@article{pfister_lobuglio_bradshaw_lebeuf_voitk_2024, title={<i>Peziza nivalis</i> and relatives-spring fungi of wide distribution}, volume={8}, ISSN={["1557-2536"]}, DOI={10.1080/00275514.2024.2370198}, abstractNote={Several members of the genus}, journal={MYCOLOGIA}, author={Pfister, Donald H. and LoBuglio, Katherine F. and Bradshaw, Michael and Lebeuf, Renee and Voitk, Andrus}, year={2024}, month={Aug} }
 @article{baggio_lagreca_lingaits_crouch_bradshaw_2024, title={First Report of Powdery Mildew Caused by <i>Golovinomyces ambrosiae</i> on <i>Verbena</i> x <i>hybrida</i> in the United States}, volume={9}, ISSN={["1943-7692"]}, DOI={10.1094/PDIS-06-24-1336-PDN}, abstractNote={Verbena × hybrida, also known as common garden verbena, has an important ornamental value for their wide range of flower colors and for attracting hummingbirds and butterflies. During the winter of 2021-2022 (December through February), more than 50% pot-grown verbena plants showed symptoms of powdery mildew in a field trial at a Syngenta Crop Protection research facility in Vero Beach, FL. Symptoms were characterized by the development of white, superficial mycelium on the adaxial side of leaves which, eventually, progressed to covering the whole surface of leaves, causing leaf discoloration, shoot distortion, and eventual plant death. Morphological characterization was carried out by observing powdery mildew colonies under the microscope. This powdery mildew forms dense patches of white mycelia, mainly on the adaxial leaf surfaces. The mycelium was a mat of hyphae with septa. Conidiophores were erect. The foot cells were straight, followed by one to three short cells bearing short chains of up to four conidia. The conidia were hyaline and ellipsoidal to doliiform in shape. Conidial germination is of the Eudoidium type. The conidia ranged from 25 to 32 μm long by 12 to 16 μm wide. The length to width ratio ranged between 1.6 and 2.3, but most were between 2.0 and 2.2. This is further verification of its identity as Golovinomyces ambrosiae and not Golovinomyces latisporus, because the length to width ratio of the latter species is consistently less than 2.0 (Qiu et al. 2020). Chasmothecia were not observed. Additionally, the ITS, GAPDH, and IGS regions were sequenced using the primer pairs ITS4/ITS5 (White et al. 1990), PMGAPDH1/PMGAPDH3R (Bradshaw et al. 2022a), and IGS-12a/NS1R (Carbone and Kohn 1999), respectively. The ITS region (GenBank number=PP924119) cannot distinguish between G. latisporus and G. ambrosiae and as such aligned 100% with both species on GenBank. However, the GAPDH and IGS regions can be used to distinguish G. ambrosiae from G. latisporus (Bradshaw et al. 2022b). The GAPDH (GenBank number=PP931995) and IGS (GenBank number=PP931996) regions aligned 100% with multiple G. ambrosiae sequences from GenBank including ON360708 and MK452567, respectively. The specimen was deposited in the Larry F. Grand Mycological Herbarium (NCSLG 24479). To confirm pathogenicity, ‘Tuscany® Pink Picotee’ and ‘Quartz XP Violet with Eye’ plugs were transplanted to 10-cm diameter pots containing ProMix potting mix and maintained in a greenhouse (± 26 °C). Inoculation was carried out 21 days after transplanting by touching infected leaves onto healthy leaves of 15 disease-free plants of each variety. Fifteen non-inoculated plants of each variety were used as controls. Typical powdery mildew symptoms and signs were first observed ten days after inoculation and the pathogen was more aggressive on ‘Tuscany® Pink Picotee’. Symptoms were not observed on non-inoculated plants. The fungus was morphologically identical to the one originally recovered from infected plants in the field. There have been many reports of Golovinomyces spp. affecting Verbena spp. worldwide; however, this is the first report of G. ambrosiae causing powdery mildew on Verbena × hybrida in the U.S. (Braun and Cook, 2012, Choi et al., 2021; Bradshaw et al. 2024). Powdery mildews reduce plant quality and decreases the aesthetics value of infected plants, causing great losses to the ornamental industry. Correct identification of the causal agent is crucial to recommend appropriate control methods, as they may differ according to the pathogen species.}, journal={PLANT DISEASE}, author={Baggio, Juliana S. and LaGreca, Scott and Lingaits, Amber and Crouch, Uma and Bradshaw, Michael}, year={2024}, month={Sep} }
