down-regulation of TAK1 following the stimuli-dependent rapid activation is important to prevent excessive immune responses. Dysregulation of inflammation is implicated in pathogenesis of many chronic diseases, such as psoriasis, rheumatoid arthritis, inflammatory bowel disease, and asthma. Furthermore, the chronic inflammation often associates with tumor development (33Coussens L.M. Werb Z. Nature. 2002; 420: 860-867Crossref PubMed Scopus (11188) Google Scholar). Elucidation of the mechanism of TAK1 down-regulation is essential for better understanding of the regulatory mechanism of inflammation. In this study, we demonstrated that PP6 is a potent negative regulator of TAK1 in a physiological setting. PP6 is likely to play a role that regulates inflammatory signaling in vivo, and hence PP6 may be a potential novel target for pharmacological therapy of inflammatory diseases as well as inflammation-associated tumors. We thank S. Tamura for discussion.}, number={52}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Kajino, Taisuke and Ren, Hong and Iemura, Shun-ichiro and Natsume, Tohru and Stefansson, Bjarki and Brautigan, David L. and Matsumoto, Kunihiro and Ninomiya-Tsuji, Jun}, year={2006}, month={Dec}, pages={39891–39896} }
 @article{uemura_kajino_sanjo_sato_akira_matsumoto_ninomiya-tsuji_2006, title={TAK1 is a component of the Epstein-Barr virus LMP1 complex and is essential for activation of JNK but not of NF-kappa B}, volume={281}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M509834200}, abstractNote={Epstein-Barr virus latent membrane protein 1 (LMP1) activates NF-κB and c-Jun N-terminal kinase (JNK), which is essential for LMP1 oncogenic activity. Genetic analysis has revealed that tumor necrosis factor receptor-associated factor 6 (TRAF6) is an indispensable intermediate of LMP1 signaling leading to activation of both NF-κB and JNK. However, the mechanism by which LMP1 engages TRAF6 for activation of NF-κB and JNK is not well understood. Here we demonstrate that TAK1 mitogen-activated protein kinase kinase kinase and TAK1-binding protein 2 (TAB2), together with TRAF6, are recruited to LMP1 through its N-terminal transmembrane region. The C-terminal cytoplasmic region of LMP1 facilitates the assembly of this complex and enhances activation of JNK. In contrast, IκB kinase γ is recruited through the C-terminal cytoplasmic region and this is essential for activation of NF-κB. Furthermore, we found that ablation of TAK1 resulted in the loss of LMP1-induced activation of JNK but not of NF-κB. These results suggest that an LMP1-associated complex containing TRAF6, TAB2, and TAK1 plays an essential role in the activation of JNK. However, TAK1 is not an exclusive intermediate for NF-κB activation in LMP1 signaling. Epstein-Barr virus latent membrane protein 1 (LMP1) activates NF-κB and c-Jun N-terminal kinase (JNK), which is essential for LMP1 oncogenic activity. Genetic analysis has revealed that tumor necrosis factor receptor-associated factor 6 (TRAF6) is an indispensable intermediate of LMP1 signaling leading to activation of both NF-κB and JNK. However, the mechanism by which LMP1 engages TRAF6 for activation of NF-κB and JNK is not well understood. Here we demonstrate that TAK1 mitogen-activated protein kinase kinase kinase and TAK1-binding protein 2 (TAB2), together with TRAF6, are recruited to LMP1 through its N-terminal transmembrane region. The C-terminal cytoplasmic region of LMP1 facilitates the assembly of this complex and enhances activation of JNK. In contrast, IκB kinase γ is recruited through the C-terminal cytoplasmic region and this is essential for activation of NF-κB. Furthermore, we found that ablation of TAK1 resulted in the loss of LMP1-induced activation of JNK but not of NF-κB. These results suggest that an LMP1-associated complex containing TRAF6, TAB2, and TAK1 plays an essential role in the activation of JNK. However, TAK1 is not an exclusive intermediate for NF-κB activation in LMP1 signaling. Persistent latent infection with Epstein-Barr virus (EBV), 2The abbreviations used are: EBV, Epstein-Barr virus; LMP1, latent membrane protein 1; JNK, c-Jun N-terminal kinase; TRAF, tumor necrosis factor receptor-associated factor; TNF, tumor necrosis factor; TGF-β, transforming growth factor β; TAK1, TGF-β-activated kinase 1; TAB, TAK1-binding protein; IKK, IκB kinase; CTAR, C-terminal activator region; TRADD, TNF receptor-associated death domain protein; IL-1, interleukin 1; RANK, receptor activator of NF-κB; NIK, NF-κB-inducing kinase; MEF, mouse embryonic fibroblast; siRNA, small interfering RNA; Flag-TfR, Flag-tagged transferrin receptor; MAPKKK, mitogen-activated protein kinase kinase kinase; DTT, dithiothreitol; HA, hemagglutinin; WT, wild type. 2The abbreviations used are: EBV, Epstein-Barr virus; LMP1, latent membrane protein 1; JNK, c-Jun N-terminal kinase; TRAF, tumor necrosis factor receptor-associated factor; TNF, tumor necrosis factor; TGF-β, transforming growth factor β; TAK1, TGF-β-activated kinase 1; TAB, TAK1-binding protein; IKK, IκB kinase; CTAR, C-terminal activator region; TRADD, TNF receptor-associated death domain protein; IL-1, interleukin 1; RANK, receptor activator of NF-κB; NIK, NF-κB-inducing kinase; MEF, mouse embryonic fibroblast; siRNA, small interfering RNA; Flag-TfR, Flag-tagged transferrin receptor; MAPKKK, mitogen-activated protein kinase kinase kinase; DTT, dithiothreitol; HA, hemagglutinin; WT, wild type. a γ herpes virus that is classified as a human DNA tumor virus, is widespread in the human population and can cause the development of malignancies such as Hodgkin's lymphoma, Burkitt's lymphoma, and nasopharyngel carcinoma. The latent membrane protein 1 (LMP1) is an oncoprotein encoded by EBV and is critically involved in the effective immortalization and proliferation of B-cells latently infected by EBV (1Farrell P.J. Trends Microbiol. 1995; 3: 105-109Abstract Full Text PDF PubMed Scopus (74) Google Scholar, 2Klein G. Cell. 1994; 77: 791-793Abstract Full Text PDF PubMed Scopus (229) Google Scholar, 3Rickinson A. Kieff E. Fields Virology.in: Howley P.M. Knipe D. Lippincott, Philadelphia2001: 2575-2627Google Scholar). LMP1 is a transmembrane protein of 386 amino acids containing a short N-terminal cytoplasmic domain of 24 amino acids, six transmembrane-spanning domains, and a C-terminal cytoplasmic tail of 200 amino acids (Fig. 1A). LMP1 mimics a constitutively activated tumor necrosis factor (TNF) receptor-like molecule, in the absence of ligand binding (4Cahir-McFarland E.D. Izumi K.M. Mosialos G. Oncogene. 1999; 18: 6959-6964Crossref PubMed Scopus (140) Google Scholar, 5Lam N. Sugden B. Cell. Signal. 2003; 15: 9-16Crossref PubMed Scopus (101) Google Scholar). The transmembrane domains of LMP1 mediate spontaneous autoaggregation within plasma membrane, and this aggregation is a prerequisite for LMP1 function (6Coffin W.F. II I Geiger T.R. Martin J.M. J. Virol. 2003; 77: 3749-3758Crossref PubMed Scopus (42) Google Scholar, 7Yasui T. Luftig M. Soni V. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 278-283Crossref PubMed Scopus (58) Google Scholar). Previous studies have identified two domains in the LMP1 C-terminal cytoplasmic tail, called the C-terminal activator regions (CTARs) 1 (amino acids 194–231) and 2 (amino acids 332–386), that are important for the cell transformation activity of LMP1 (4Cahir-McFarland E.D. Izumi K.M. Mosialos G. Oncogene. 1999; 18: 6959-6964Crossref PubMed Scopus (140) Google Scholar, 5Lam N. Sugden B. Cell. Signal. 2003; 15: 9-16Crossref PubMed Scopus (101) Google Scholar, 8Eliopoulos A.G. Young L.S. Semin. Cancer Biol. 2001; 11: 435-444Crossref PubMed Scopus (186) Google Scholar). Both CTAR1 and CTAR2 participate in the activation of the transcription factor NF-κB. CTAR1 binds to several TNF receptor-associated factors (TRAFs), TRAF1, -2, -3, and -5, through a consensus TRAF-binding motif, while CTAR2 has been shown to bind to the TNF receptor-associated death domain protein (TRADD). However, experiments using gene knock-out and small interfering RNA (siRNA) treatment have determined that neither TRAF2, TRAF5, nor TRADD is essential for LMP1 signaling (9Luftig M. Prinarakis E. Yasui T. Tsichritzis T. Cahir-McFarland E. Inoue J. Nakano H. Mak T.W. Yeh W.C. Li X. Akira S. Suzuki N. Suzuki S. Mosialos G. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 15595-15600Crossref PubMed Scopus (110) Google Scholar, 10Wan J. Sun L. Mendoza J.W. Chui Y.L. Huang D.P. Chen Z.J. Suzuki N. Suzuki S. Yeh W.C. Akira S. Matsumoto K. Liu Z.G. Wu Z. Mol. Cell. Biol. 2004; 24: 192-199Crossref PubMed Scopus (64) Google Scholar). Therefore, these molecules are likely to act redundantly. In contrast, two independent studies have shown that TRAF6, which was previously established as an essential mediator of interleukin 1 (IL-1) and receptor activator of NF-κB (RANK), is also a critical factor for LMP1-induced activation of NF-κB and JNK (9Luftig M. Prinarakis E. Yasui T. Tsichritzis T. Cahir-McFarland E. Inoue J. Nakano H. Mak T.W. Yeh W.C. Li X. Akira S. Suzuki N. Suzuki S. Mosialos G. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 15595-15600Crossref PubMed Scopus (110) Google Scholar, 10Wan J. Sun L. Mendoza J.W. Chui Y.L. Huang D.P. Chen Z.J. Suzuki N. Suzuki S. Yeh W.C. Akira S. Matsumoto K. Liu Z.G. Wu Z. Mol. Cell. Biol. 2004; 24: 192-199Crossref PubMed Scopus (64) Google Scholar). Unlike TRAF2 and TRAF5, TRAF6 has not been extensively studied in connection with LMP1. It is still unclear which LMP1 domains are involved in its association with TRAF6. Moreover, the mechanism by which TRAF6 mediates LMP1 signaling has not been well studied.FIGURE 1LMP1 associates with TAK1, TAB2, and TRAF6. A, schematic drawing of wild type LMP1 and mutants. B–D, 293 cells were transfected with expression vectors for various versions of Flag-LMP1 or Flag-TfR together with HA-TAK1 (B), HA-TAB2 (C), or HA-TRAF6 (D). Cell lysates were immunoprecipitated (IP) and analyzed by immunoblotting (IB). WCE, whole cell extracts; HC, immunoglobulin heavy chain; LC, immunoglobulin light chain.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Transforming growth factor β (TGF-β)-activated kinase 1 (TAK1) is a member of the mitogen-activated protein kinase kinase kinase (MAPKKK) family and is activated by various cytokines, including the family of TGF-β ligands (11Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1174) Google Scholar). TAK1 is also involved in the IL-1 signaling pathway (12Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar). Following exposure of cells to IL-1, endogenous TAK1 is recruited to the TRAF6 complex and activated, upon which it stimulates both the JNK and NF-κB pathways. Several lines of evidence indicate that TAK1 is an essential mediator of innate immunity signaling: (i) TAK1 deletion or siRNA targeting TAK1 abolishes IL-1-induced NF-κB activation (13Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (319) Google Scholar, 14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takewuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (752) Google Scholar); (ii) a selective inhibitor against TAK1 inhibits IL-1-induced activation of NF-κB and JNK (15Ninomiya-Tsuji J. Kajino T. Ono K. Ohtomo T. Matsumoto M. Shiina M. Mihara M. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2003; 278: 18485-18490Abstract Full Text Full Text PDF PubMed Scopus (345) Google Scholar); (iii) TAK1 deficiency in Drosophila causes an impaired immune response to bacterial infection (16Vidal S. Khush R.S. Leulier F. Tzou P. Nakamura M. Lemaitre B. Genes Dev. 2001; 15: 1900-1912Crossref PubMed Scopus (250) Google Scholar). In previous studies, we have isolated TAB2 and its homologue TAB3, proteins that interact with TAK1. TAB2 and TAB3 are also intermediates in a proinflammatory signaling pathways (17Ishitani T. Takaesu G. Ninomiya-Tsuji J. Shibuya H. Gaynor R.B. Matsumoto K. EMBO J. 2003; 22: 6277-6288Crossref PubMed Scopus (219) Google Scholar, 18Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar). Knockdown of both TAB2 and TAB3 by siRNA diminishes IL-1 responses. Although TAB2 and TAB3 have overlapping functions, TAB2 is more directly involved in the TRAF6 pathway. TAB2 directly associates with TRAF6 as well as TAK1, and this interaction facilitates the assembly of a signaling complex consisting of TRAF6, TAB2, and TAK1 in response to IL-1 and RANK ligand stimulation (18Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar, 19Mizukami J. Takaesu G. Akatsuka H. Sakurai H. Ninomiya-Tsuji J. Matsumoto K. Sakurai N. Mol. Cell. Biol. 2002; 22: 992-1000Crossref PubMed Scopus (234) Google Scholar, 20Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (159) Google Scholar). A recent report has demonstrated that TAK1 is activated by LMP1 and that knockdown of TAK1 expression by siRNA causes a defect in LMP1-induced JNK activation (10Wan J. Sun L. Mendoza J.W. Chui Y.L. Huang D.P. Chen Z.J. Suzuki N. Suzuki S. Yeh W.C. Akira S. Matsumoto K. Liu Z.G. Wu Z. Mol. Cell. Biol. 2004; 24: 192-199Crossref PubMed Scopus (64) Google Scholar). This suggests that TAK1 participates in LMP1 signaling. However, the exact connections among LMP1, TRAF6, TAK1, NF-κB, and JNK remain to be established. Here we report that TAK1 and TAB2 are involved in LMP1 signaling. We found that TRAF6, TAB2, and TAK1 were assembled into a complex with LMP1. Assembly of these factors was capable of activating JNK and was mediated through the transmembrane region of LMP1. In contrast, activation of NF-κB absolutely requires the C-terminal cytoplasmic region of LMP1 where IKK is recruited. Furthermore, we found that TAK1 was essential for LMP1-induced JNK activation but dispensable for LMP1-mediated NF-κB activation. These results suggest that the formation of the TRAF6-TAB2-TAK1 complex with LMP1 mediates activation of JNK, while IKK recruited into the C-terminal region of LMP1 can be activated through multiple pathways that may include TAK1. Plasmids—pSG5-Flag-LMP1 vectors were generously provided by Dr. Kieff (21Higuchi M. Izumi K.M. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4675-4680Crossref PubMed Scopus (112) Google Scholar). To generate pCMV-Flag-LMP1 and pCMV-HA-JNK vectors, a BamHI fragment from pSG5-Flag-LMP1 or pSRα-HA-JNK was subcloned into a pCMV mammalian expression vector. Flag-LMP1-(1–186) and -(25–186) mutants were generated by PCR and subcloned into pCMV vectors. The PCR products were verified by sequencing. To generate expression vector of C-terminal Flag-fused transferrin receptor, cDNA were excised from pcD-transferrin receptor (purchased from ATCC) and subcloned into pCMV-C-Flag vector. T7-TAK1 and HA-TRAF6 were also subcloned into pCMV vectors. To knockdown the expression of TAK1, siRNA targeting TAK1 were used. Oligonuclotides corresponded to nucleotides 88–106 of the TAK1 coding region were subcloned into the BS/H1 vector to produce siRNA. Cell Cultures and Transfection—293 cells, TAK1+/+, and TAK1Δ/Δ mouse embryonic fibroblasts (MEFs) (14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takewuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (752) Google Scholar) and HeLa S3 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum or bovine growth serum (Hyclone) at 37 °C in 5% CO2. For the transfection studies, 293 cells (5 × 105 cells) were plated in 10-cm-diameter dishes, transfected with a total of 10 μg of DNA containing various expression vectors by the calcium phosphate precipitation method, and incubated for 36–48 h. TAK1+/+ and TAK1Δ/Δ MEFs and HeLa S3 cells were transfected using FuGENE 6 transfection reagent (Roche Diagnostics) and TransFast™ transfection reagent (Promega). Chemicals and Antibodies—Polyclonal rabbit antibodies to TRAF6 (anti-TRAF6), TAK1 (anti-TAK1), and TAB2 (anti-TAB2) have been described previously (12Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1018) Google Scholar, 18Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar). Anti-Flag M2 monoclonal antibody (Sigma), anti-HA (HA.11) monoclonal antibody (Babco), anti-HA (Y-11) polyclonal antibody (Santa Cruz Biotechnology), anti-T7 monoclonal antibody (Novagen), anti-TRAF2 (H-249) polyclonal antibody (Santa Cruz Biotechnology), anti-JNK1 (FL) polyclonal antibody (Santa Cruz Biotechnology), anti-β-actin (Sigma), and anti-p65 (A) polyclonal antibody (Santa Cruz Biotechnology) were used for immunoprecipitation and immunoblotting. Anti-phospho-SAPK/JNK (Thr-183/Tyr-185) rabbit polyclonal antibody (Cell Signaling) was used to detect the phosphorylated forms of JNK. The TAK1 inhibitor, 5Z-7-oxozeaenol, has been described previously (15Ninomiya-Tsuji J. Kajino T. Ono K. Ohtomo T. Matsumoto M. Shiina M. Mihara M. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2003; 278: 18485-18490Abstract Full Text Full Text PDF PubMed Scopus (345) Google Scholar). Recombinant human TNF-α (Roche Diagnostics) and anisomycin (Calbiochem) were used. Generation of Cell Lines Stably Expressing T7-TAK1—To establish stable cell lines that express wild type TAK1, TAK1Δ/Δ MEFs were transfected with pCMV-T7-TAK1 together with an expression vector for hygromycin resistance. Hygromycin-resistant clones were selected in medium containing 200 μg/ml hygromycin B (Calbiochem), and expression of T7-TAK1 was verified by immunoblotting with anti-TAK1. Generation of Cell Lines Stably Expressing siRNA for TAK1—To establish stable cell lines that express siRNA-targeting TAK1, HeLa S3 cells were transfected with pBS/H1-TAK1 siRNA vector together with an expression vector for neomycin resistance. Neomycin-resistant clones were selected in medium containing 500 mg/ml G418 (Invitrogen), and expression of TAK1 was determined by immunoblotting. Reporter Gene Assays—For the reporter gene assays, 293 cells (8 × 104 cells), TAK1+/+ or TAK1Δ/Δ MEFs (3 × 104 cells) were plated into six-well dishes (35 mm), or HeLa S3 cells (1.5 × 104 cells) were plated into 12-well dishes. At 24 h after seeding, cells were transfected with a reporter plasmid and expression vectors as indicated. Some cells were treated with TNF (20 ng/ml) for 36 h. An Ig-κ-firefly luciferase reporter was used to measure NF-κB-dependent gene activation. An AP-1-firefly luciferase reporter was used to measure AP-1-dependent gene activation. Plasmids encoding β-galactosidase under the control of the β-actin promoter or Renilla luciferase under the control of the EF1α promoter were used to normalize transfection efficiency. Immunoprecipitation and Immunoblotting—Cells were washed once with ice-cold phosphate-buffered saline and lysed in 0.3 ml of lysis buffer (20 mm HEPES (pH 7.4), 150 mm NaCl, 12.5 mm β-glycerophosphate, 1.5 mm MgCl2, 2 mm EGTA, 10 mm NaF, 2 mm DTT, 1 mm Na3VO4, 1 mm phenylmethylsulfonyl fluoride, 20 μm aprotinin, 0.5% Triton X-100). For co-precipitation assay, cells were lysed in 0.3 ml of RIPA buffer (0.1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mm phenylmethylsulfonyl fluoride, 1 mm Na3Vo4, 20 μm aprotinin). Cell debris was removed by centrifugation at 15,000 × g for 5 min. Proteins from cell lysates were immunoprecipitated with 1 μg of various antibodies and 20 μl of protein G-Sepharose (Amersham Biosciences). The immunoprecipitates were washed three times with washing buffer (20 mm HEPES, 10 mm MgCl2, 500 mm NaCl), once with rinse buffer (10 mm HEPES (pH 7.4), 5 mm MgCl2, 1 mm DTT) and resuspended in 30 μl of rinse buffer. For immunoblotting, the immunoprecipitates or whole cell lysates were resolved on SDS-PAGE and transferred to Hybond-P membranes (Amersham Biosciences). The membranes were immunoblotted with various antibodies, and the bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against rabbit or mouse IgG using the ECL Western blotting system (Amersham Biosciences). Gel Retardation Analysis—293 cells, TAK1+/+, or TAK1Δ/Δ MEFs were either left untreated or treated with TNF (20 ng/ml) for 30 min and harvested and lysed for use in gel retardation assays. 32P-Labeled NF-κB oligonucleotides (Promega) were used. The binding reactions containing the radiolabeled probe, 15 μg of cell extracts, 4% glycerol, 1 mm MgCl2, 0.5 mm EDTA, 0.5 mm DTT, 50 mm NaCl, 10 mm Tris-HCl (pH 7.5), 500 ng of poly(dI-dC) (Amersham Biosciences), and 10 μg of bovine serum albumin in a final volume of 30 μl were incubated at room temperature for 1 h and subjected to electrophoresis on a 4% (w/v) polyacrylamide gel in 0.5 × TBE (45 mm Tris borate, 1 mm EDTA). For supershift assays, 1 μg of control rabbit IgG or anti-p65 were added to the reactions and incubated for 30 min at room temperature before probes were added. The gels were dried and exposed to x-ray film. We have previously demonstrated that TAK1 and its adapter protein TAB2 play important roles in IL-1 and RANKL signaling pathways via complex formation with TRAF6 (18Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (488) Google Scholar, 19Mizukami J. Takaesu G. Akatsuka H. Sakurai H. Ninomiya-Tsuji J. Matsumoto K. Sakurai N. Mol. Cell. Biol. 2002; 22: 992-1000Crossref PubMed Scopus (234) Google Scholar). Recently, it was shown that TRAF6 is an indispensable intermediate in LMP1 signaling (9Luftig M. Prinarakis E. Yasui T. Tsichritzis T. Cahir-McFarland E. Inoue J. Nakano H. Mak T.W. Yeh W.C. Li X. Akira S. Suzuki N. Suzuki S. Mosialos G. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 15595-15600Crossref PubMed Scopus (110) Google Scholar, 10Wan J. Sun L. Mendoza J.W. Chui Y.L. Huang D.P. Chen Z.J. Suzuki N. Suzuki S. Yeh W.C. Akira S. Matsumoto K. Liu Z.G. Wu Z. Mol. Cell. Biol. 2004; 24: 192-199Crossref PubMed Scopus (64) Google Scholar). This raised the possibility that TAK1 and TAB2 also participate in LMP1 signaling. To test this possibility, we used co-precipitation assays in human embryonic kidney 293 cells to examine whether LMP1 associates with TAK1, TAB2, and TRAF6 (Fig. 1, B–D). 293 cells were transfected with expression vectors for Flag-tagged LMP1 (Flag-LMP1), together with HA-tagged TAK1 (HA-TAK1), HA-tagged TAB2 (HA-TAB2), or HA-tagged TRAF6 (HA-TRAF6). Flag-tagged transferrin receptor (Flag-TfR) was used as a control membrane protein. Cell extracts were immunoprecipitated with anti-Flag or anti-HA monoclonal antibody and co-precipitated proteins were detected by immunoblotting. We found that TAK1, TAB2, and TRAF6 were capable of associating with LMP1. The N-terminal transmembrane region of LMP1 mediates autoaggregation, which is a prerequisite for LMP1 activation (6Coffin W.F. II I Geiger T.R. Martin J.M. J. Virol. 2003; 77: 3749-3758Crossref PubMed Scopus (42) Google Scholar, 7Yasui T. Luftig M. Soni V. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 278-283Crossref PubMed Scopus (58) Google Scholar), while CTAR1 and CTAR2 domains in the C-terminal cytoplasmic tail are thought to mediate LMP1 signaling. TRAF2, TRAF5, and TRADD are involved in CTAR1/2-mediated signaling (4Cahir-McFarland E.D. Izumi K.M. Mosialos G. Oncogene. 1999; 18: 6959-6964Crossref PubMed Scopus (140) Google Scholar, 5Lam N. Sugden B. Cell. Signal. 2003; 15: 9-16Crossref PubMed Scopus (101) Google Scholar, 8Eliopoulos A.G. Young L.S. Semin. Cancer Biol. 2001; 11: 435-444Crossref PubMed Scopus (186) Google Scholar). To determine which domain is involved in the binding of TAK1, TAB2, and TRAF6, we utilized several LMP1 mutant constructs (Fig. 1A). The LMP1-AA, -ID, and -DM mutants (kindly provided by Dr. Kieff) have mutations in essential amino acid residues of CTAR1, CTAR2, and both, respectively (21Higuchi M. Izumi K.M. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 4675-4680Crossref PubMed Scopus (112) Google Scholar). In addition, we generated the mutant LMP1-(1–186) and LMP1-(25–186), which lack the entire C-terminal cytoplasmic tail and both the N-terminal and C-terminal cytoplasmic domains, respectively. We transfected expression vectors for these various LMP1 mutants together with HA-TAK1, HA-TAB2, or HA-TRAF6 (Fig. 1B-D). We found that TAK1, TAB2, and TRAF6 were co-precipitated with all three types of LMP1 mutations: LMP1-AA, -ID, and -DM. These results suggest that the CTAR1 and CTAR2 domains are not involved in the association of LMP1 with TAK1, TAB2, and TRAF6. Furthermore, even LMP1-(1–186) or -(25–186) could co-precipitate TAK1, TAB2, and TRAF6, although they seem to associate less efficiently with TAK1 and TRAF6. The reciprocal immunoprecipitation study (Fig. 1, B–D, right panels) confirmed that TAK1, TAB2, and TRAF6 could co-precipitate WT LMP1 and LMP1-AA, -ID, -DM, and -(1–186). These results suggest that TAK1, TAB2, and TRAF6 interact with LMP1 primarily through the N-terminal transmembrane region. The C-terminal region of LMP1 might stabilize the assembly of the complex. To verify the physiological relevance of these interactions, we next investigated the complexes between LMP1 and endogenous molecules. We transfected 293 cells with expression vectors for various versions of Flag-LMP1 and used anti-Flag antibody to immunoprecipitate complexes. We then attempted to detect co-precipitated endogenous proteins including TRAF2, TRAF6, TAB2, and TAK1 (Fig. 2A). TRAF2 is known to associate with LMP1 through the CTAR1 domain (22Devergne O. Hatzivassiliou E. Izumi K.M. Kaye K.M. Kleijnen M.F. Kieff E. Mosialos G. Mol. Cell. Biol. 1996; 16: 7098-7108Crossref PubMed Google Scholar). Consistent with this, TRAF2 was found to associate with WT LMP1 and the LMP1-ID mutant but not with the LMP1-AA, -DM, or -(1–186) mutants (Fig. 2A). In contrast, we found that TRAF6 was co-precipitated with WT LMP1 and LMP1-AA, -ID, -DM, and -(1–186) mutants. TAB2 and TAK1 were also co-precipitated with WT LMP1 and LMP1-AA, -ID, and -DM, and less efficiently with LMP1-(1–186). This is consistent with the results from overexpression proteins shown above. The reciprocal immunoprecipitation was performed in cell extracts from WT LMP1 and LMP1-(1–186) expressing cells (Fig. 2B). TAK1 could co-precipitate WT LMP1 but less effectively LMP1-(1–186). These results suggest that LMP1 can recruit TRAF6, TAB2, and TAK1 through its N-terminal transmembrane region and that the C-terminal region functions to stabilize the complex. The N-terminal transmembrane region is essential for the action of LMP1. However, the functional role of the N terminus has not been fully addressed. We therefore examined the effects of LMP1-(1–186) expression on the activation of JNK and NF-κB (Fig. 3). 293 cells were transfected with expression vectors for various Flag-LMP1 mutants. Activation of JNK was detected by immunoblotting with phospho-specific JNK antibody. The CTAR domains of LMP1 have been implicated in JNK activation (23Eliopoulos A.G. Blake S.M. Floettmann J.E. Rowe M. Young L.S. J. Virol. 1999; 73: 1023-1035Crossref PubMed Google Scholar, 24Kieser A. Kaiser C. Hammerschmidt W. EMBO J. 1999; 18: 2511-2521Crossref PubMed Scopus (104) Google Scholar). Consistently, we found that mutations at both CTAR domains and the deletion of the C-terminal region impaired JNK activation (Fig. 3A). However, we found that the N-terminal transmembrane region alone had some ability to activate JNK when it was highly expressed (Fig. 3A, left and right panels). This activation might be correlated with the recruitment of TAK1, TAB2, and TRAF6 into the LMP1 complex, which occur weakly with the LMP1-(1–186) and most strongly with the WT LMP1.FIGURE 3Effect of LMP1 mutations on activation of JNK and NF-κB. A, 293 cells were transfected with expression vectors for various versions of Flag-LMP1. Increasing amounts of Flag-LMP1-(1–186) vectors were used. The activated form of JNK was detected with phospho-JNK antibody (P-JNK). B, 293 cells were transfected with expression vectors for various versions of Flag-LMP1. The amounts of plasmids were the same as in A. Cell lysates were subjected to electrophoretic mobility shift assay (EMSA) using NF-κB DNA probe (top panel). NF-κB binding was confirmed by supershift with anti-p65. The amounts of p65 in the cell lysates and expression levels of LMP1 are also shown. IB, immunoblotting; WCE, whole cell extracts. C, 293 cells were transfected with an NF-κB-dependent luciferase reporter and pAct-β-galactosidase plasmids, together with expression vectors for various versions of Flag-LMP1 or Flag-TfR. Increasing amounts of Flag-LMP1-(1–186) vectors were used. Luciferase activity was determined and normalized to the levels of β-galactosidase activity. Stimulation relative to control transfection with empty vector is shown. D, left panels: 293 cells were transfected with expression vectors for various versions of Flag-LMP1 or Flag-TfR together with HA-IKKγ. Cell lysates were immunoprecipitated (IP) and analyzed by immunoblotting (IB). WCE, whole cell extracts. Right panels: 293 cells were transfected with expression vectors for T7-TAK1 together with HA-IKKγ in the absence or presence of Flag-LMP1 WT or 1–186 mutant. Cell lysates were immunoprecipitated (IP) and analyzed by immunoblotting (IB). WCE, whole cell extracts.View Large Image Figure ViewerDownload Hi-res image Download (PPT) NF-κB activation was examined by employing an NF-κB electrophoretic mobility shift assay (Fig. 3B) and NF-κB-dependent reporter assay (Fig. 3C). In agreement with earlier studies (22Devergne O. Hatzivassiliou E. Izumi K.M. Kaye K.M. Kleijnen M.F. Kieff E. Mosialos G. Mol. Cell. Biol. 1996; 16: 7098-7108Crossref PubMed Google Scholar, 25Izumi K.M. Kieff E.D. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 12592-12597Crossref PubMed Scopus (359) Google Scholar), disruption of either CTAR1 or CTAR2 (LMP1-AA or -ID mutants) reduced NF-κB binding activity, while the double mutation (LMP1-DM) abolished NF-κB activation (Fig. 3B). The LMP1-(1–186) mutant was completely unable to stimulate NF-κB binding activity. The NF-κB-dependent reporter assay further confirmed that the LMP1-(1–186) mutant could not activate NF-κB (Fig. 3C). Taken together, these results suggest that formation of a complex containing TRAF6, TAB2, and TAK1, assembled through interactions with the LMP1 N-terminal transmembrane region, might directly participate in JNK activation but is not sufficient to mediate NF-κB activation. Lack of NF-κB activation by the LMP1 transmembrane region suggests that the signaling complex formed through the transmembrane region is not sufficient to activate NF-κB. We therefore hypothesized that the downstream effectors may not be recruited in the complex of LMP1 transmembrane region. We examined whether IKK is contained in the LMP1 complex. We transfected expression vectors for IKKγ together with the WT LMP1 and LMP1-AA, -ID, -DM, LMP1-(1–186), or LMP1-(25–186) (Fig. 3D, left panels). We found that IKKγ was precipitated with WT LMP1 and LMP1-AA, -ID, and -DM but not with the C-terminal truncated mutants. This result indicates that the LMP1 recruits IKKγ through its C-terminal region. Therefore, the transmembrane region alone is not sufficient for recruitment of the IKK complex. LMP-DM has ability to recruit IKKγ despite the fact that it does not activate NF-κB. This suggests that any of TRAF2, TRAF5, or TRADD, which is recruited through CTAR domains, is likely to be essential for NF-κB activation. We next looked at relationship between TAK1 and IKKγ in the LMP1 complex. We transfected expression vectors for IKKγ, TAK1, together with the WT LMP1 or LMP1-(1–186) (Fig. 3D, right panels). TAK1 was not co-precipited with IKKγ in the absence of LMP1. Expression of WT LMP1 but not LMP1-(1–186) greatly increased interaction of TAK1 with IKKγ. These results suggest that TAK1 by itself does not interact with IKKγ and that integrity of LMP1 is important for assembly of the signaling complex leading to NF-κB activation. We next asked whether TAK1 is essential for LMP1 signaling by utilizing a selective inhibitor of TAK1, 5Z-7-oxozeaenol (Fig. 4). As shown previously (15Ninomiya-Tsuji J. Kajino T. Ono K. Ohtomo T. Matsumoto M. Shiina M. Mihara M. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2003; 278: 18485-18490Abstract Full Text Full Text PDF PubMed Scopus (345) Google Scholar), 10–30 nm 5Z-7-oxozeaenol can inhibit activation of JNK by TNF (Fig. 4A) and IL-1 treatments (data not shown). Cells expressing LMP1 were treated with vehicle or 5Z-7-oxozeaenol every 12 h, and JNK activity was measured. 5Z-7-oxozeaenol completely blocked LMP1-induced JNK activation, to an extent similar to its inhibition of the TNF response (Fig. 4A). We next tested the effect of 5Z-7-oxozeaenol on LMP1-mediated NF-κB activation using an NF-κB-dependent reporter construct (Fig. 4B). As described previously (15Ninomiya-Tsuji J. Kajino T. Ono K. Ohtomo T. Matsumoto M. Shiina M. Mihara M. Tsuchiya M. Matsumoto K. J. Biol. Chem. 2003; 278: 18485-18490Abstract Full Text Full Text PDF PubMed Scopus (345) Google Scholar), 5Z-7-oxozeaenol effectively blocked TNF-induced activation of NF-κB, while overexpression of NF-κB-inducing kinase (NIK) activated NF-κB independently of TAK1. We found that 5Z-7-oxozeaenol had only marginal effect on LMP1-induced NF-κB activation. These results suggest that TAK1 is primarily involved in LMP1 signaling leading to activation of JNK but not of NF-κB. To further define the role of TAK1 in LMP1 signaling, we utilized mouse embryonic fibroblasts having a homozygous deletion of the ATP-binding site within the TAK1 kinase domain (amino acids 41–77) (TAK1Δ/Δ MEFs) (Fig. 5A). This cell line was obtained by infecting MEFs containing homozygous TAK1 genes flanked by loxP sites with a Cre-expressing retroviral vector (14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takewuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (752) Google Scholar). The line was subsequently immortalized using the 3T3 protocol. We examined LMP1-induced JNK activation in TAK1+/+ and TAK1Δ/Δ MEFs transfected with HA-tagged JNK. JNK activity was measured by immunoprecipitation of HA-JNK (HA-JNK) followed by immunoblotting with anti-phospho-JNK (Fig. 5B). An inhibitor of the peptidyltransferase reaction, anisomycin, can trigger a ribotoxic stress response that strongly activates JNK. We found that anisomycin activated JNK in both TAK1+/+ and TAK1Δ/Δ MEFs. In contrast, LMP1 activated JNK in TAK1+/+ but not in TAK1Δ/Δ MEFs. To verify whether the defect is due to the TAK1 deficiency, we generated TAK1Δ/Δ MEFs stably expressing wild type T7-tagged TAK1 (T7-TAK1) (Fig. 5B, right panels). Expression of TAK1 in TAK1Δ/Δ MEFs could restore LMP1-induced JNK activation. These results confirmed that TAK1 is an essential mediator of LMP1 signaling leading to JNK activation.FIGURE 5TAK1 is essential for LMP1-induced JNK activation. A, schematic drawing of TAK1Δ. B, TAK1+/+, TAK1Δ/Δ, and T7-TAK1-expressing TAK1Δ/Δ MEFs were transfected with expression vectors for HA-JNK and Flag-LMP1. Some cells were treated with anisomycin for 30 min prior to harvest. HA-JNK was immunoprecipitated, and the activated form of JNK was detected with phospho-JNK antibody (P-JNK). IP, immunoprecipitated; IB, immunoblotting; WCE, whole cell extracts. C, TAK1+/+ and TAK1Δ/Δ MEFs were transfected with expression vectors for Flag-LMP1. Cell lysates were subjected to electrophoretic mobility shift assay (EMSA) using an NF-κB DNA probe. NF-κB binding was confirmed by supershift with anti-p65. Amounts of p65 in the cell lysates and expression levels of LMP1 are shown. IB, immunoblotting; WCE, whole cell extracts. D, TAK1+/+ and TAK1Δ/Δ MEFs were transfected with NF-κB-dependent luciferase reporter and pEF1α Renilla luciferase plasmids together with expression vector for Flag-LMP1. Luciferase activity was determined and normalized to the levels of Renilla luciferase activity. Stimulation relative to control transfection with empty vector is shown. E, left panels: proteins from HeLa S3 control or TAK1 siRNA cells were immunoblotted (IB) with anti-TAK1 (upper panel) and anti-β-actin (lower panel). Right panels: HeLa S3 control or TAK1 siRNA cells were transfected with expression vectors for HA-JNK and Flag-LMP1. Some cells were treated with anisomycin for 30 min prior to harvest. HA-JNK was immunoprecipitated (IP), and the activated form of JNK was detected with phospho-JNK antibody (P-JNK). WCE, whole cell extracts. F, HeLa S3 control or TAK1 siRNA cells were transfected with AP-1- or NF-κB-dependent luciferase reporter and pEF1α Renilla luciferase plasmids together with expression vector for Flag-LMP1. Luciferase activity was determined and normalized to the levels of Renilla luciferase activity. Stimulation relative to control transfection with empty vector is shown.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We next tested LMP1-mediated NF-κB activation in TAK1Δ/Δ MEFs (Fig. 5, C and D). An earlier study had shown that deletion of TAK1 causes impaired TNF signaling (13Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (319) Google Scholar, 14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takewuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (752) Google Scholar). As expected, an electrophoretic mobility shift assay showed that TNF-induced NF-κB binding activity was impaired in TAK1Δ/Δ MEFs (Fig. 5C). In contrast, we found that LMP1 was able to activate NF-κB binding activity to a similar or somewhat higher degree in TAK1 Δ/Δ MEFs compared with TAK1+/+ MEFs. We also examined activity of an NF-κB-dependent reporter construct (Fig. 5D). We found that LMP1 activated NF-κBin both TAK1+/+ and TAK1Δ/Δ MEFs. TAK1Δ/Δ expresses a truncated version of TAK1 that only lacks the ATP-binding site as described above. Although this mutant TAK1 has no kinase activity, it may be possible that the truncated TAK1 still can promote activation of NF-κB in a manner of independent of kinase activity. To clarify this possibility, we used HeLa S3 cells stably expressing TAK1 siRNA in which expression of TAK1 is significantly decreased (Fig. 5E, left panels). To assess whether lack of TAK1 protein alters LMP1-dependent signaling pathways, we examined LMP-1-induced JNK activation (Fig. 5E, right panels) and activity of AP-1- or NF-κB-dependent reporter construct (Fig. 5F). AP-1-dependent reporter construct was used to assess the downstream events of JNK. LMP1 could not activate JNK in the cells expressing TAK1 siRNA, which is consistent with the results from TAK1 deletion MEFs. Activation of AP-1 was also impaired by TAK1 depletion, while activation of NF-κB was not affected. These results confirm that TAK1 is dispensable for LMP1-induced NF-κB activation. It is likely that TAK1 redundantly functions to activate NF-κB with other kinases in LMP1 pathway. The transmembrane region of LMP1 is essential for LMP1 signaling. Autoaggregation through the LMP1 transmembrane region is thought to trigger downstream signaling (6Coffin W.F. II I Geiger T.R. Martin J.M. J. Virol. 2003; 77: 3749-3758Crossref PubMed Scopus (42) Google Scholar, 7Yasui T. Luftig M. Soni V. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 278-283Crossref PubMed Scopus (58) Google Scholar). However, the functional role of the N-terminal transmembrane region has not been closely examined. Here we demonstrate that TRAF6, TAK1, and its binding protein TAB2 can associate with LMP1 through the LMP1 N-terminal transmembrane region (Figs. 1 and 2). This reveals a novel role of LMP1 transmembrane region in the facilitating assembly of a signaling complex consisting of TRAF6, TAB2, and TAK1 (Fig. 6). The C-terminal region appears to enhance this assembly as shown in Figs. 1 and 2. We also demonstrated that expression of just the N-terminal transmembrane region of LMP1 has the ability to activate JNK (Fig. 3A). This suggests that an LMP1 transmembrane complex containing TRAF6, TAB2, and TAK1 can mediate activation of JNK. LMP1 C-terminal region functions to stabilize the complex and enhances JNK activation. The present study also revealed that TAK1 is essential for LMP1-induced activation of JNK (Fig. 4A and 5, B, E, and F). Taken together, assembly of a signaling complex composed of LMP1-TRAF6-TAB2-TAK1 mediates activation of JNK (Fig. 6). In agreement with earlier studies, we demonstrated that the N-terminal transmembrane region alone is completely unable to activate NF-κB (Fig. 3, B and C). This suggests that the LMP1-TRAF6-TAB2-TAK1 signaling complex could not mediate activation of NF-κB. In IL-1 signaling pathway, TAK1, TAB2 and TRAF6 make a signaling complex and activate IKK. However, in this process, not only forming the complex of TRAF6-TAB2-TAK1 but also recruitment of IKKs into this complex is indispensable for IKK activation (26Wang C. Deng L. Hong M. Akkaraju G.R. Inoue J. Chen Z.J. Nature. 2001; 412: 346-351Crossref PubMed Scopus (1633) Google Scholar, 27Kanayama A. Seth R.B. Sun L. Ea C.K. Hong M. Shaito A. Chiu Y.H. Deng L. Chen Z.J. Mol. Cell. 2004; 15: 535-548Abstract Full Text Full Text PDF PubMed Scopus (696) Google Scholar). We therefore examined whether LMP1 mutants can recruit IKKs. We found that IKKγ is recruited by WT LMP1 but not by LMP1-(1–186) (Fig. 3D). This result suggests that LMP1 transmembrane region recruits TRAF6, TAB2, and TAK1 but not the IKK complex resulting in failure of IKK activation. TAK1 is essential for IL-1- and TNF-induced activation both of JNK and of NF-κB (14Sato S. Sanjo H. Takeda K. Ninomiya-Tsuji J. Yamamoto M. Kawai T. Matsumoto K. Takewuchi O. Akira S. Nat. Immunol. 2005; 6: 1087-1095Crossref PubMed Scopus (752) Google Scholar). In contrast to this, we found that TAK1 is dispensable for LMP-1-induced NF-κB activation despite the fact that TAK1 is recruited into the LMP1 complex. This raises possibility that other MAPKKK kinases such as NIK, which can activate NF-κB, may function redundantly with TAK1. NIK is indeed implicated in LMP1 signaling (27Kanayama A. Seth R.B. Sun L. Ea C.K. Hong M. Shaito A. Chiu Y.H. Deng L. Chen Z.J. Mol. Cell. 2004; 15: 535-548Abstract Full Text Full Text PDF PubMed Scopus (696) Google Scholar, 28Saito N. Courtois G. Chiba A. Yamamoto N. Nitta T. Hironaka N. Rowe M. Yamaoka S. J. Biol. Chem. 2003; 278: 46565-46575Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). LMP1 may be able to recruit not only TAK1 but also NIK and transmits the signal leading to activation of JNK and NF-κB. It is worth noting that NIK does not have ability to activate JNK, whereas TAK1 can activate both JNK and NF-κB. TAB2 can bind directly TRAF6 and TAK1 and thereby mediate assembly of a TRAF6-TAB2-TAK1 signaling complex (19Mizukami J. Takaesu G. Akatsuka H. Sakurai H. Ninomiya-Tsuji J. Matsumoto K. Sakurai N. Mol. Cell. Biol. 2002; 22: 992-1000Crossref PubMed Scopus (234) Google Scholar). We show here that TRAF6, TAB2, and TAK1 are also components of the LMP1 complex. Thus, it is likely that TAB2 facilitates assembly of the LMP1 complex by binding to both TRAF6 and TAK1. This may appear inconsistent with earlier studies showing that TAB2 is dispensable for activation of both JNK and NF-κB in LMP1 signaling (9Luftig M. Prinarakis E. Yasui T. Tsichritzis T. Cahir-McFarland E. Inoue J. Nakano H. Mak T.W. Yeh W.C. Li X. Akira S. Suzuki N. Suzuki S. Mosialos G. Kieff E. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 15595-15600Crossref PubMed Scopus (110) Google Scholar, 10Wan J. Sun L. Mendoza J.W. Chui Y.L. Huang D.P. Chen Z.J. Suzuki N. Suzuki S. Yeh W.C. Akira S. Matsumoto K. Liu Z.G. Wu Z. Mol. Cell. Biol. 2004; 24: 192-199Crossref PubMed Scopus (64) Google Scholar). However, we previously reported that a homologue of TAB2, TAB3, plays a redundant role with TAB2 in the IL-1 and TNF signaling pathways (16Vidal S. Khush R.S. Leulier F. Tzou P. Nakamura M. Lemaitre B. Genes Dev. 2001; 15: 1900-1912Crossref PubMed Scopus (250) Google Scholar). It is therefore possible that in TAB2 knock-out cells, TAB3 might compensate for the function of TAB2 in LMP1 complex assembly. This newly identified LMP1 complex containing TRAF6, TAB2, and TAK1 appears to be important for the activity of LMP1. Further studies utilizing TAK1 deletion mice may help revealing the in vivo role of this complex in B-cell transformation. We thank E. Kieff and E. Nishida for materials.}, number={12}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Uemura, N and Kajino, T and Sanjo, H and Sato, S and Akira, S and Matsumoto, K and Ninomiya-Tsuji, J}, year={2006}, month={Mar}, pages={7863–7872} }
 @article{omori_matsumoto_sanjo_sato_akira_smart_ninomiya-tsuji_2006, title={TAK1 is a master regulator of epidermal homeostasis involving skin inflammation and apoptosis}, volume={281}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M603384200}, abstractNote={Transforming growth factor beta-activated kinase 1 (TAK1) functions downstream of inflammatory cytokines to activate c-Jun N-terminal kinase (JNK) as well as NF-kappaB in several cell types. However, the functional role of TAK1 in an in vivo setting has not been determined. Here we have demonstrated that TAK1 is the major regulator of skin inflammation as well as keratinocyte death in vivo. Epidermal-specific deletion of TAK1 causes a severe inflammatory skin condition by postnatal day 6-8. The mutant skin also exhibits massive keratinocyte death. Analysis of keratinocytes isolated from the mutant skin revealed that TAK1 deficiency results in a striking increase in apoptosis in response to tumor necrosis factor (TNF). TAK1-deficient keratinocytes cannot activate NF-kappaB or JNK upon TNF treatment. These results suggest that TNF induces TAK1-deficient keratinocyte death because of the lack of NF-kappaB (and possibly JNK)-mediated cell survival signaling. Finally, we have shown that deletion of the TNF receptor can largely rescue keratinocyte death as well as inflammatory skin condition in epidermal-specific TAK1-deficient mice. Our results demonstrate that TAK1 is a master regulator of TNF signaling in skin and regulates skin inflammation and keratinocyte death.}, number={28}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Omori, Emily and Matsumoto, Kunihiro and Sanjo, Hideki and Sato, Shintaro and Akira, Shizuo and Smart, Robert C. and Ninomiya-Tsuji, Jun}, year={2006}, month={Jul}, pages={19610–19617} }
 @article{sato_sanjo_tsujimura_ninomiya-tsuji_yamamoto_kawai_takeuchi_akira_2006, title={TAK1 is indispensable for development of T cells and prevention of colitis by the generation of regulatory T cells}, volume={18}, ISSN={["1460-2377"]}, DOI={10.1093/intimm/dxl082}, abstractNote={Transforming growth factor (TGF)-beta-activating kinase 1 (TAK1) is critical for Toll-like receptor- and tumor necrosis factor-mediated cellular responses. In B cells, TAK1 is essential for the activation of mitogen-activated protein kinases (MAPKs), but not nuclear factor-kappaB (NF-kappaB), in antigen receptor signaling. In this study, we generate T cell-specific TAK1-deficient (Lck(Cre/(+))Tak1(flox/flox)) mice and show that TAK1 is indispensable for the maintenance of peripheral CD4 and CD8 T cells. In thymocytes, TAK1 is essential for TCR-mediated activation of both NF-kappaB and MAPKs. Additionally, Lck(Cre/(+))Tak1(flox/flox) mice developed colitis as they aged. In these mice, accumulations of activated/memory T cells as well as B cells were observed. Development of regulatory T (Treg) cells in thymus was abrogated in Lck(Cre/(+))Tak1(flox/flox) mice, suggesting that the loss of Treg cells is the cause of the disease. Together, the results show that TAK1, by controlling the generation of central Treg cells, is important for preventing spontaneously developing colitis.}, number={10}, journal={INTERNATIONAL IMMUNOLOGY}, author={Sato, Shintaro and Sanjo, Hideki and Tsujimura, Tohru and Ninomiya-Tsuji, Jun and Yamamoto, Masahiro and Kawai, Taro and Takeuchi, Osamu and Akira, Shizuo}, year={2006}, month={Oct}, pages={1405–1411} }
 @article{ninomiya-tsuji_matsumoto_2006, title={Tab1}, ISSN={1477-5921}, url={http://dx.doi.org/10.1038/mp.a002247.01}, DOI={10.1038/mp.a002247.01}, journal={AfCS-Nature Molecule Pages}, publisher={Springer Science and Business Media LLC}, author={Ninomiya-Tsuji, Jun and Matsumoto, Kunihiro}, year={2006}, month={Mar} }
 @article{ninomiya-tsuji_matsumoto_2006, title={Tak1}, ISSN={1477-5921}, url={http://dx.doi.org/10.1038/mp.a002249.01}, DOI={10.1038/mp.a002249.01}, journal={AfCS-Nature Molecule Pages}, publisher={Springer Science and Business Media LLC}, author={Ninomiya-Tsuji, Jun and Matsumoto, Kunihiro}, year={2006}, month={Jan} }
 @article{li_miller_ninomiya-tsuji_russell_young_2005, title={AMP-activated protein kinase activates p38 mitogen-activated protein kinase by increasing recruitment of p38 MAPK to TAB1 in the ischemic heart}, volume={97}, ISSN={["1524-4571"]}, DOI={10.1161/01.RES.0000187458.77026.10}, abstractNote={AMP-activated protein kinase (AMPK) promotes glucose transport, maintains ATP stores, and prevents injury and apoptosis during ischemia. AMPK has several direct molecular targets in the heart but also may interact with other stress-signaling pathways. This study examined the role of AMPK in the activation of the p38 mitogen-activated protein kinase (MAPK). In isolated heart muscles, the AMPK activator 5-aminoimidazole-4-carboxy-amide-1-β- d -ribofuranoside (AICAR) increased p38 MAPK activation. In AMPK-deficient mouse hearts, expressing a kinase-dead (KD) α 2 catalytic subunit, p38 MAPK activation was markedly reduced during low-flow ischemia (2.3- versus 7-fold in wild-type hearts, P <0.01) and was similarly reduced during severe no-flow ischemia in KD hearts ( P <0.01 versus ischemic wild type). Knockout of the p38 MAPK upstream kinase, MAPK kinase 3 (MKK3), did not affect ischemic activation of either AMPK or p38 MAPK in transgenic mkk3 −/− mouse hearts. Ischemia increased p38 MAPK recruitment to transforming growth factor-β-activated protein kinase 1–binding protein 1 (TAB1), a scaffold protein that promotes p38 MAPK autophosphorylation. Moreover, TAB1 was associated with the α 2 catalytic subunit of AMPK. p38 MAPK recruitment to TAB1/AMPK complexes required AMPK activation and was reduced in ischemic AMPK-deficient transgenic mouse hearts. The potential role of p38 MAPK in mediating the downstream action of AMPK to promote glucose transport was also assessed. The p38 MAPK inhibitor SB203580 partially inhibited both AICAR- and hypoxia-stimulated glucose uptake and GLUT4 translocation. Activation of p38 MAPK by anisomycin also increased glucose transport in heart muscles. Thus, AMPK has an important role in promoting p38 MAPK activation in the ischemic heart by inducing p38 MAPK autophosphorylation through interaction with the scaffold protein TAB1.}, number={9}, journal={CIRCULATION RESEARCH}, author={Li, J and Miller, EJ and Ninomiya-Tsuji, J and Russell, RR and Young, LH}, year={2005}, month={Oct}, pages={872–879} }
 @article{sato_sanjo_takeda_ninomiya-tsuji_yamamoto_kawai_matsumoto_takeuchi_akira_2005, title={Essential function for the kinase TAK1 in innate and adaptive immune responses}, volume={6}, ISSN={["1529-2916"]}, DOI={10.1038/ni1255}, number={11}, journal={NATURE IMMUNOLOGY}, author={Sato, S and Sanjo, H and Takeda, K and Ninomiya-Tsuji, J and Yamamoto, M and Kawai, T and Matsumoto, K and Takeuchi, O and Akira, S}, year={2005}, month={Nov}, pages={1087–1095} }
 @article{kishida_sanjo_akira_matsumoto_ninomiya-tsuji_2005, title={TAK1-binding protein 2 facilitates ubiquitination of TRAF6 and assembly of TRAF6 with IKK in the IL-1 signaling pathway}, volume={10}, ISSN={["1365-2443"]}, DOI={10.1111/j.1365-2443.2005.00852.x}, abstractNote={TAK1 mitogen-activated protein kinase kinase kinase participates in the Interleukin-1 (IL-1) signaling pathway by mediating activation of JNK, p38, and NF-κB. TAK1-binding protein 2 (TAB2) was previously identified as an adaptor that links TAK1 to an upstream signaling intermediate, tumor necrosis factor receptor-associated factor 6 (TRAF6). Recently, ubiquitination of TRAF6 was shown to play an essential role in the activation of TAK1. However, the mechanism by which IL-1 induces TRAF6 ubiquitination remains to be elucidated. Here we report that TAB2 functions to facilitate TRAF6 ubiquitination and thereby mediates IL-1-induced cellular events. A conserved ubiquitin binding domain in TAB2, the CUE domain, is important for this function. We also found that TAB2 promotes the assembly of TRAF6 with a downstream kinase, IκB kinase (IKK). These results show that TAB2 acts as a multifunctional signaling molecule, facilitating both IL-1-dependent TRAF6 ubiquitination and assembly of the IL-1 signaling complex.}, number={5}, journal={GENES TO CELLS}, author={Kishida, S and Sanjo, H and Akira, S and Matsumoto, K and Ninomiya-Tsuji, J}, year={2005}, month={May}, pages={447–454} }
 @article{safwat_ninomiya-tsuji_gore_miller_2005, title={Transforming growth factor beta-activated kinase 1 is a key mediator of ovine follicle-stimulating hormone beta-subunit expression}, volume={146}, ISSN={["1945-7170"]}, DOI={10.1210/en.2005-0457}, abstractNote={FSH, a key regulator of gonadal function, contains a beta-subunit (FSHbeta) that is transcriptionally induced by activin, a member of the TGFbeta-superfamily. This study used 4.7 kb of the ovine FSHbeta-promoter linked to luciferase (oFSHbetaLuc) plus a well-characterized activin-responsive construct, p3TPLuc, to investigate the hypothesis that Smad3, TGFbeta-activated kinase 1 (TAK1), or both cause activin-mediated induction of FSH. Overexpression of either Smad3 or TAK1 induced oFSHbetaLuc in gonadotrope-derived LbetaT2 cells as much as activin itself. Induction of p3TPLuc by activin is known to require Smad3 activation in many cell types, and this was true in LbetaT2 cells, where 10-fold induction by activin (2-8 h after activin treatment) was blocked more than 90% by two dominant negative (DN) inhibitors of Smad3 [DN-Smad3 (3SA) and DN-Smad3 (D407E)]. By contrast, 6.5-fold induction of oFSHbetaLuc by activin (10-24 h after activin treatment) was not blocked by either DN-Smad inhibitor, suggesting that activation of Smad3 did not trigger induction of oFSHbetaLuc. By contrast, inhibition of TAK1 by a DN-TAK1 construct led to a 50% decrease in activin-mediated induction of oFSHbetaLuc, and a specific inhibitor of TAK1 (5Z-7-Oxozeanol) blocked induction by 100%, indicating that TAK1 is necessary for activin induction of oFSHbetaLuc. Finally, inhibiting p38-MAPK (often activated by TAK1) blocked induction of oFSHbetaLuc by 60%. In conclusion, the data presented here indicate that activation of TAK1 (and probably p38-MAPK), but not Smad3, is necessary for triggering induction of oFSHbeta by activin.}, number={11}, journal={ENDOCRINOLOGY}, author={Safwat, N and Ninomiya-Tsuji, J and Gore, AJ and Miller, WL}, year={2005}, month={Nov}, pages={4814–4824} }
 @article{akiyama_yonezawa_kudo_li_wang_ito_yoshioka_ninomiya-tsuji_matsumoto_kanamaru_et al._2004, title={Activation mechanism of c-Jun amino-terminal kinase in the course of neural differentiation of P19 embryonic carcinoma cells}, volume={279}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M406610200}, abstractNote={P19 embryonic carcinoma cells, a model system for studying early development and differentiation, can differentiate into neurons and primitive endoderm-like cells depending on the culture conditions. We have previously reported that the activation of c-Jun amino-terminal kinase (JNK) is required for the retinoic acid-induced neural differentiation of P19 cells. However, the signaling pathway(s) responsible for the activation of JNK has not been known. In this study, we demonstrated that activities of MAPK kinase 4 (MKK4) and TAK1, one of the upstream kinases of MKK4, were enhanced in the neurally differentiating cells. Inhibition of the neural differentiation by an overexpression of protein phosphatase 2Cϵ, an inactivator of TAK1, suggested a critical role of the TAK1 signaling pathway during the differentiation. Confocal microscopic analysis indicated that TAK1, phospho-MKK4, and phospho-JNK were colocalized with tubulin in the neurites and localized also in the nuclei of the differentiating cells. In contrast, two TAK1-binding proteins, TAB1 and TAB2, which are involved in the activation of TAK1, were localized in the neurites and the nuclei of the differentiating cells, respectively. These results suggest that two distinct TAK1-MKK4-JNK signaling pathways are independently activated at the different intracellular locations and may participate in the regulation of the neural differentiation of P19 cells. P19 embryonic carcinoma cells, a model system for studying early development and differentiation, can differentiate into neurons and primitive endoderm-like cells depending on the culture conditions. We have previously reported that the activation of c-Jun amino-terminal kinase (JNK) is required for the retinoic acid-induced neural differentiation of P19 cells. However, the signaling pathway(s) responsible for the activation of JNK has not been known. In this study, we demonstrated that activities of MAPK kinase 4 (MKK4) and TAK1, one of the upstream kinases of MKK4, were enhanced in the neurally differentiating cells. Inhibition of the neural differentiation by an overexpression of protein phosphatase 2Cϵ, an inactivator of TAK1, suggested a critical role of the TAK1 signaling pathway during the differentiation. Confocal microscopic analysis indicated that TAK1, phospho-MKK4, and phospho-JNK were colocalized with tubulin in the neurites and localized also in the nuclei of the differentiating cells. In contrast, two TAK1-binding proteins, TAB1 and TAB2, which are involved in the activation of TAK1, were localized in the neurites and the nuclei of the differentiating cells, respectively. These results suggest that two distinct TAK1-MKK4-JNK signaling pathways are independently activated at the different intracellular locations and may participate in the regulation of the neural differentiation of P19 cells. c-Jun amino-terminal kinases (JNKs) 1The abbreviations used are: JNK, c-Jun amino-terminal kinase; MAPK, mitogen-activated protein kinase; MEK, MAPK/extracellular signal-regulated kinase kinase; MEKK, MEK kinase; MKK, MAPK kinase; MKKK, MAPK kinase kinase; SAPK, stress-activated protein kinase; RA, retinoic acid; PP2Cϵ, phosphatase 2Cϵ.1The abbreviations used are: JNK, c-Jun amino-terminal kinase; MAPK, mitogen-activated protein kinase; MEK, MAPK/extracellular signal-regulated kinase kinase; MEKK, MEK kinase; MKK, MAPK kinase; MKKK, MAPK kinase kinase; SAPK, stress-activated protein kinase; RA, retinoic acid; PP2Cϵ, phosphatase 2Cϵ. belong to the mitogen-activated protein kinase (MAPK) superfamily and are implicated in the regulation of diverse cellular functions. JNKs are activated by a variety of stimuli, including cellular stress exerted by protein synthesis inhibitors, UV, osmotic imbalance, and proinflammatory cytokines (1Garrington T.P. Johnson G.L. Curr. Opin. Cell Biol. 1999; 11: 211-218Crossref PubMed Scopus (1127) Google Scholar, 2Weston C.R. Davis R.J. Curr. Opin. Genet. Dev. 2002; 12: 14-21Crossref PubMed Scopus (602) Google Scholar). Recently, the JNK signaling pathway has been implicated in a number of cellular functions unrelated to stress responses, including proliferation and differentiation (3Davis R.J. Cell. 2000; 103: 239-252Abstract Full Text Full Text PDF PubMed Scopus (3593) Google Scholar, 4Mielke K. Herdegen T. Prog. Neurobiol. 2000; 61: 45-60Crossref PubMed Scopus (433) Google Scholar). Two MAPK kinases (MKKs), MKK4 (5Sanchez I. Hughes R.T. Mayer B.J. Yee K. Woodgett J.R. Avruch J. Kyriakis J.M. Zon L.I. Nature. 1994; 372: 794-798Crossref PubMed Scopus (913) Google Scholar, 6Yan M. Dai T. Deak J.C. Kyriakis J.M. Zon L.I. Woodgett J.R. Templeton D.J. Nature. 1994; 372: 798-800Crossref PubMed Scopus (658) Google Scholar) and MKK7 (7Tournier C. Whitmarsh A.J. Cavanagh J. Barrett T. Davis R.J. Proc. Natl. Acad. Sci. U. S. A. 1999; 94: 7337-7342Crossref Scopus (339) Google Scholar, 8Moriguchi T. Toyoshima F. Masuyama N. Hanafusa H. Gotoh Y. Nishida E. EMBO J. 1997; 16: 7045-7053Crossref PubMed Google Scholar) have been identified as JNK activators. These MKKs, in turn, are similarly activated by the phosphorylation of conserved serine and threonine residues by MAPK kinase kinase (MKKK) family members including the MEKK family (MEKK1, MEKK2, MEKK3, and MEKK4/MTK1), MLK family (MLK1, MLK2, MLK3, and dual leucine zipper kinase (DLK)), and TAK1 and ASK1 (9Minden A. Lin A. McMahon M. Lange-Carter C. Derijard B. Davis R.J. Johnson G.L. Karin M. Science. 1994; 266: 1719-1723Crossref PubMed Scopus (1010) Google Scholar, 10Deacon K. Blank J.L. J. Biol. Chem. 1997; 272: 14489-14496Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 11Gerwins P. Blank J.L. Johnson G.L. J. Biol. Chem. 1997; 272: 8288-8295Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar, 12Hirai S.-I. Katoh M. Terada M. Kyriakis J.M. Zon L.I. Rana A. Avruch J. Ohno S. J. Biol. Chem. 1997; 272: 15167-15173Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 13Tibbles L.A. Ing Y.L. Kiefer F. Chan J. Iscove N. Woodgett J.R. Lassam N.J. EMBO J. 1996; 15: 7026-7035Crossref PubMed Scopus (280) Google Scholar, 14Sakuma H. Ikeda A. Oka S. Kozutsumi Y. Zanetta J.P. Kawasaki T. J. Biol. Chem. 1997; 272: 28622-28629Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1169) Google Scholar, 16Ichijo H. Nishida E. Irie K. ten Dijke P. Saitoh M. Moriguchi T. Takagi T. Matsumoto K. Miyazono K. Gotoh Y. Science. 1997; 275: 90-94Crossref PubMed Scopus (1999) Google Scholar).P19 cells are murine embryonic carcinoma cells that have been used as a model system for studying early embryonic development and differentiation. P19 cells resemble the inner cell mass of early embryo and can differentiate to primitive endoderm-like cells, neuroectoderm-like cells, or muscle-like cells depending on the culture conditions (17Rudnicki M.A. McBurney M.W. Robertson E.J. A Practical Approach. Teratocarcinomas and Embryonic Stem Cells. IRL Press, Washington, D. C.1987: 19-49Google Scholar, 18Bain G. Ray W.J. Yao M. Gottlieb D.I. BioEssays. 1994; 16: 343-348Crossref PubMed Scopus (235) Google Scholar, 19Edwards M.K.S. McBurney M.W. Dev. Biol. 1983; 98: 187-191Crossref PubMed Scopus (215) Google Scholar). The treatment of aggregated P19 cells in a bacterial grade culture dish with low concentrations (10 nm) of retinoic acid (RA) followed by plating onto a tissue culture grade dish leads to differentiation to primitive endoderm-like cells, whereas the treatment of aggregated P19 cells with higher concentrations (1 μm) of RA results in their differentiation into neurons and glias (17Rudnicki M.A. McBurney M.W. Robertson E.J. A Practical Approach. Teratocarcinomas and Embryonic Stem Cells. IRL Press, Washington, D. C.1987: 19-49Google Scholar, 18Bain G. Ray W.J. Yao M. Gottlieb D.I. BioEssays. 1994; 16: 343-348Crossref PubMed Scopus (235) Google Scholar, 19Edwards M.K.S. McBurney M.W. Dev. Biol. 1983; 98: 187-191Crossref PubMed Scopus (215) Google Scholar).Studies on signaling systems responsible for RA-induced primitive endodermal and neural differentiation of P19 cells have indicated that the JNK signaling pathway plays an important role (20Jho E.H. Malbon C.C. J. Biol. Chem. 1997; 272: 24461-24467Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 21Jho E.H. Davis R.J. Malbon C.C. J. Biol. Chem. 1997; 272: 24468-24474Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 22Wang H. Ikeda S. Kanno S. Li M.G. Ohnishi M. Sasaki M. Kobayashi T. Tamura S. FEBS Lett. 2001; 503: 91-96Crossref PubMed Scopus (34) Google Scholar). Expression of Gα12 and Gα13 subunits of the heterotrimeric G-protein is enhanced in the course of RA-induced primitive endodermal differentiation of P19 cells. Overexpression of the constitutively active form of Gα12 activated JNK and induced primitive endodermal differentiation, even in the absence of RA treatment (20Jho E.H. Malbon C.C. J. Biol. Chem. 1997; 272: 24461-24467Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). In addition, expression of a dominant negative mutant of JNK suppressed the RA-induced primitive endodermal differentiation of P19 cells, indicating that JNK plays a pivotal role in the differentiation (20Jho E.H. Malbon C.C. J. Biol. Chem. 1997; 272: 24461-24467Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar). Recently, it has been reported that MEKK4 mediated JNK activation and differentiation of P19 cells to endoderm-like cells (23Kanungo J. Potapova I. Malbon C.C. Wang H. J. Biol. Chem. 2000; 275: 24032-24039Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar).We have previously reported that the activation of JNK was also required for the RA-induced neural differentiation of P19 cells (22Wang H. Ikeda S. Kanno S. Li M.G. Ohnishi M. Sasaki M. Kobayashi T. Tamura S. FEBS Lett. 2001; 503: 91-96Crossref PubMed Scopus (34) Google Scholar). However, the upstream signaling pathway responsible for the activation of JNK in the course of the neutral differentiation has not been elucidated. Here, we present evidence indicating that activity levels of MKK4 and TAK1 are enhanced in the neurally differentiating cells and that expression of protein phosphatase 2Cϵ (PP2Cϵ), an inactivator of TAK1 (24Li M.G. Katsura K. Nomiyama H. Komaki K. Ninomiya-Tsuji J. Matsumoto K. Kobayashi T. Tamura S. J. Biol. Chem. 2003; 278: 12013-12021Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar), inhibits the neural differentiation. Although TAK1, phospho-MKK4, and phospho-JNK were localized in both the nuclei and the neurites of the neurally differentiating cells, two adapter proteins involved in the activation of TAK1 were differently localized, suggesting that two TAK1-MKK4-JNK signaling pathways are independently activated at the different intracellular locations and may participate in the regulation of the neural differentiation of P19 cells.EXPERIMENTAL PROCEDURESReagents—JNK1 rabbit polyclonal antibody and MKK4 rabbit polyclonal antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-MKK7 rabbit polyclonal antibody was a generous gift from Dr. E. Nishida (Kyoto University, Kyoto, Japan). Phospho-specific JNK rabbit antibody and phospho-specific SEK1/MKK4 rabbit antibody were purchased from New England Biolabs (Beverly, MA). Anti-TAK1, anti-TAB1, and anti-TAB2 antibodies were already described (25Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar). Anti-α-tubulin mouse monoclonal antibody was purchased from Sigma. Cy3-conjugated goat anti-rabbit IgG was purchased from Jackson ImmunoResearch (West Grove, PA). Alexa Fluor 488-conjugated goat antimouse IgG was purchased from Molecular Probes (Eugene, OR).Cell Culture and Neural Differentiation—P19 cells were cultured in α-minimum essential medium (Invitrogen) supplemented with 10% (v/v) fetal calf serum. For neural differentiation, P19 cells were cultured in medium containing 1 μm RA in a bacterial grade culture dish for 4 days, and then the aggregates were plated onto a tissue culture grade dish as a monolayer and cultured for another 3 days in the absence of RA. For osmotic shock, undifferentiated P19 cells were incubated with medium supplemented with 0.7 m NaCl for 15 min at 37 °C.Immunoprecipitation and Kinase Assay—P19 cells were lysed in ice-cold lysis buffer (20 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 1% (v/v) Triton X-100, 50 mm NaF, 1 mm β-glycerophosphate, 2.5 mm sodium pyrophosphate, 1 mm Na3VO4, 2 μg/ml leupeptin, 1 mm phenylmethylsulfonyl fluoride, and 1 mm dithiothreitol). The cell lysates were incubated with the indicated antibodies (1 μg) at 4 °C for 1 h followed by incubation with 10 μl of protein G-Sepharose 4FF beads for 1 h. The beads were then washed three times with the lysis buffer. Activities of MKKs and JNK were determined using His-JNK3 (K55R) and GST-c-Jun, respectively, as the substrates (22Wang H. Ikeda S. Kanno S. Li M.G. Ohnishi M. Sasaki M. Kobayashi T. Tamura S. FEBS Lett. 2001; 503: 91-96Crossref PubMed Scopus (34) Google Scholar).Immunoblot Analysis—Immunoblot analysis was carried out as described previously except using the ECL system (Amersham Biosciences) to detect protein (22Wang H. Ikeda S. Kanno S. Li M.G. Ohnishi M. Sasaki M. Kobayashi T. Tamura S. FEBS Lett. 2001; 503: 91-96Crossref PubMed Scopus (34) Google Scholar).Northern Blotting—Total RNA (10 μg) was separated on 1.2% (w/v) agarose/0.67 m formaldehyde gel and subsequently transferred to a nylon membrane. Hybridization and washing conditions were described previously (27Sasahara Y. Kobayashi T. Onodera H. Onoda M. Ohnishi M. Kato S. Kusuda K. Shima H. Nagao M. Abe H. Yanagawa Y. Hiraga A. Tamura S. J. Biol. Chem. 1996; 271: 25950-25957Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar).Stable Transfection—P19 cells were co-transfected with pBABE that contains the puromycin-resistant gene and pCX-Myc empty vector or pCX-Myc-PP2Cϵ. Expression of Myc-PP2Cϵ was examined using anti-Myc antibody.Indirect Immunofluorescence—For immunofluorescence, cells were cultured on a poly-l-lysine-coated cover glass (Asahi Techno Glass, Tokyo, Japan) and then fixed for 15 min with 4% (w/v) paraformaldehyde. The fixed cells were permeabilized with 0.1% (v/v) Triton X-100, blocked for 30 min in phosphate-buffered saline containing 2% (v/v) normal goat serum, and subsequently incubated with the indicated first antibodies for 1 h at room temperature or overnight at 4 °C. After extensive washing with phosphate-buffered saline, the cells were incubated with the secondary antibody for 1 h at room temperature. After repeated washing with phosphate-buffered saline, the cover glass was prepared for immunofluorescence by mounting in VECTASHIELD (Vector Laboratories, Burlingame, CA). The cells were examined by confocal microscopy with a Zeiss LSM410 microscope (Carl Zeiss, Jena, Germany).RESULTSMKK4 Is Selectively Activated in the Course of RA-induced Neural Differentiation of P19 Cells—We have previously shown that the activation of JNK was required for the RA-induced neural differentiation of P19 cells using a dominant negative mutant of JNK (22Wang H. Ikeda S. Kanno S. Li M.G. Ohnishi M. Sasaki M. Kobayashi T. Tamura S. FEBS Lett. 2001; 503: 91-96Crossref PubMed Scopus (34) Google Scholar). However, the mechanism of the JNK activation was not clear. Therefore, we investigated the upstream signaling pathways of JNK in the P19 cells before and after the induction of neural differentiation. We compared the activities of MKK4 and MKK7, which are known to be the physiological activators of JNK, of the neurally differentiating cells with those of the undifferentiated or stress-treated cells. To determine the MKK4 and MKK7 activities of cell extracts, an immune complex kinase assay was performed using a kinase-negative mutant of JNK (His-JNK (K55R)) as the substrate. Interestingly, only MKK4 was substantially activated in the neurally differentiating cells, whereas both MKK4 and MKK7 were activated in response to stress (Fig. 1, b and c). MKK4 itself is known to be activated through phosphorylation by upstream kinases. Concomitant with the activation of MKK4, an increase in phosphorylation of MKK4 in the neurally differentiating cells was observed (Fig. 1d). In parallel with the activation of MKK4, JNK was also activated during the neural differentiation, confirming our previous observation (Fig. 1a) (22Wang H. Ikeda S. Kanno S. Li M.G. Ohnishi M. Sasaki M. Kobayashi T. Tamura S. FEBS Lett. 2001; 503: 91-96Crossref PubMed Scopus (34) Google Scholar). The degree of the activation of JNK in the neurally differentiating cells was similar to that induced by the addition of NaCl to the medium. These results indicated that MKK4, but not MKK7, was the major activator of JNK during the neural differentiation.TAK1 Is Activated in the Neurally Differentiating Cells—We were interested in identifying the MKKK that is responsible for the phosphorylation and activation of MKK4 in the neurally differentiating cells. Recently, a number of MKKKs that phosphorylate and activate MKK4 have been reported (9Minden A. Lin A. McMahon M. Lange-Carter C. Derijard B. Davis R.J. Johnson G.L. Karin M. Science. 1994; 266: 1719-1723Crossref PubMed Scopus (1010) Google Scholar, 10Deacon K. Blank J.L. J. Biol. Chem. 1997; 272: 14489-14496Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 11Gerwins P. Blank J.L. Johnson G.L. J. Biol. Chem. 1997; 272: 8288-8295Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar, 12Hirai S.-I. Katoh M. Terada M. Kyriakis J.M. Zon L.I. Rana A. Avruch J. Ohno S. J. Biol. Chem. 1997; 272: 15167-15173Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 13Tibbles L.A. Ing Y.L. Kiefer F. Chan J. Iscove N. Woodgett J.R. Lassam N.J. EMBO J. 1996; 15: 7026-7035Crossref PubMed Scopus (280) Google Scholar, 14Sakuma H. Ikeda A. Oka S. Kozutsumi Y. Zanetta J.P. Kawasaki T. J. Biol. Chem. 1997; 272: 28622-28629Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1169) Google Scholar, 16Ichijo H. Nishida E. Irie K. ten Dijke P. Saitoh M. Moriguchi T. Takagi T. Matsumoto K. Miyazono K. Gotoh Y. Science. 1997; 275: 90-94Crossref PubMed Scopus (1999) Google Scholar). Using Northern blot analysis, we first examined whether the mRNA levels of MEKK1, MEKK3, MEKK4/MTK1, ASK1, and TAK1 increased in the course of the differentiation. The results demonstrated that there was little difference in the expression levels of MEKK1, MEKK3, MEKK4/MTK1, and ASK1 between the undifferentiated cells and the neurally differentiating cells (Fig. 2a). In contrast, the expression level of TAK1 was substantially increased in the neurally differentiating cells (Fig. 2a). Therefore, we determined whether the protein level of TAK1 was also increased in accordance with the neural differentiation. TAK1 was immunoprecipitated with anti-TAK1 antibody from the cell lysates of undifferentiated and neurally differentiating cells. Immunoblot analysis using the anti-TAK1 antibody demonstrated that the TAK1 protein level was indeed enhanced in the neurally differentiating cells (Fig. 2b, upper panel). It has been established that TAB1, a TAK1-binding protein, associates with TAK1 and induces the activation of TAK1 by autophosphorylation in the cells (25Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (224) Google Scholar). Upon the activation of TAK1, TAB1 is phosphorylated. It is also known that TAB2, another TAK1-binding protein that mediates interleukin-1-induced signaling to TAK1, is also phosphorylated concomitant with the activation of TAK1 in vivo (28Qian Y. Commane M. Ninomiya-Tsuji J. Matsumoto K. Li X. J. Biol. Chem. 2001; 276: 41661-41667Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). The phosphorylation of the endogenous TAB1 by TAK1 can be monitored by its mobility shifts on Western blot analysis. Using this method, we determined whether phosphorylation of TAB1 by TAK1 is enhanced in the neurally differentiating cells. TAK1/TAB1 complex was first immunoprecipitated from the cell extracts with anti-TAK1 antibody and probed with anti-TAB1 antibody on immunoblot analysis (Fig. 2b, lower panel). An enhanced mobility shift of TAB1 was observed in the neurally differentiating cells, and this mobility shift was cancelled by the incubation of the immunoprecipitates with bacterial λ-phosphatase (Fig. 2d, left panel), indicating that the mobility shift was indeed caused by the enhanced phosphorylation of TAB1. Similar to TAB1, an increased mobility shift of TAB2 of the neurally differentiating cells was observed, which was also cancelled by the phosphatase treatment of the cell extracts (Fig. 2, c and d). Collectively, these observations indicate that TAK1 was activated in the neurally differentiating cells.Fig. 2TAK1 is activated in the neurally differentiating P19 cells. a, total RNA was prepared from the duplicated dishes of the undifferentiated P19 cells (indicated as Undif.) and the neurally differentiating cells (indicated as Neural). RNA was separated on an agarose gel containing formaldehyde, transferred to nylon membrane, and probed with 32P-labeled cDNAs as indicated (upper panels). The membranes were deprobed and reprobed with 32P-labeled cDNA of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to indicate equal loading of RNA samples (lower panels). b, aliquots of the cell extracts (0.5 mg of protein) from the undifferentiated (lanes 1 and 3) and the neurally differentiating cells (lanes 2 and 4) were immunoprecipitated (IP) with normal rabbit IgG (indicated by IgG) or anti-TAK1 antibody, and the immunoprecipitates were analyzed by immunoblotting with anti-TAK1 (upper panel) and anti-TAB1 (lower panel) antibodies. WB, Western blot. c, the lysates (10 μg) from the undifferentiated and neurally differentiating cells were analyzed by immunoblotting with anti-TAB2 antibody. d, the immunoprecipitates obtained from the neurally differentiating cells (panel b, lane 4) were incubated without (–) or with (+) λ-phosphatase (λ-phos) for 1 h and then immunoblotted with anti-TAB1 antibody (left panel). The lysates (10 μg) of the neurally differentiating cells were subjected to SDS-PAGE and analyzed by immunoblotting with anti-TAB2 antibody before and after λ-phosphatase treatment (right panel).View Large Image Figure ViewerDownload (PPT)PP2Cϵ Suppresses the Neural Differentiation of P19 Cells— We have recently reported that PP2Cϵ, a member of protein phosphatase 2C family, inactivated the SAPK signaling pathway by selectively associating with and dephosphorylating TAK1 (24Li M.G. Katsura K. Nomiyama H. Komaki K. Ninomiya-Tsuji J. Matsumoto K. Kobayashi T. Tamura S. J. Biol. Chem. 2003; 278: 12013-12021Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). PP2Cϵ gave no influence on the phosphorylation levels of the downstream components of TAK1 such as MKK4 and JNK. To test whether the activation of the TAK1 signaling pathway is required for the neural differentiation of P19 cells, we expressed PP2Cϵ stably in P19 cells and determined the effect of PP2Cϵ expression on the differentiation. The results demonstrated that the neural differentiation was markedly suppressed by the expression of PP2Cϵ (Fig. 3, a and b). Interestingly, expression level of endogenous PP2Cϵ mRNA was substantially enhanced at day 4 (aggregation culture) of the RA-induced neural differentiation process of P19 cells, and the expression was further enhanced at day 7 (Fig. 3c).Fig. 3PP2Cϵ suppresses the neural differentiation of P19 cells. a, empty vector (lane 1) or expression plasmid of Myc-tagged PP2Cϵ (lane 2) was stably transfected to P19 cells, and the expressed proteins were detected with anti-Myc antibody. b, P19 stable transfectants (left panel, empty vector; right panel, PP2Cϵ expression vector) were treated with 1 μm RA and immunostained with anti-tubulin antibody. c, P19 cells (day 0) were cultured in the absence or presence of 1 μm RA on a bacterial grade culture dish for 4 days and then grown on a tissue culture grade dish containing medium without RA for another 3 days. Total mRNAs were prepared at days 0, 4, and 7, and Northern blot analysis was carried out using PP2Cϵ cDNA (upper panel) or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (lower panel) as the probe.View Large Image Figure ViewerDownload (PPT)TAB1 and TAB2 Are Differentially Localized in the Neurally Differentiating Cells—We performed confocal microscopic analysis to determine the subcellular localization of phospho-JNK and phospho-MKK4 in the cells before and during neural differentiation. Both phospho-JNK and phospho-MKK4 were localized exclusively in the nucleus in the undifferentiated P19 cells (data not shown). In contrast, in the neurally differentiating cells, both the phospho-JNK and the phospho-MKK4 were colocalized with tubulin in the neurites (Fig. 4, a and b). Both of them were also detected in the nuclei, although the signals of phospho-JNK in the nuclei were much weaker than those in the neurites.Fig. 4Subcellular localization of phospho-JNK, phospho-MKK4, TAK1, TAB1, and TAB2 in the neurally differentiating P19 cells. a–e, P19 cells during neural differentiation were fixed with paraformaldehyde, and the proteins were detected using specific antibodies as indicated followed by incubation with Cy3-conjugated goat anti-rabbit IgG antibody. The cells were double-stained with anti-tubulin antibody followed by incubation with Alexa 488-conjugated goat anti-mouse IgG antibody. Hoechst 33258 dye was used to show the nuclei. The scale bar indicates 25 μm.View Large Image Figure ViewerDownload (PPT)Studies of subcellular localization of TAK1, TAB1, and TAB2 in the neurally differentiating cells revealed that, whereas TAK1 was colocalized with tubulin in the neurites and also localized in the cell nuclei (Fig. 4c), TAB1 was predominantly colocalized with tubulin in the neurites (Fig. 4d), and TAB2 was mainly localized in the nuclei of the neurally differentiating cells (Fig. 4e).DISCUSSIONIn this study, we investigated the signaling pathway responsible for the sustained activation of JNK, which is required for the RA-induced neural differentiation of P19 cells. We observed the enhanced activities of JNK, MKK4, and TAK1 in the neurally differentiating cells (Figs. 1 and 2). All of these proteins were colocalized with tubulin in the neurites and also localized in the cell nuclei (Fig. 4). These observations suggest that the TAK1-MKK4 signaling pathway participates in the activation of JNK in the course of neural differentiation of P19 cells. Recently, we have shown that PP2Cϵ interacted selectively with TAK1 and inactivated it by dephosphorylation (24Li M.G. Katsura K. Nomiyama H. Komaki K. Ninomiya-Tsuji J. Matsumoto K. Kobayashi T. Tamura S. J. Biol. Chem. 2003; 278: 12013-12021Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). PP2Cϵ did not dephosphorylate downstream components of TAK1 such as MKK4/7 and JNK/p38. These results suggested that PP2Cϵ acts as a specific inactivator of TAK1 in the SAPK signaling pathway. Inhibition of the neural differentiation of P19 cells by overexpression of PP2Cϵ supports the idea that the activation of TAK1 plays an important role in the differentiation (Fig. 3b). The observation that PP2Cϵ mRNA level increases in the course of differentiation may suggest that endogenous PP2Cϵ indeed participates in the fine regulation of the phosphorylation level of TAK1 during the differentiation (Fig. 3c).Interestingly, two endogenous TAK1-binding proteins were differently localized in the neurally differentiating cells. Thus, TAB1 was colocalized with tubulin in the neurites, and TAB2 was mainly localized in the cell nuclei (Fig. 4, d and e). TAB1 and TAB2 have been reported to participate in the tumor growth factor-β family and interleukin-1-induced activations of TAK1, respectively (15Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1169) Google Scholar, 29Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1010) Google Scholar). Both the membranous and the nuclear localizations of TAB2 have been reported previously (30Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2474-2484Crossref Scopus (159) Google Scholar, 31Baek S.H. Ohgi K.A. Rose D.W. Koo E.H. Glass C.K. Rosenfeld M.G. Cell. 2002; 110: 55-67Abstract Full Text Full Text PDF PubMed Scopus (492) Google Scholar). Therefore, the different subcellular localization of TAB1 and TAB2 in the neurally differentiating cells may indicate that JNKs in the neurites and the cell nuclei are independently activated by two different TAK1 signaling pathways, each activated by different extracellular stimulus.The sustained activation of JNK has also been reported in the differentiating cerebellar granule neurons of rats, although both MKK4 and MKK7 were activated in this case (32Coffey E.T. Hongisto V. Dicke}, number={35}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Akiyama, S and Yonezawa, T and Kudo, TA and Li, MG and Wang, H and Ito, M and Yoshioka, K and Ninomiya-Tsuji, J and Matsumoto, K and Kanamaru, R and et al.}, year={2004}, month={Aug}, pages={36616–36620} }
 @article{takeda_matsuzawa_nishitoh_tobiume_kishida_ninomiya‐tsuji_matsumoto_ichijo_2004, title={Involvement of ASK1 in Ca
            2+
            ‐induced p38 MAP kinase activation}, volume={5}, ISSN={1469-221X 1469-3178}, url={http://dx.doi.org/10.1038/sj.embor.7400072}, DOI={10.1038/sj.embor.7400072}, abstractNote={The mammalian mitogen-activated protein (MAP) kinase kinase kinase apoptosis signal-regulating kinase 1 (ASK1) is a pivotal component in cytokine- and stress-induced apoptosis. It also regulates cell differentiation and survival through p38 MAP kinase activation. Here we show that Ca2+ signalling regulates the ASK1-p38 MAP kinase cascade. Ca2+ influx evoked by membrane depolarization in primary neurons and synaptosomes induced activation of p38, which was impaired in those derived from ASK1-deficient mice. Ca2+/calmodulin-dependent protein kinase type II (CaMKII) activated ASK1 by phosphorylation. Moreover, p38 activation induced by the expression of constitutively active CaMKII required endogenous ASK1. Thus, ASK1 is a critical intermediate of Ca2+ signalling between CaMKII and p38 MAP kinase.}, number={2}, journal={EMBO reports}, publisher={EMBO}, author={Takeda, Kohsuke and Matsuzawa, Atsushi and Nishitoh, Hideki and Tobiume, Kei and Kishida, Satoshi and Ninomiya‐Tsuji, Jun and Matsumoto, Kunihiro and Ichijo, Hidenori}, year={2004}, month={Jan}, pages={161–166} }
 @article{ono_ohtomo_ninomiya-tsuji_tsuchiya_2003, title={A dominant negative TAK1 inhibits cellular fibrotic responses induced by TGF-beta}, volume={307}, ISSN={["0006-291X"]}, DOI={10.1016/S0006-291X(03)01207-5}, abstractNote={Transforming growth factor-beta (TGF-beta) is crucially virulent in the progression of fibrotic disorders. TAK1 (TGF-beta activated kinase 1) is one of the mitogen-activated kinase kinase kinase (MAPKKK) that is involved in TGF-beta signal transduction. To elucidate the importance of TAK1 in TGF-beta-induced fibrotic marker expression, we investigated whether dominant negative TAK1 could suppress TGF-beta signaling. Based on the finding that TAB1 (TAK1 binding protein 1) binding to TAK1 is required for TAK1 activation, a minimal portion of TAK1 lacking kinase activity that binds to TAB1 was designed as a TAK1 dominant negative inhibitor (TAK1-DN). The effect of TAK1-DN was assessed in the cells that respond to TGF-beta stimulation and that lead to the increase in production of extracellular matrix (ECM) proteins. TAK1-DN, indeed, decreased the ECM protein production, indicating that TAK1-DN retains the ability to intercept the TGF-beta signaling effectively.}, number={2}, journal={BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS}, author={Ono, K and Ohtomo, T and Ninomiya-Tsuji, J and Tsuchiya, M}, year={2003}, month={Jul}, pages={332–337} }
 @article{ninomiya-tsuji_kajino_ono_ohtomo_matsumoto_shiina_mihara_tsuchiya_matsumoto_2003, title={A resorcylic acid lactone, 5Z-7-oxozeaenol, prevents inflammation by inhibiting the catalytic activity of TAK1 MAPK kinase kinase}, volume={278}, ISSN={["0021-9258"]}, DOI={10.1074/jbc.M207453200}, abstractNote={TAK1, a member of the mitogen-activated kinase kinase kinase (MAPKKK) family, participates in proinflammatory cellular signaling pathways by activating JNK/p38 MAPKs and NF-κB. To identify drugs that prevent inflammation, we screened inhibitors of TAK1 catalytic activity. We identified a natural resorcylic lactone of fungal origin, 5Z-7-oxozeaenol, as a highly potent inhibitor of TAK1. This compound did not effectively inhibit the catalytic activities of the MEKK1 or ASK1 MAPKKKs, suggesting that 5Z-7-oxozeaenol is a selective inhibitor of TAK1. In cell culture, 5Z-7-oxozeaenol blocked interleukin-1-induced activation of TAK1, JNK/p38 MAPK, IκB kinases, and NF-κB, resulting in inhibition of cyclooxgenase-2 production. Furthermore, in vivo 5Z-7-oxozeaenol was able to inhibit picryl chloride-induced ear swelling. Thus, 5Z-7-oxozeaenol blocks proinflammatory signaling by selectively inhibiting TAK1 MAPKKK. TAK1, a member of the mitogen-activated kinase kinase kinase (MAPKKK) family, participates in proinflammatory cellular signaling pathways by activating JNK/p38 MAPKs and NF-κB. To identify drugs that prevent inflammation, we screened inhibitors of TAK1 catalytic activity. We identified a natural resorcylic lactone of fungal origin, 5Z-7-oxozeaenol, as a highly potent inhibitor of TAK1. This compound did not effectively inhibit the catalytic activities of the MEKK1 or ASK1 MAPKKKs, suggesting that 5Z-7-oxozeaenol is a selective inhibitor of TAK1. In cell culture, 5Z-7-oxozeaenol blocked interleukin-1-induced activation of TAK1, JNK/p38 MAPK, IκB kinases, and NF-κB, resulting in inhibition of cyclooxgenase-2 production. Furthermore, in vivo 5Z-7-oxozeaenol was able to inhibit picryl chloride-induced ear swelling. Thus, 5Z-7-oxozeaenol blocks proinflammatory signaling by selectively inhibiting TAK1 MAPKKK. MAPKK kinase MAPK kinase mitogen-activated protein kinase interleukin-1 tumor necrosis factor c-Jun N-terminal kinase IκB kinase epidermal growth factor extracellular signal-regulated kinase picryl chloride cyclooxgenase 2 glutathione S-transferase TAK1 is a member of the mitogen-activated protein kinase kinase kinase (MAPKKK)1family that phosphorylates and activates MKK3, MKK4, MKK6, and MKK7 MAPKKs, which in turn activate the c-Jun N-terminal kinase (JNK) and p38 MAPKs (1Moriguchi T. Kuroyanagi N. Yamaguchi K. Gotoh Y. Irie K. Kano T. Shirakabe K. Muro Y. Shibuya H. Matsumoto K. Nishida E. Hagiwara M. J. Biol. Chem. 1996; 271: 13675-13679Abstract Full Text Full Text PDF PubMed Scopus (407) Google Scholar, 2Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 3Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1178) Google Scholar). We have recently demonstrated that TAK1 also activates IκB kinases (IKKs), ultimately leading to activation of the transcription factor NF-κB (4Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). TAK1 participates in proinflammatory cellular signaling pathways such as the interleukin-1 (IL-1) pathway by activating both JNK/p38 MAPKs and IKKs. Exposure of cells to IL-1 induces the interaction between endogenous TAK1 and TRAF6 (tumor necrosis factor (TNF)receptor-associated factor6), a molecule essential for IL-1 activation of both JNK/p38 and NF-κB. This interaction in turn leads to TAK1 activation. We have previously identified two TAK1-binding proteins, TAB1 and TAB2 (5Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar, 6Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (495) Google Scholar). When ectopically co-expressed, TAB1 augments the kinase activity of TAK1, indicating that TAB1 functions as an activator of TAK1 (5Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar, 7Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (228) Google Scholar). TAB2 functions as an adaptor linking TAK1 to TRAF6 by directly binding to both, thereby mediating TAK1 activation in the IL-1 signaling pathway (6Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Abstract Full Text Full Text PDF PubMed Scopus (495) Google Scholar, 8Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (160) Google Scholar). Several lines of evidence suggest that TAK1 is a key molecule in proinflammatory signaling pathways. Various proinflammatory cytokines and endotoxins activate the kinase activity of endogenous TAK1 (4Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar, 9Irie T. Muta T. Takeshige K. FEBS Lett. 2000; 467: 160-164Crossref PubMed Scopus (166) Google Scholar, 10Sakurai H. Miyoshi H. Toriumi W. Sugita T. J. Biol. Chem. 1999; 274: 10641-10648Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). Overexpression of kinase-dead TAK1 inhibits IL-1- and TNF-induced activation of both JNK/p38 and NF-κB (4Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar, 10Sakurai H. Miyoshi H. Toriumi W. Sugita T. J. Biol. Chem. 1999; 274: 10641-10648Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). The Drosophila homolog of TAK1 was recently identified as an essential molecule for host defense signaling in Drosophila(11Vidal S. Khush R.S. Leulier F. Tzou P. Nakamura M. Lemaitre B. Genes Dev. 2001; 15: 1900-1912Crossref PubMed Scopus (251) Google Scholar). Furthermore, the TAK1 gene-silencing study using the small interfering RNA method defined that TAK1 is essential for both IL-1- and TNF-induced NF-κB activation in mammalian cells (12Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (322) Google Scholar). Therefore, it can be expected that inhibition of TAK1 activity may be effective in preventing inflammation and tissue destruction promoted by proinflammatory cytokines. In this study, we screened for compounds that can inhibit TAK1 kinase activity. This strategy resulted in the isolation of one natural compound 5Z-7-oxozeaenol, a resorcylic lactone of fungal origin. We found that 5Z-7-oxozeaenol inhibited the kinase activity of purified TAK1, whereas no significant inhibition of TAK1 activity was observed with structurally related compounds including radicicol. 5Z-7-Oxozeaenol had no significant effect on the kinase activities of other members of the MAPKKK family such as MEKK1 and ASK1. Exposure of cells to 5Z-7-oxozeaenol blocked IL-1-induced activation of TAK1, IKK, JNK, p38, and NF-κB. Furthermore, 5Z-7-oxozeaenol inhibited IL-1-induced production of cyclooxygenase-2 and relieved ear swelling induced by picryl chloride. These results suggest that 5Z-7-oxozeaenol blocks proinflammatory signaling by selectively inhibiting TAK1 MAPKKK. Zeaenol analog and radicicol were prepared from the culture broth of fungal strain f6024 and f6065, respectively. Recombinant human IL-1β (Roche Applied Science), recombinant human TNFα (Roche Applied Science), and epidermal growth factor (EGF) (BD Biosciences) were used. The following antibodies were used: anti-TAK1 polyclonal antibody M-17 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-FLAG monoclonal antibody M2 (Sigma), anti-phosphoextracellular signal-regulated kinase (ERK) (Thr-202/Tyr-204) polyclonal antibody (Cell Signaling), anti-ERK polyclonal antibody (Cell Signaling), anti-phospho-JNK (Thr-183/Tyr-185) monoclonal antibody (Cell Signaling), anti-JNK polyclonal antibody FL (Santa Cruz Biotechnology), anti-phospho-p38 (Thr-180/Tyr-182) polyclonal antibody (Cell Signaling), anti-p38 polyclonal antibody (Cell Signaling), anti-IKKα polyclonal antibody H-744 (Santa Cruz Biotechnology), and anti-cyclooxygenase-2 polyclonal antibody M-19 (Santa Cruz Biotechnology). The rabbit anti-TAK1 and anti-TAB1 polyclonal antibodies (4Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar) were also used to immunoprecipitate and/or detect endogenous TAK1 and TAB1 in 293-IL-1RI cells (13Cao Z. Henzel W.J. Gao X. Science. 1996; 271: 1128-1131Crossref PubMed Scopus (777) Google Scholar). Expression vectors for FLAG-TAK1, FLAG-MEKK1ΔN, FLAG-ASK1, NF-κB-interacting kinase, and FLAG-IKKβ were described previously (4Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar, 14Hirai S. Izawa M. Osada S. Spyrou G. Ohno S. Oncogene. 1996; 12: 641-650PubMed Google Scholar, 15Mochida Y. Takeda K. Saitoh M. Nishitoh H. Amagasa T. Ninomiya-Tsuji J. Matsumoto K. Ichijo H. J. Biol. Chem. 2000; 275: 32747-32752Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 16Woronicz J.D. Gao X. Cao Z. Rothe M. Goeddel D.V. Science. 1997; 278: 866-869Crossref PubMed Scopus (1068) Google Scholar). Purified MEKK1 and MEK1 were purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). 293-IL-1RI cells and mouse embryonic fibroblast cells were maintained in high glucose Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, penicillin G (100 units/ml) and streptomycin (100 μg/ml). For the transfection studies, cells (1 × 106) were plated in 10-cm dishes, transfected with a total of 10 μg of DNA containing various expression vectors by the calcium phosphate precipitate method, and incubated for 24–36 h before stimulation. Cells were washed once with ice-cold phosphate-buffered saline and lysed in 0.3 ml of 0.5% Triton X-100 lysis buffer containing 20 mm HEPES (pH 7.4), 150 mm NaCl, 12.5 mmβ-glycerophosphate, 1.5 mm MgCl2, 2 mm EGTA, 10 mm NaF, 2 mmdithiothreitol, 1 mm sodium orthovanadate, 1 mmphenylmethylsulfonyl fluoride, and 20 μm aprotinin. Cellular debris was removed by centrifugation at 10,000 ×g for 5 min. Proteins from cell lysates were immunoprecipitated with 1 μg of various antibodies and 20 μl of protein G-Sepharose (Amersham Biosciences). The immune complexes were washed three times with wash buffer containing 20 mm HEPES (pH 7.4), 500 mm NaCl, and 10 mmMgCl2, and once with rinse buffer containing 20 mm HEPES (pH 7.4), 150 mm NaCl, and 10 mm MgCl2 and suspended in 30 μl of rinse buffer. For immunoblotting, the immunoprecipitates or whole cell lysates were resolved on SDS-PAGE and transferred to Hybond-P membranes (Amersham Biosciences). The membranes were immunoblotted with various antibodies, and the bound antibodies were visualized with horseradish peroxidase-conjugated antibodies against rabbit or mouse IgG using the ECL Western blotting system (Amersham Biosciences). For screening TAK1 inhibitors, insect expression vectors for TAK1 and TAB1 were co-infected into Sf9 cells. After 2 days of incubation, cell lysates were immunoprecipitated with anti-TAK1 antibody (M-17). The immunoprecipitates were incubated with various compounds and subsequently incubated with 2 μg of myelin basic protein and 10 μCi of [γ-32P]ATP (3,000 Ci/mmol) in 10 μl of the kinase buffer containing 10 mmHEPES (pH 7.4), 1 mm dithiothreitol, 5 mmMgCl2 at 30 °C for 5 min. Samples were separated by 10% SDS-PAGE, and 32P incorporated into myelin basic protein was quantified with a bioimage analyzer (FUJIX BAS2000). The catalytic activity of MEK1 was determined by activation of ERK2 (Upstate Biotechnology) to phosphorylate myelin basic protein according to the manufacturer's procedure. The catalytic activity of MEKK1 was measured with 2 μg of myelin basic protein as a substrate in the kinase buffer. For subsequent kinase assays, immunoprecipitates were incubated with 5 μCi of [γ-32P]ATP (3,000 Ci/mmol) and 1 μg of bacterially expressed MKK6 or GST-IκBα-(1–72) in 10 μl of the kinase buffer at 25 °C for 2 min. Samples were separated by 10% SDS-PAGE and visualized by autoradiography. Assays for reporter gene activity were performed as described (4Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). An Ig-κ-luciferase reporter was used to measure NF-κB-dependent transcription. A plasmid containing the β-galactosidase gene under the control of the β-actin promoter (pAct-β-galactosidase) was used for normalizing transfection efficiency. Female BALB/c mice (6 weeks old) were sensitized by applying 0.1 ml of picryl chloride (50 mg/ml) in an olive oil/acetone solution (1:5, v/v) to the shaved abdomen of the mice at day 0. Seven days later, 10 μl of picryl chloride solution (10 mg/ml) in olive oil was applied to each side of the right ear (PC challenge). At day 10, mice were resensitized with picryl chloride. At day 17, the PC challenge was repeated (second PC challenge). Ten μl of 1 mg/ml 5Z-7-oxozeaenol or vehicle alone (ethanol) were painted on each side of the right ear before and after the second PC challenge. The ear thickness was measured with calibrated digital thickness gauges before and 24 h after the second PC challenge, and the difference in thickness was calculated. We have previously shown that TAK1 has no kinase activity when expressed alone but is activated when TAB1 is co-expressed (5Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar, 7Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (228) Google Scholar). To identify inhibitors of TAK1, we developed an in vitro kinase assay system using purified TAK1 and TAB1 proteins expressed in insect cells. We tested 90 compounds, including 59 compounds that have been reported to inhibit protein kinases, 24 oxindole-related compounds, and 7 resorcylic acid lactone-related compounds. Of these compounds, one resorcylic acid lactone-related compound, 5Z-7-oxozeaenol, was found to be a very potent inhibitor of TAK1, with an IC50 of 8 nm (Fig.1A and TableI). Other structurally related compounds such as radicicol had little inhibitory activity, with an IC50 of >10 μm. The remaining 89 compounds did not exhibit any effective inhibition of TAK1. These included oxindole protein-tyrosine kinase inhibitors (SU5402 and SU4984), staurosporine-related protein kinase C inhibitors, the platelet-derived growth factor receptor inhibitor AG1433, and the plant flavonoid apigenin. Two compounds, Ro092210 and L783277, with very similar structures to 5Z-7-oxozeaenol were previously demonstrated to inhibit MEK kinase activity (17Williams D.H. Wilkinson S.E. Purton T. Lamont A. Flotow H. Murray E.J. Biochemistry. 1998; 37: 9579-9585Crossref PubMed Scopus (58) Google Scholar, 18Zhao A. Lee S.H. Mojena M. Jenkins R.G. Patrick D.R. Huber H.E. Goetz M.A. Hensens O.D. Zink D.L. Vilella D. Dombrowski A.W. Lingham R.B. Huang L. J. Antibiot. 1999; 52: 1086-1094Crossref PubMed Scopus (111) Google Scholar). We examined the effect of 5Z-7-oxozeaenol on purified rat MEK1 kinase activity (Fig.1B). 5Z-7-Oxozeaenol did inhibit MEK1 kinase activity; however, the IC50 of 5Z-7-oxozeaenol required to inhibit MEK1 is 411 nm, which is 50-fold higher than that for TAK1.Table IInhibitory activity of compounds on TAK1View Large Image Figure ViewerDownload (PPT)* IC50 values are means from two or three independent experiments (n = 3). Open table in a new tab * IC50 values are means from two or three independent experiments (n = 3). To explore the mechanism for 5Z-7-oxozeaenol inhibition of TAK1, we examined whether 5Z-7-oxozeaenol is competitive with ATP. We incubated increasing concentrations of ATP and 5Z-7-oxozeaenol with purified TAK1 and subsequently assayed kinase activity of TAK1. We found that the IC50 of 5Z-7-oxozeaenol required to inhibit TAK1 shifted to higher values with increasing ATP concentrations (Fig. 1D), suggesting that 5Z-7-oxozeaenol is a competitive inhibitor of ATP binding to TAK1. When 5Z-7-oxozeaenol was preincubated with TAK1 for 30 min before the addition of ATP, the IC50 values of 5Z-7-oxozeaenol did not shift with increasing ATP concentrations (Fig. 1D), suggesting that the binding of 5Z-7-oxozeaenol to TAK1 is either irreversible or very slowly reversible. Thus, 5Z-7-oxozeaenol is likely to irreversibly interact within the ATP binding site of TAK1, thereby inhibiting the catalytic activity of TAK1. To evaluate whether 5Z-7-oxozeaenol is a specific inhibitor of TAK1 or if it more generally inhibits the MAPKKK family, we tested the effect of 5Z-7-oxozeaenol on bacterially expressed MEKK1 kinase activity in vitro (Fig.1C). 5Z-7-Oxozeaenol had a weak effect on MEKK1 kinase activity. The IC50 of 5Z-7-oxozeaenol required to inhibit MEKK1 was 268 nm. To further verify the effects of 5Z-7-oxozeaenol on MAPKKKs, we utilized ectopically expressed MAPKKKs in 293 cells. TAK1 is known to be active when it is co-expressed together with TAB1 (5Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Crossref PubMed Scopus (524) Google Scholar, 7Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (228) Google Scholar). When N-terminal truncated MEKK1 (MEKK1ΔN) or the full-length ASK1 is overexpressed in 293 cells, they are catalytically active (19Ichijo H. Nishida E. Irie K. ten Dijke P. Saitoh M. Moriguchi T. Takagi M. Matsumoto K. Miyazono K. Gotoh Y. Science. 1997; 275: 90-94Crossref PubMed Scopus (2037) Google Scholar, 20Yan M. Dai T. Deak J.C. Kyriakis J.M. Zon L.I. Woodgett J.R. Templeton D.J. Nature. 1994; 372: 798-800Crossref PubMed Scopus (660) Google Scholar). FLAG-tagged TAK1 together with TAB1, FLAG-MEKK1ΔN, or FLAG-ASK1 was expressed in 293 cells, and each kinase was immunoprecipitated with anti-FLAG antibody. We measured their abilities both to autophosphorylate themselves and to phosphorylate MAPKK MKK6 (Fig. 2). In this assay, 5Z-7-oxozeaenol inhibited autophosphorylation of TAK1 and TAK1 activity to phosphorylate MKK6 at concentrations of 30–300 nm. By contrast, no inhibitory effect of 5Z-7-oxozeaenol was observed on MEKK1 or ASK1. The kinase activity of another MAPKKK, MEKK4, was also not inhibited by 5Z-7-oxozeaenol at concentrations as high as 500 nm (data not shown). Thus, 5Z-7-oxozeaenol is potent and selective inhibitor of TAK1. We have previously demonstrated that TAK1 is involved in the IL-1 signaling pathway (4Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar). The observation that 5Z-7-oxozeaenol inhibits TAK1 activity raised the possibility that this compound might be an effective inhibitor of IL-1 signaling. Treatment of cells with IL-1 activates endogenous TAK1 activity and consequently stimulates the MAPK cascade and IKK, leading to the activation of JNK/p38 MAPKs and NF-κB, respectively. To verify if 5Z-7-oxozeaenol can inhibit IL-1 signaling, we test for the effect of 5Z-7-oxozeaenol on NF-κB-dependent transcriptional activation induced by IL-1 (Fig.3A). We found that treatment of cells with 5Z-7-oxozeaenol effectively inhibited IL-1-induced activation of NF-κB. NF-κB is activated through several pathways including human T-cell leukemia virus Tax protein and TNF pathways. TAK1 is implicated in TNF-induced NF-κB activation (10Sakurai H. Miyoshi H. Toriumi W. Sugita T. J. Biol. Chem. 1999; 274: 10641-10648Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar, 12Takaesu G. Surabhi R.M. Park K.J. Ninomiya-Tsuji J. Matsumoto K. Gaynor R.B. J. Mol. Biol. 2003; 326: 105-115Crossref PubMed Scopus (322) Google Scholar), whereas MEKK1 is involved in Tax-induced NF-κB activation (21Yin M.J. Christerson L.B. Yamamoto Y. Kwak Y.T. Xu S. Mercurio F. Barbosa M. Cobb M.H. Gaynor R.B. Cell. 1998; 93: 875-884Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar). NF-κB can also be activated in the absence of extracellular signals by overexpression of TAK1 and TAB1 together or by NF-κB-interacting kinase alone (4Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Crossref PubMed Scopus (1023) Google Scholar, 22Malinin N.L. Boldin M.P. Kovalenko A.V. Wallach D. Nature. 1997; 385: 540-544Crossref PubMed Scopus (1166) Google Scholar). To examine whether the effect of 5Z-7-oxozeaenol is specific to NF-κB activation mediated by TAK1, cells were treated with TNF or transfected TAK1, TAB1, Tax, or NF-κB-interacting kinase expression vectors. We found that 5Z-7-oxozeaenol treatment effectively inhibited activation of NF-κB induced by TNF and overexpression of TAK1 and TAB1, whereas it had marginal inhibitory effect on activation of NF-κB induced by overexpression of Tax or NF-κB-interacting kinase (Fig. 3A). These results suggest that 5Z-7-oxozeaenol specifically inhibits NF-κB activation by blocking TAK1 activity. The IC50 value of 5Z-7-oxozeaenol required to inhibit NF-κB activation by overexpression of TAK1 and TAB1 was 83 nm (Fig. 3B). This IC50 is 10-fold higher than that required to inhibit purified TAK1 in vitro(Fig. 1A). We next examined whether 5Z-7-oxozeaenol inhibits IL-1-induced JNK/p38 activation. We pretreated 293-IL-1RI cells with increasing amounts of 5Z-7-oxozeaenol and stimulated the cells with IL-1 treatment. The activated JNK and p38 were detected with anti-phospho-JNK and -p38 antibodies that specifically recognize the dually phosphorylated activated forms of JNK1/JNK2 and p38, respectively (Fig. 4A). IL-1-dependent JNK/p38 activation was abrogated with treatment of 5Z-7-oxozeaenol in a dose-dependent manner. The amount of 5Z-7-oxozeaenol required to inhibit IL-1-induced JNK/p38 activation was in a similar range to that required for NF-κB inhibition. To further examine the specificity of 5Z-7-oxozeaenol, we tested the effect of 5Z-7-oxozeaenol on MAPK cascades activated by several other stimuli. Hydrogen peroxide is a strong stimulator of JNK/p38; however, it poorly activates TAK1 in 293-IL-1RI cells, 2J. Ninomiya-Tsuji, unpublished result. suggesting that TAK1 is not involved in this pathway. 293-IL-1RI cells were treated with 5Z-7-oxozeaenol for 30 min followed by hydrogen peroxide simulation (Fig. 4B). No pronounced inhibition of either JNK or p38 activation was observed in 5Z-7-oxozeaenol-treated cells. We also assayed UV- and EGF-induced ERK activation. UV and EGF activate the MEK-ERK MAP kinase cascade, in which TAK1 does not participate. 293-IL-1RI cells were pretreated with 5Z-7-oxozeaenol and stimulated with UV or EGF. The activated ERK was detected with anti-phospho-ERK antibody that specifically recognizes the dually phosphorylated activated forms of ERK1 and ERK2 (Fig. 4, C and D). 5Z-7-Oxozeaenol had little effect on UV- or EGF-induced ERK activation even at a concentration of 500 nm. These results suggest that 5Z-7-oxozeaenol selectively inhibits TAK1, thereby inhibiting IL-1-induced JNK/p38 activation in culture cells. We then examined whether 5Z-7-oxozeaenol inhibits kinase activity of endogenous TAK1 upon IL-1 stimulation. We have previously observed that TAK1 is transiently activated around 2–5 min after IL-1 stimulation when 293-IL-1RI cells were treated with IL-1 (8Takaesu G. Ninomiya-Tsuji J. Kishida S. Li X. Stark G.R. Matsumoto K. Mol. Cell. Biol. 2001; 21: 2475-2484Crossref PubMed Scopus (160) Google Scholar). We treated 293-IL-1RI cells with various concentrations of 5Z-7-oxozeaenol prior to IL-1 stimulation. At 5 min after IL-1 stimulation, cells were lysed, and endogenous TAK1 was immunoprecipitated with anti-TAK1 antibody. The catalytic activity of TAK1 was measured using MKK6 as a substrate (Fig.5A, upper panel). Treatment of the cells with 5Z-7-oxozeaenol inhibited kinase activity of endogenous TAK1. The IC50 of 5Z-7-oxozeaenol to inhibit endogenous TAK1 was 65 nm (Fig. 5A), which is correlated with the IC50 to inhibit NF-κB and JNK/p38 activation (Fig. 3and 4). We next tested whether the 5Z-oxozeaenol-mediated inhibition of TAK1 in culture cells is reversible or irreversible. We treated 293-IL-1RI cells with 100 nm 5Z-7-oxozeaenol for 30 min and then incubated for an additional 30 min without 5Z-7-oxozeaenol. The cells were subsequently stimulated with IL-1, and the catalytic activity of endogenous TAK1 was measured (Fig.5B). 5Z-7-Oxozeaenol significantly inhibited TAK1 kinase activity even after 5Z-7-oxozeaenol was removed from the culture medium. These results suggest that 5Z-7-oxozeaenol irreversibly binds to and inhibits TAK1 in 293-IL-1RI cells, consistent with the result showing that 5Z-7-oxozeaenol irreversibly inhibits ATP binding to TAK1in vitro (Fig. 1D). Thus, it is likely that 5Z-7-oxozeaenol, when added into the culture medium, inhibits TAK1 activity by irreversibly inhibiting the binding of ATP to TAK1. We also investigated the time course of activation of TAK1, IKK, JNK, and p38 upon IL-1 stimulation. In this assay, 293-IL-1RI cells were treated with 500 nm 5Z-7-oxozeaenol for 30 min to completely inhibit kinase activity of TAK1 and then stimulated with IL-1 (Fig. 6). Cells were harvested at 3 and 12 min post-IL-1 stimulation, and the lysates were immunoprecipitated with anti-TAK1 followed by in vitrokinase assay (Fig. 6A). 5Z-7-Oxozeaenol treatment abolished IL-1-induced activation of TAK1. We have previously shown that autophosphorylation of TAK1 upon IL-1 stimulation is essential for its activation (7Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (228) Google Scholar). TAK1 autophosphorylation can be detected on SDS-PAGE as slowly migrating TAK1 bands (Fig.6A, lower panel). We observed that 5Z-7-oxozeaenol inhibited IL-1-induced autophosphorylation of TAK1. We have also previously demonstrated that endogenous TAK1 constitutively interacts with TAB1 (7Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Abstract Full Text Full Text PDF PubMed Scopus (228) Google Scholar). The amount of coprecipitated TAB1 in TAK1 immunoprecipitates was not changed with treatment of 5Z-7-oxozeaenol (Fig. 6A, lower panel), suggesting that 5Z-7-oxozeaenol did not interfere with interaction of TAK1 with TAB1. IKK activity was measured using GST-IκB as a substrate (Fig. 6B). 5Z-7-Oxozeaenol treatment inhibited 70–80% of the kinase activity of the IL-1-induced IKK activity. Since 5Z-7-oxozeaenol had no inhibitory effect on kinase activity of IKK itself (Fig. 2), 5Z-7-oxozeaenol presumably inhibits IL-1-induced activation of IKK by inhibiting TAK1 activity. We also observed that 5Z-7-oxozeaenol abolished IL-1-induced activation of JNK and p38 (Fig. 6, C and D). Taken together, our results indicate that 5Z-7-oxozeaenol inhibits the IL-1 signaling pathways that normally lead to activation of both NF-κB and JNK/p38 by inhibiting TAK1. IL-1 is a proinflammatory cytokine that induces the expression of many genes that up-regulate inflammation (23Dinarello C.A. Blood. 1996; 87: 2095-2147Crossref PubMed Google Scholar). One such gene product is cyclooxgenase 2 (COX-2), which catalyzes the production of prostaglandin (24Smith W.L. DeWitt D.L. Garavito R.M. Annu. Rev. Biochem. 2000; 69: 145-182Crossref PubMed Scopus (2477) Google Scholar). We tested the effect of 5Z-7-oxozeaenol on IL-1-induced COX-2 production (Fig.7A). The level of COX-2 proteins was increased after IL-1 treatment, whereas no increase was detected when cells were pretreated with 5Z-7-oxozeaenol, even in the presence of IL-1. Thus, 5Z-7-oxozeaenol inhibits production of inflammation mediators. We next examined whether 5Z-7-oxozeaenol could suppress inflammation in vivo. For this experiment, we used PC-induced ear swelling as a model for COX-2-mediated inflammation. The ear swelling system has been widely used as a model for allergic cutaneous diseases and inflammatory skin disorders (25Krueger G.G. Stingl G. J. Invest. Dermatol. 1989; 92: 32-51Abstract Full Text PDF PubMed Scopus (25) Google Scholar, 26Weston W.L. Ann. Allergy. 1976; 37: 346-352PubMed Google Scholar). Indeed, it has been shown that inhibitors of COX-2 block PC-induced ear swelling (27Lavaud P. Rodrigue F. Carre C. Touvay C. Mencia-Huerta J.M. Braquet P. J. Invest. Dermatol. 1991; 97: 101-105Abstract Full Text PDF PubMed Scopus (14) Google Scholar). Furthermore, reduction of IL-1 production have also been shown to block ear swelling induced by PC (28Goto Y. Inoue Y. Tsuchiya M. Isobe M. Ueno T. Uchi H. Furue M. Hayashi H. Int. Arch. Allergy Immunol. 2000; 123: 341-348Crossref PubMed Scopus (13) Google Scholar), suggesting that IL-1 signaling is involved in this disorder. When 5Z-7-oxozeaenol was administrated to the PC-challenged ear, ear swelling was reduced by up to 50% of that of the control ear treated with vehicle (Fig.7B). Thus, 5Z-7-oxozeaenol is able to prevent inflammation, probably through inhibiting TAK1 activity. Our screening for a TAK1 kinase inhibitor identified a natural compound, 5Z-7-oxozeaenol, a fungal resorcylic acid lactone that has been previously reported to inhibit endotoxin-induced production of TNF (29Rawlins P. Mander T. Sadeghi R. Hill S. Gammon G. Foxwell B. Wrigley S. Moore M. Int. J. Immunopharmacol. 1999; 21: 799-814Crossref PubMed Scopus (26) Google Scholar). 5Z-7-Oxozeaenol is also able to inhibit anisomycin-induced JNK/p38 activation (30Takehana K. Sato S. Kobayasi T. Maeda T. Biochem. Biophys. Res. Commun. 1999; 257: 19-23Crossref PubMed Scopus (61) Google Scholar). However, the mechanisms underlying these inhibitory effects had been unclear. Here we demonstrate that 5Z-7-oxozeaenol specifically inhibits the catalytic activity of TAK1. Since TAK1 is activated upon treatment with various endotoxins and stresses, it is likely that 5Z-7-oxozeaenol might inhibit TAK1 activity activated by endotoxin and anisomycin, thereby reducing TNF production and JNK/p38 activation. TAK1 is a multifunctional protein kinase involved not only in the IL-1 signaling pathway but also in the transforming growth factor-β family signaling pathway (3Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Crossref PubMed Scopus (1178) Google Scholar, 31Shibuya H. Iwata H. Masuyama N. Gotoh Y. Yamaguchi K. Irie K. Matsumoto K. Nishida E. Ueno N. EMBO J. 1998; 17: 1019-1028Crossref PubMed Scopus (191) Google Scholar). Furthermore, we have recently found that TAK1 is involved in a MAP kinase-like pathway that negatively regulates the Wnt signaling pathway (32Ishitani T. Ninomiya-Tsuji J. Nagai S. Nishita M. Meneghini M. Barker N. Waterman M. Bowerman B. Clevers H. Shibuya H. Matsumoto K. Nature. 1999; 399: 798-802Crossref PubMed Scopus (519) Google Scholar, 33Ishitani T. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. Biol. 2003; 23: 1379-1389Crossref PubMed Scopus (184) Google Scholar, 34Ishitani T. Kishida S. Hyodo-Miura J. Ueno N. Yasuda J. Waterman M. Shibuya H. Moon R.T. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. Biol. 2003; 23: 131-139Crossref PubMed Scopus (478) Google Scholar). Since 5Z-7-oxozeaenol is a highly potent and selective inhibitor of TAK1, this compound will be a useful tool for studies on these signal transduction pathways. Furthermore, in this study, we show that when applied topically, 5Z-7-oxozeaenol significantly reduces the level of PC-induced ear swelling. These results suggest that 5Z-7-oxozeaenol might be a useful therapeutic agent for allergic cutaneous disorders such as allergic contact dermatitis and atopic dermatitis. We thank H. Ichijo, S. Ohno, H. Saito, and E. Nishida for materials and M. Lamphier for critical reading of the manuscript.}, number={20}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Ninomiya-Tsuji, J and Kajino, T and Ono, K and Ohtomo, T and Matsumoto, M and Shiina, M and Mihara, M and Tsuchiya, M and Matsumoto, K}, year={2003}, month={May}, pages={18485–18490} }
 @article{li_katsura_nomiyama_komaki_ninomiya-tsuji_matsumoto_kobayashi_tamura_2003, title={Regulation of the interleukin-1-induced signaling pathways by a novel member of the protein phosphatase 2C family (PP2C epsilon)}, volume={278}, ISSN={["1083-351X"]}, DOI={10.1074/jbc.M211474200}, abstractNote={Although TAK1 signaling plays essential roles in eliciting cellular responses to interleukin-1 (IL-1), a proinflammatory cytokine, how the IL-1-TAK1 signaling pathway is positively and negatively regulated remains poorly understood. In this study, we investigated the possible role of a novel protein phosphatase 2C (PP2C) family member, PP2Cε, in the regulation of the IL-1-TAK1 signaling pathway. PP2Cε was composed of 303 amino acids, and the overall similarity of amino acid sequence between PP2Cε and PP2Cα was found to be 267. Ectopic expression of PP2Cε inhibited the IL-1- and TAK1-induced activation of mitogen-activated protein kinase kinase 4 (MKK4)-c-Jun N-terminal kinase or MKK3-p38 signaling pathway. PP2Cε dephosphorylated TAK1 in vitro. Co-immunoprecipitation experiments indicated that PP2Cε associates stably with TAK1 and attenuates the binding of TAK1 to MKK4 or MKK6. Ectopic expression of a phosphatase-negative mutant of PP2Cε, PP2Cε(D/A), which acted as a dominant negative form, enhanced both the association between TAK1 and MKK4 or MKK6 and the TAK1-induced activation of an AP-1 reporter gene. The association between PP2Cε and TAK1 was transiently suppressed by IL-1 treatment of the cells. Taken together, these results suggest that, in the absence of IL-1-induced signal, PP2Cε contributes to keeping the TAK1 signaling pathway in an inactive state by associating with and dephosphorylating TAK1.AY184801 Although TAK1 signaling plays essential roles in eliciting cellular responses to interleukin-1 (IL-1), a proinflammatory cytokine, how the IL-1-TAK1 signaling pathway is positively and negatively regulated remains poorly understood. In this study, we investigated the possible role of a novel protein phosphatase 2C (PP2C) family member, PP2Cε, in the regulation of the IL-1-TAK1 signaling pathway. PP2Cε was composed of 303 amino acids, and the overall similarity of amino acid sequence between PP2Cε and PP2Cα was found to be 267. Ectopic expression of PP2Cε inhibited the IL-1- and TAK1-induced activation of mitogen-activated protein kinase kinase 4 (MKK4)-c-Jun N-terminal kinase or MKK3-p38 signaling pathway. PP2Cε dephosphorylated TAK1 in vitro. Co-immunoprecipitation experiments indicated that PP2Cε associates stably with TAK1 and attenuates the binding of TAK1 to MKK4 or MKK6. Ectopic expression of a phosphatase-negative mutant of PP2Cε, PP2Cε(D/A), which acted as a dominant negative form, enhanced both the association between TAK1 and MKK4 or MKK6 and the TAK1-induced activation of an AP-1 reporter gene. The association between PP2Cε and TAK1 was transiently suppressed by IL-1 treatment of the cells. Taken together, these results suggest that, in the absence of IL-1-induced signal, PP2Cε contributes to keeping the TAK1 signaling pathway in an inactive state by associating with and dephosphorylating TAK1.AY184801 stress-activated protein kinase mitogen-activated protein kinase kinase PP2A, PP2B, and PP2C, protein phosphatase 1, 2A, 2B, and 2C, respectively interleukin hemagglutinin Jun N-terminal kinase cytomegalovirus glutathioneS-transferase maltose-binding protein Stress-activated protein kinases (SAPKs)1 are a subfamily of the mitogen-activated protein kinase superfamily and are highly conserved from yeast to mammalian cells. SAPKs relay signals in response to various extracellular stimuli, including environmental stress and inflammatory cytokines. In mammalian cells, two distinct classes of SAPKs have been identified, the c-Jun N-terminal kinases (JNK1, JNK2, and JNK3) and the p38 mitogen-activated protein kinases (p38α, p38ॆ, p38γ, and p38δ) (1Garrington T.P. Johnson G.L. Curr. Opin. Cell Biol. 1999; 11: 211-218Google Scholar, 2Ip Y.T. Davis R.J. Curr. Opin. Cell Biol. 1998; 10: 205-219Google Scholar). Activation of SAPKs requires phosphorylation of conserved tyrosine and threonine residues present in the catalytic domain. This phosphorylation is mediated by dual specificity protein kinases, which are members of the mitogen-activated protein kinase kinase (MKK) family. Of these, MKK3 and MKK6 phosphorylate p38, MKK7 phosphorylates JNK, and MKK4 can phosphorylate either. These MKKs, in turn, are similarly activated by the phosphorylation of conserved serine and threonine residues (1Garrington T.P. Johnson G.L. Curr. Opin. Cell Biol. 1999; 11: 211-218Google Scholar, 2Ip Y.T. Davis R.J. Curr. Opin. Cell Biol. 1998; 10: 205-219Google Scholar). Recently, several MKK-activating MKK kinases have been identified (3Widmann C. Gibson S. Jarpe M.B. Johnson G.L. Physiol. Rev. 1999; 79: 143-180Google Scholar). Some of these MKK kinases are also known to be activated by phosphorylation. In the absence of a signal, the constituents of the SAPK cascade return to their dephosphorylated, inactive state, suggesting an essential role for phosphatases in SAPK regulation. Protein phosphatases are classified into three groups, Ser/Thr phosphatases, Ser/Thr/Tyr phosphatases, and Tyr phosphatases, depending on their phosphoamino acid specificity. Dephosphorylation of SAPK signal pathway components requires the participation of a variety of phosphatases. In fact, participation by members of all three groups in the negative regulation of SAPK signaling pathways has been reported (4Tamura S. Hanada M. Ohnishi M. Katsura K. Sasaki M. Kobayashi T. Eur. J. Biochem. 2002; 269: 1060-1066Google Scholar). PP2C is one of four major protein serine/threonine phosphatases (PP1, PP2A, PP2B, and PP2C) found in eukaryotes. At least six distinct PP2C gene products (2Cα, 2Cॆ, 2Cγ, 2Cδ, Wip1, and Ca2+/calmodulin-dependent protein kinase phosphatase) have been found in mammalian cells (5Tamura S. Lynch K.R. Larner J. Fox J. Yasui A. Kikuchi K. Suzuki Y. Tsuiki S. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1796-1800Google Scholar, 6Wenk J. Trompeter H.I. Pettrich K.G. Cohen P.T.W. Campbell D.G. Mieskes G. FEBS Lett. 1992; 297: 135-138Google Scholar, 7Travis S.M. Welsh M.J. FEBS Lett. 1997; 412: 415-419Google Scholar, 8Guthridge M.A. Bellosta P. Tavoloni N. Basilico C. Mol. Cell. Biol. 1997; 17: 5485-5498Google Scholar, 9Tong Y. Quirion R. Shen S-H. J. Biol. Chem. 1998; 273: 35282-35290Google Scholar, 10Fiscella M. Zhang H. Fan S. Sakaguchi K. Shen S. Mercer W.E. Vande Woude G.F. O'Connor P.M. Appella E. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6048-6053Google Scholar, 11Kitani T. Ishida A. Okuno S. Takeuchi M. Kameshita I. Fujisawa H. J. Biochem. (Tokyo). 1999; 125: 1022-1028Google Scholar, 12Leung-Hagesteijn C. Mahendra A. Naruszewicz I. Hannigan G.E. EMBO J. 2001; 20: 2160-2170Google Scholar). In addition, two distinct isoforms of the human PP2Cα (α-1 and -2) and five isoforms of the mouse PP2Cॆ (ॆ-1, -2, -3, -4, and -5) have been identified (13Mann D.J. Campbell D.G. McGowan C.H. Cohen P.T. Biochim. Biophys. Acta. 1992; 1130: 100-104Google Scholar, 14Takekawa M. Maeda T. Saito H. EMBO J. 1998; 17: 4744-4752Google Scholar, 15Terasawa T. Kobayashi T. Murakami T. Ohnishi M. Kato S. Tanaka O. Kondo H. Yamamoto H. Takeuchi T. Tamura S. Arch. Biochem. Biophys. 1993; 307: 342-349Google Scholar, 16Kato S. Terasawa T. Kobayashi T. Ohnishi M. Sasahara Y. Kusuda K. Yanagawa Y. Hiraga A. Matsui Y. Tamura S. Arch. Biochem. Biophys. 1995; 318: 387-393Google Scholar). These isoforms are generated as splicing variants of a single pre-mRNA. Of the six different members of the PP2C family, three (PP2Cα, PP2Cॆ, and Wip1) have recently been implicated in the negative regulation of SAPK signaling pathways (14Takekawa M. Maeda T. Saito H. EMBO J. 1998; 17: 4744-4752Google Scholar,17Hanada M. Kobayashi T. Ohnishi M. Ikeda S. Wang H. Katsura K. Yanagawa Y. Hiraga A. Kanamaru R. Tamura S. FEBS Lett. 1998; 437: 172-176Google Scholar, 18Hanada M. Ninomiya-Tsuji J. Komaki K. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Google Scholar, 19Takekawa M. Adachi M. Nakahata A. Nakayama I. Itoh F. Tsukuda H. Taya Y. Imai K. EMB0 J. 2000; 19: 6517-6526Google Scholar). We and others have reported that ectopic expression of mouse PP2Cα or PP2Cॆ-1 inhibited the stress-activated MKK3/6-p38 and MKK4/7-JNK pathways but not the mitogen-activated MKK1-ERK1 pathway (14Takekawa M. Maeda T. Saito H. EMBO J. 1998; 17: 4744-4752Google Scholar, 17Hanada M. Kobayashi T. Ohnishi M. Ikeda S. Wang H. Katsura K. Yanagawa Y. Hiraga A. Kanamaru R. Tamura S. FEBS Lett. 1998; 437: 172-176Google Scholar). Thus, negative regulation by PP2Cα and PP2Cॆ-1 is selective for SAPK pathways. We have provided further evidence indicating that PP2Cॆ-1 associates with another upstream kinase, TAK1, and inhibits the SAPK signaling pathways by direct dephosphorylation of TAK1 (18Hanada M. Ninomiya-Tsuji J. Komaki K. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Google Scholar). Takekawa et al. (14Takekawa M. Maeda T. Saito H. EMBO J. 1998; 17: 4744-4752Google Scholar) have found that PP2Cα-2 dephosphorylates and inactivates MKK4, MKK6 and p38, both in vivo and in vitro. In addition, they reported that Wip1, whose expression is induced by ionizing radiation in a p53-dependent manner, inactivates p38 by specific dephosphorylation of a conserved threonine residue and suppresses subsequent p53 activation (10Fiscella M. Zhang H. Fan S. Sakaguchi K. Shen S. Mercer W.E. Vande Woude G.F. O'Connor P.M. Appella E. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6048-6053Google Scholar, 19Takekawa M. Adachi M. Nakahata A. Nakayama I. Itoh F. Tsukuda H. Taya Y. Imai K. EMB0 J. 2000; 19: 6517-6526Google Scholar). TAK1 was originally identified as a MKK kinase that functions in the transforming growth factor-ॆ signaling pathway (21Yamaguchi K. Shirakabe K. Shibuya H. Irie K. Oishi I. Ueno N. Taniguchi T. Nishida E. Matsumoto K. Science. 1995; 270: 2008-2011Google Scholar). TAK1 can activate both the MKK4-JNK and MKK6-p38 pathways (18Hanada M. Ninomiya-Tsuji J. Komaki K. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Google Scholar). Studies of the mechanism of transforming growth factor-ॆ-induced activation of TAK1 have revealed that a TAK1-binding protein, TAB1, functions as an activator promoting TAK1 autophosphorylation (22Shibuya H. Yamaguchi K. Shirakabe K. Tonegawa A. Gotoh Y. Ueno N. Irie K. Nishida E. Matsumoto K. Science. 1996; 272: 1179-1182Google Scholar, 23Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Google Scholar). Recent studies have indicated that TAK1 is also activated by various stimuli, including environmental stress and inflammatory cytokines (IL-1 and tumor necrosis factor α), and TAB2, another TAK1 binding protein, has been found to link TAK1 and TRAF6 and acts as a mediator of TAK1 action in the IL-1-induced signaling pathway (24Shirakabe K. Yamaguchi K. Shibuya H. Irie K. Matsuda S. Moriguchi T. Gotoh Y. Matsumoto K. Nishida E. J. Biol. Chem. 1997; 272: 8141-8144Google Scholar, 25Takaesu G. Kishida S. Hiyama A. Yamaguchi K. Shibuya H. Irie K. Ninomiya-Tsuji J. Matsumoto K. Mol. Cell. 2000; 5: 649-658Google Scholar). However, the detailed mechanism of positive and negative regulation of TAK1 is not yet fully understood. In this study, we present evidence that a novel member of the PP2C family (PP2Cε) participates in the negative regulation of the TAK1 signaling pathway and suggest that PP2Cε is involved in the IL-1-induced regulation of TAK1. Restriction enzymes and other modifying enzymes used for DNA manipulation were obtained from Takara (Kyoto, Japan). Glutathione-agarose beads, protein A-agarose beads, Hybond-P membranes, Hybond-N+ membranes, [γ-32P]ATP, and RedivueTML [35S]methionine were purchased from Amersham Biosciences. CDP-Star substrate was obtained from Applied Biosystems (Bedford, MA). The luciferase assay, ॆ-galactosidase enzyme assay, and TNT Quick Coupled Transcription/Translation Systems were supplied by Promega(Madison, WI). Amylose resin and anti-MBP antibody were purchased from New England Biolabs (Beverly, MA). Anti-hemagglutinin antibody (HA; 12CA5) and human IL-1ॆ were purchased from Roche Molecular Biochemicals. Anti-phospho-JNK, anti-phospho-p38, anti-phospho-MKK4, and anti-phospho-MKK3/6 antibodies were obtained from Cell Signaling(Beverly, MA). Anti-TAK1, anti-Myc, and anti-His antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Anti-FLAG (M2) antibody was from Kodak Scientific Imaging Systems (New Haven, CT). All other reagents used were from Wako Pure Chemical (Osaka, Japan). We searched the expressed sequence tag data base for DNA clones encoding the amino acid sequences of the unique motifs conserved in mouse PP2C family members. Three different clones, each potentially encoding a novel member of the PP2C family, were found. These three cDNAs were designated clone-1, -2 (to be published elsewhere), and -3 (to be published elsewhere). A putative full-length cDNA of clone-1 was obtained by 5′- and 3′-rapid amplification of cDNA ends methods using the total RNA fraction isolated from the hearts of adult mice as the template. Nucleotide sequence data for the full-length cDNA are available in the GenBankTM data base under the accession numberAY184801. This sequence has been scanned against the data base, and all sequences with significant relatedness to the new sequence were identified (BF466920, BB611990, BB636411, BU052859, BB611559, AI613837,BM876958, AF117832, BF471931, AA509367, BE980311, BF464085, AA498729,AI481407, BG296608, BE948499, BB628580, BF465398, BB643596, BE983821,BB866395, BB662653, BB622909, BI220774, BE859571). Plasmids expressing PP2C, TAK1, TAB1, mitogen-activated protein kinases, and MKKs in mammalian cells were constructed using cDNAs encoding these proteins, under the control of the CMV promoter. Epitope tags were added to the constructs using synthesized oligonucleotides. Mutated cDNAs were generated by polymerase chain reactions. For bacterial expression of proteins, cDNAs encoding the proteins were subcloned into pGEX (Amersham Biosciences) or into pMAL-C2X (New England Biolabs) to generate glutathione S-transferase (GST) fusion proteins or maltose-binding protein (MBP) fusion proteins. Other expression plasmids were prepared as described elsewhere (23Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Google Scholar, 26Kusuda K. Kobayashi T. Ikeda S. Ohnishi M. Chida N. Yanagawa Y. Shineha R. Nishihira T. Satomi S. Hiraga A. Tamura S. Biochem. J. 1998; 332: 243-250Google Scholar). TNT Quick Coupled Transcription/Translation Systems (Promega) were used to determine the start codon of PP2Cε cDNA. 293 cells and 293IL-1RI (27Cao Z. Henzel W.J. Gao X. Science. 1996; 271: 1128-1131Google Scholar) cells were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 107 (v/v) fetal bovine serum and penicillin/streptomycin. At ∼50–707 confluence the cells were transfected by the calcium phosphate transfection method or using LipofectAMINE (Invitrogen). The total amount of DNA used for transfection was 1 ॖg per 12-well plate, 2 ॖg/6-cm plate, and 10 ॖg/10-cm plate. After transfection, the cells were cultured for 48 h and harvested. α-Casein was phosphorylated by protein kinase A and [γ-32P]ATP as described previously (28Tamura S. Kikuchi K. Hiraga A. Hosokawa M. Tsuiki S. Biochim. Biophys. Acta. 1978; 524: 349-356Google Scholar, 29McGowan C.H. Cohen P. Methods Enzymol. 1988; 159: 416-425Google Scholar). The catalytic subunit of protein kinase A was purified as described by Reimann and Beham (30Reimann E.M. Beham R.A. Methods Enzymol. 1983; 99: 51-55Google Scholar). The reaction mixture was gel-filtered by Sephadex G-25 and the isolated32P-labeled casein was stored at −20 °C before use. To obtain 32P-labeled TAK1, 293 cells (2 × 106) were cotransfected with 5 ॖg of pcDNA3-HA-TAK1 and 5 ॖg of pcDNA3-HA-TAB1, using the calcium phosphate transfection method. The cell lysates were prepared 48 h after the transfection, and the TAK1-TAB1 complex was immunoprecipitated with anti-TAK1 antibody and protein A-Sepharose beads (Amersham Biosciences). After immunoprecipitation, the beads were washed with Tris-buffered saline (20 mm Tris-HCl, pH 7.5, and 150 mm NaCl) containing 0.057 (v/v) Tween 20 and incubated with [γ-32P]ATP in kinase buffer (20 mmTris-HCl, pH 7.5, 10 mm MgCl2, and 1 mm dithiothreitol) for 30 min at 30 °C. The immune complex containing the autophosphorylated TAK1 was washed with 50 mm Tris-HCl, pH 7.5, and subsequently with phosphatase buffer (50 mm Tris-HCl, pH 7.5, 0.1 mm EDTA, 5 mm dithiothreitol, 0.017 (v/v) Brij 35, and 2 mm MnCl2). Aliquots were stored at −20 °C before use. In order to prepare the phosphorylated JNK, 2 ॖg of pcDNA3-Myc-JNK was transfected into 293 cells (2 × 105) using LipofectAMINE. IL-1 (500 units/ml) was added to the medium 48 h after the transfection, and the cells were incubated for 15 min. The cells were lysed in a buffer containing 20 mm Tris-HCl, pH 7.5, 17 (v/v) Triton X-100, 150 mm NaCl, 1 mm EGTA, 1 mm sodium orthovanadate, 50 mm NaF, 1 mm dithiothreitol, and 1 mm phenylmethylsulfonyl fluoride, and the cell lysates were immunoprecipitated with anti-Myc antibody and protein A-Sepharose beads. The immune complex was washed with Tris-buffered saline containing 0.057 (v/v) Tween 20 and then with the kinase buffer and stored in aliquots at −20 °C before use. In order to prepare the GST-phospho-MKK4, pEBG2T-MKK4, pcDNA3-HA-TAK1, and pcDNA3-HA-TAB1 were cotransfected into 293 cells. The cells were harvested 48 h after the transfection, and the GST-phospho-MKK4 was isolated from the cell lysates with glutathione-Sepharose beads. The phosphorylated GST-MKK4 was eluted with elution buffer (50 mm Tris-HCl, pH 8.0, 5 mm glutathione, 0.25m sucrose, 0.5 mm dithiothreitol, and 0.1 mm EGTA) and stored at −20 °C before use. Casein phosphatase activity was assayed by measuring the release of [32P]phosphate from 32P-labeled casein, essentially as described previously (28Tamura S. Kikuchi K. Hiraga A. Hosokawa M. Tsuiki S. Biochim. Biophys. Acta. 1978; 524: 349-356Google Scholar). TAK1 phosphatase activity was determined by incubating the 32P-labeled TAK1 with the indicated amounts of recombinant MBP-PP2Cε or MBP-PP2Cॆ-1 in phosphatase buffer for 30 min at 30 °C. The reaction was stopped by the addition of SDS-sample buffer, and the reaction mixture was subjected to SDS-PAGE followed by autoradiography. To determine the JNK phosphatase activity, the phosphorylated JNK was incubated with the indicated amounts of recombinant MBP-PP2Cε, together with recombinant GST-c-Jun and [γ-32P]ATP (0.5–3 ॖCi) in the kinase buffer. The reaction mixtures were incubated for 30 min at 30 °C. The reactions were stopped by adding SDS-sample buffer. The proteins were separated by SDS-PAGE and analyzed by autoradiography. In order to determine the MKK4 phosphatase activity, the phospho-MKK4 was incubated with the recombinant MBP-PP2Cε for 30 min at 30 °C in phosphatase buffer. The proteins in the reaction mixture were separated by SDS-PAGE and immunoblotted with anti-phospho-MKK4 and anti-MBP antibodies. Cells transfected with the indicated expression plasmids were washed twice with phosphate-buffered saline and lysed with ice-cold lysis buffer. Immunoprecipitation was performed with the indicated antibodies and protein A-Sepharose beads. The immunoprecipitates were subjected to 107 (w/v) SDS-PAGE and then transferred onto polyvinylidene difluoride membranes. The membranes were incubated overnight with the primary antibodies at 4 °C, incubated with alkaline phosphatase-conjugated secondary antibody for 1 h at 25 °C, and developed by chemiluminescence using CDP-Star as the substrate. Total RNA was extracted from the mouse tissues with RNAzol B (Biotecx Laboratories, Inc.). The denatured RNA (15 ॖg) was electrophoresed in a 1.07 (w/v) agarose gel and transferred onto a Hybond-N+ membrane, and Northern hybridization was carried out as described previously (15Terasawa T. Kobayashi T. Murakami T. Ohnishi M. Kato S. Tanaka O. Kondo H. Yamamoto H. Takeuchi T. Tamura S. Arch. Biochem. Biophys. 1993; 307: 342-349Google Scholar). A32P-labeled probe representing the entire coding sequence of the PP2Cε cDNA was used for the hybridization. A reporter gene activity assay was performed as described previously (18Hanada M. Ninomiya-Tsuji J. Komaki K. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Google Scholar, 32Beltman J. Erickson J.R. Martin G.A. Lyons J.F. Cook S.J. J. Biol. Chem. 1999; 274: 3772-3780Google Scholar). The pGL3-AP-1/luciferase reporter gene was used to measure AP-1-dependent transcriptional activity. Luciferase activity was determined with a luciferase assay system (Promega). A ॆ-galactosidase reporter plasmid, under the control of a ॆ-actin promoter, was cotransfected to normalize the transfection efficiency. The obtained cDNA clone (clone-1) contained a single oligonucleotide of 1566 bp (Fig.1A). The first Met codon and the first stop codon downstream were at nucleotide 238 and 1318, respectively. However, the fourth Met codon at nucleotide 409 was in the context of the translational start consensus sequence (A at −3 and G at +4, where the A in ATG is +1) (33Kozak M. Cell. 1986; 44: 283-292Google Scholar). Therefore, we performed an in vitro translation of the cDNA clone to determine which Met was the actual translational initiation codon. The largest size of the proteins synthesized in vitro was 34 kDa (Fig.1B). This size matched that of the protein from the fourth Met codon, which is composed of 303 amino acids. The bands of the smaller sizes may presumably be the proteolytic products of the 34-kDa protein. Therefore, we tentatively concluded that the open reading frame resided between 409 and 1318 nt. The primary sequence contained six motifs commonly conserved in PP2C family members in addition to a basic amino acid cluster unique to this 34-kDa protein (34Pilgrim D. McGregor A. Jackle P. Johnson T. Hansen D. Mol. Biol. Cell. 1995; 6: 1159-1171Google Scholar). This suggested that the encoded protein was a novel PP2C family member, and it was designated PP2Cε. Overall, the homogeneity between PP2Cα and PP2Cε was 267. To determine whether the recombinant PP2Cε possessed protein phosphatase activity, MBP-PP2Cα or MBP-PP2Cε fusion proteins were expressed inE. coli and then purified with amylose resin. The purified MBP-PP2Cε fusion protein exhibited substantial Mg2+- or Mn2+-dependent and okadaic acid-insensitive protein phosphatase activity (data not shown). The specific activity of MBP-PP2Cε was similar to that of MBP-PP2Cα when phosphorylated α-casein was used as the substrate (data not shown). Northern hybridization was performed on mouse tissues to clarify the tissue distribution of PP2Cε mRNA. A strong signal of 5.9-kb mRNA was observed in the brain, and a weak signal corresponding to the same size was also found in the heart (Fig. 1C). Interestingly, a mRNA signal of 2.2 kb was observed only in the testis (Fig. 1C). Although the PP2Cε mRNA signal was not observed in liver, lung, or skeletal muscle by Northern blot analysis, we were able to detect the PP2Cε mRNA signal in these tissues by polymerase chain reaction, suggesting that PP2Cε mRNA is ubiquitously expressed in a variety of tissues (data not shown). Three distinct PP2C family members (PP2Cα, PP2Cॆ, and Wip1) have previously been implicated in the regulation of the SAPK systems (14Takekawa M. Maeda T. Saito H. EMBO J. 1998; 17: 4744-4752Google Scholar, 17Hanada M. Kobayashi T. Ohnishi M. Ikeda S. Wang H. Katsura K. Yanagawa Y. Hiraga A. Kanamaru R. Tamura S. FEBS Lett. 1998; 437: 172-176Google Scholar, 18Hanada M. Ninomiya-Tsuji J. Komaki K. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Google Scholar, 19Takekawa M. Adachi M. Nakahata A. Nakayama I. Itoh F. Tsukuda H. Taya Y. Imai K. EMB0 J. 2000; 19: 6517-6526Google Scholar). Therefore, we examined the possibility that PP2Cε was also involved in the regulation of SAPK signaling pathways. In 293 cells, IL-1 stimulates the activity of the transcription factor complex AP-1 through the activation of TAK1 and JNK (35Ninomiya-Tsuji J. Kishimoto K. Hiyama A. Inoue J-I. Cao Z. Matsumoto K. Nature. 1999; 398: 252-256Google Scholar). We transfected 293 IL-1RI cells, which express the IL-1 receptor, with the expression plasmid of PP2Cε and then assayed the AP-1 activity using an AP-1-dependent luciferase reporter gene (Fig. 2A). Similar to our previously reported data with transfected PP2Cॆ-1 (18Hanada M. Ninomiya-Tsuji J. Komaki K. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Google Scholar), PP2Cε inhibited the IL-1-induced activation of AP-1 in a concentration-dependent manner (Fig. 2A). We next asked whether the TAK1-induced activation of AP-1 is also affected by the co-expression of PP2Cε (Fig. 2B). The expression of TAK1 alone in 293 IL-1RI cells activated the AP-1 reporter gene. This enhanced activity was substantially suppressed by PP2Cε, suggesting that TAK1 itself or a component(s) that lies downstream of TAK1 is a substrate of PP2Cε. Since TAK1 activates both JNK and p38 signaling pathways via MKK4/7 and MKK3/6, respectively, we also tested whether TAK1-induced activation of JNK or p38 was suppressed by PP2Cε. We expressed Myc-JNK (Fig.2C) or FLAG-p38 (Fig. 2D) with HA-TAK1 in 293 cells and tested the effect of PP2Cε co-expression on the TAK1-enhanced activation of JNK and p38. PP2Cε was found to inhibit the TAK1-enhanced activation of either JNK or p38. These results indicated that a signaling component(s) situated between TAK1 and JNK/p38 could be a substrate of PP2Cε. We next determined whether MKK3b-induced activation of p38 is affected by PP2Cε in 293 cells. The expression of PP2Cα suppressed the MKK3b-enhanced phosphorylation of p38 in 293 cells (Fig.3A), confirming our previous observation performed using COS7 cells (17Hanada M. Kobayashi T. Ohnishi M. Ikeda S. Wang H. Katsura K. Yanagawa Y. Hiraga A. Kanamaru R. Tamura S. FEBS Lett. 1998; 437: 172-176Google Scholar). In contrast, PP2Cε expressed in the cells exhibited no effect on the phosphorylation level of p38 (Fig. 3B), indirectly suggesting no direct effect on MKK3 and thereby raising the possibility that TAK1, which lies upstream of MKK3, might be the substrate of PP2Cε. To determine whether TAK1 is a substrate of PP2Cε, we examined the dephosphorylation of TAK1 after incubation with PP2Cε in vitro (Fig. 4B). HA-TAK1 and its promoter HA-TAB1 were co-expressed in 293 cells, and HA-TAK1 was immunoprecipitated from cell extracts with anti-TAK1 antibody. When the immunoprecipitated TAK1 complex was incubated with [γ-32P]ATP, TAK1 became autophosphorylated. The immunoprecipitate containing the phosphorylated TAK1 was washed and next incubated with bacterially produced MBP-PP2Cε or GST-PP2Cॆ-1. TAK1 was dephosphorylated by PP2Cॆ-1 (Fig. 4A), confirming our previous observation (18Hanada M. Ninomiya-Tsuji J. Komaki K. Ohnishi M. Katsura K. Kanamaru R. Matsumoto K. Tamura S. J. Biol. Chem. 2001; 276: 5753-5759Google Scholar). Similarly, TAK-1 was dephosphorylated by MBP-PP2Cε in a dose-dependent manner (Fig.4B). We next tested whether PP2Cε could dephosphorylate MKK4 or JNKin vitro (Fig. 4, C and D). Phosphorylated MKK4 or JNK was incubated with increasing concentrations of PP2Cε in vitro. PP2Cε did not dephosphorylate either MKK4 (Fig. 4C) or JNK (Fig. 4D) at the concentrations high enough to dephosphorylate TAK1. Based on these results, we propose that PP2Cε suppresses TAK1 signaling pathways by directly dephosphorylating TAK1 itself. To investigate the mechanism of PP2Cε action on TAK1 in more detail, we searched for a dominant negative form of PP2Cε in various point mutants of PP2Cε, defective in protein phosphatase activity. We prepared expression constructs for five different point mutants of PP2Cε, in which each of five different amino acids, known to be conserved in PP2C family members and to play essential roles in the enzyme activity, was replaced by another amino acid. We found that three of the resulting recombinant proteins exhibited essentially no activity against phosphorylated α-casein (Fig. 5A). In addition, one of these mutants, PP2Cε(D/A), in which Asp-245 had been replaced by Ala, was able to inhibit the dephosphorylation of TAK1 by PP2Cε in vitro (Fig. 5B). PP2Cε(D/A), expressed in 293 cells, reversed the inhibition of the TAK1-activated AP-1 reporter gene by the wild-type PP2Cε (Fig. 5C). Furthermore, expression of PP2Cε(D/A) in 293 cells enhanced further the TAK1-activated AP-1 reporter gene (Fig. 5D). These results support the ideas that PP2Cε(D/A) acts as a dominant negative form and that the endogenous PP2Cε may in fact participate in the negative regulation of the SAPK signaling pathways. Since TAK1 was found to be a substrate of PP2Cε, we next asked whether the phosphatase was able to associate with TAK1. To answer this question, we co-expressed HA-TAK1 and HA-PP2Cε or HA-PP2Cε(D/A) in 293 cells (Fig.6A). The cell extracts were immunoprecipitated with anti-TAK1 antibody. Co-precipitated HA-PP2Cε was detected by immunoblotting using anti-HA antibody. The results demonstrated that both PP2Cε and PP2Cε(D/A) were co-immunoprecipitated with TAK1 (Fig. 6A). We considered the possibility that PP2Cε might associate preferentially with the phosphorylated TAK1, the substrate of PP2Cε. The TAK1(S/A) mutant, in which Ser-192 is replaced by Ala, is defective in both phosphorylation and activation (23Kishimoto K. Matsumoto K. Ninomiya-Tsuji J. J. Biol. Chem. 2000; 275: 7359-7364Google Scholar). We co-expressed HA-PP2Cε and Myc-TAK1 or Myc-TAK1(S/A) in 293 cells and immunoprecipitated the Myc-TAK1 or Myc-TAK1(S/A) by anti-Myc antibody from the cell extracts. Immunoblot analysis using anti-HA antibody revealed that, simila}, number={14}, journal={JOURNAL OF BIOLOGICAL CHEMISTRY}, author={Li, MG and Katsura, K and Nomiyama, H and Komaki, K and Ninomiya-Tsuji, J and Matsumoto, K and Kobayashi, T and Tamura, S}, year={2003}, month={Apr}, pages={12013–12021} }
 @article{takaesu_surabhi_park_ninomiya-tsuji_matsumoto_gaynor_2003, title={TAK1 is critical for I kappa B kinase-mediated activation of the NF-kappa B pathway}, volume={326}, ISSN={["0022-2836"]}, DOI={10.1016/S0022-2836(02)01404-3}, abstractNote={Cytokine treatment stimulates the IkappaB kinases, IKKalpha and IKKbeta, which phosphorylate the IkappaB proteins, leading to their degradation and activation of NF-kappaB regulated genes. A clear definition of the specific roles of IKKalpha and IKKbeta in activating the NF-kappaB pathway and the upstream kinases that regulate IKK activity remain to be elucidated. Here, we utilized small interfering RNAs (siRNAs) directed against IKKalpha, IKKbeta and the upstream regulatory kinase TAK1 in order to better define their roles in cytokine-induced activation of the NF-kappaB pathway. In contrast to previous results with mouse embryo fibroblasts lacking either IKKalpha or IKKbeta, which indicated that only IKKbeta is involved in cytokine-induced NF-kappaB activation, we found that both IKKalpha and IKKbeta were important in activating the NF-kappaB pathway. Furthermore, we found that the MAP3K TAK1, which has been implicated in IL-1-induced activation of the NF-kappaB pathway, was also critical for TNFalpha-induced activation of the NF-kappaB pathway. TNFalpha activation of the NF-kappaB pathway is associated with the inducible binding of TAK1 to TRAF2 and both IKKalpha and IKKbeta. This analysis further defines the distinct in vivo roles of IKKalpha, IKKbeta and TAK1 in cytokine-induced activation of the NF-kappaB pathway.}, number={1}, journal={JOURNAL OF MOLECULAR BIOLOGY}, author={Takaesu, G and Surabhi, RM and Park, KJ and Ninomiya-Tsuji, J and Matsumoto, K and Gaynor, RB}, year={2003}, month={Feb}, pages={105–115} }
 @article{komatsu_shibuya_takeda_ninomiya-tsuji_yasui_miyado_sekimoto_ueno_matsumoto_yamada_2002, title={Targeted disruption of the Tab1 gene causes embryonic lethality and defects in cardiovascular and lung morphogenesis}, volume={119}, ISSN={["0925-4773"]}, DOI={10.1016/S0925-4773(02)00391-X}, abstractNote={The transforming growth factor-beta (TGF-beta) superfamily consists of a group of secreted signaling molecules that perform important roles in the regulation of cell growth and differentiation. TGF-beta activated kinase-1 binding protein-1 (TAB1) was identified as a molecule that activates TGF-beta activated kinase-1 (TAK1). Recent studies have revealed that the TAB1-TAK1 interaction plays an important role in signal transduction in vitro, but little is known about the role of these molecules in vivo. To investigate the role of TAB1 during development, we cloned the murine Tab1 gene and disrupted it by homologous recombination. Homozygous Tab1 mutant mice died, exhibiting a bloated appearance with extensive edema and hemorrhage at the late stages of gestation. By histological examinations, it was revealed that mutant embryos exhibited cardiovascular and lung dysmorphogenesis. Tab1 mutant embryonic fibroblast cells displayed drastically reduced TAK1 kinase activities and decreased sensitivity to TGF-beta stimulation. These results indicate a possibility that TAB1 plays an important role in mammalian embryogenesis and is required for TAK1 activation in TGF-beta signaling.}, number={2}, journal={MECHANISMS OF DEVELOPMENT}, author={Komatsu, Y and Shibuya, H and Takeda, N and Ninomiya-Tsuji, J and Yasui, T and Miyado, K and Sekimoto, T and Ueno, N and Matsumoto, K and Yamada, G}, year={2002}, month={Dec}, pages={239–249} }