 @article{bradshaw_boufford_braun_moparthi_jellings_maust_pandey_slack_pfister_2023, title={An in-depth evaluation of powdery mildew hosts reveals one of the world’s most common and widespread groups of fungal plant pathogens}, volume={9}, ISSN={0191-2917 1943-7692}, url={http://dx.doi.org/10.1094/PDIS-07-23-1471-RE}, DOI={10.1094/PDIS-07-23-1471-RE}, abstractNote={ Powdery mildews are highly destructive fungal plant pathogens that have a significant economic impact on both agricultural and ecological systems worldwide. The intricate relationship between powdery mildews and their host plants has led to cospeciation. In this study, we conducted an extensive evaluation of powdery mildew hosts to provide an updated understanding of the host ranges and distributions of these fungi. The “United States National Fungus Collections Fungus-Host Dataset” is the primary source of information for our analyses. The analysis of the dataset demonstrated the worldwide prevalence of powdery mildews; the data contained over 72,000 reports of powdery mildews, representing ∼8.7% of all host-fungal records. We have updated the taxonomy and nomenclature of powdery mildews. In total, powdery mildews infect ∼10,125 host taxa belonging to 205 families of flowering plants, which accounts for 1,970 genera in 200 countries across six continents. Furthermore, we estimate that powdery mildews infect approximately 2.9% of described angiosperm species. Our study underscores the need for regular updates on powdery mildew host information due to the continuously evolving taxonomy and the discovery of new host taxa. Since 1986, we estimate an additional 1,866 host taxa, 353 genera, and 36 families have been reported. Additionally, the identification of powdery mildew hosts provides valuable insights into the coevolutionary dynamics between the fungi and their plant hosts. Overall, this updated list provides valuable insights into the taxonomy and geographic distribution of powdery mildew species, which builds upon the previous work of Amano in 1986. Discerning the geographic spread and host range of economically significant plant pathogens is vital for biosecurity measures and identifying the origins and expansion of potentially harmful pathogens. }, journal={Plant Disease}, publisher={Scientific Societies}, author={Bradshaw, Michael and Boufford, David and Braun, Uwe and Moparthi, Swarnalatha and Jellings, Keila and Maust, Autumn and Pandey, Binod and Slack, Suzanne and Pfister, Donald}, year={2023}, month={Sep} }
 @article{bartholomew_luciano-rosario_bradshaw_gaskins_peng_fonseca_jurick_2023, title={Avirulent Isolates of Penicillium chrysogenum to Control the Blue Mold of Apple Caused by P. expansum}, volume={11}, ISSN={2076-2607}, url={http://dx.doi.org/10.3390/microorganisms11112792}, DOI={10.3390/microorganisms11112792}, abstractNote={Blue mold is an economically significant postharvest disease of pome fruit that is primarily caused by Penicillium expansum. To manage this disease and sustain product quality, novel decay intervention strategies are needed that also maintain long-term efficacy. Biocontrol organisms and natural products are promising tools for managing postharvest diseases. Here, two Penicillium chrysogenum isolates, 404 and 413, were investigated as potential biocontrol agents against P. expansum in apple. Notably, 404 and 413 were non-pathogenic in apple, yet they grew vigorously in vitro when compared to the highly aggressive P. expansum R19 and Pe21 isolates. Whole-genome sequencing and species-specific barcoding identified both strains as P. chrysogenum. Each P. chrysogenum strain was inoculated in apple with the subsequent co-inoculation of R19 or Pe21 simultaneously, 3, or 7 days after prior inoculation with 404 or 413. The co-inoculation of these isolates showed reduced decay incidence and severity, with the most significant reduction from the longer establishment of P. chrysogenum. In vitro growth showed no antagonism between species, further suggesting competitive niche colonization as the mode of action for decay reduction. Both P. chrysogenum isolates had incomplete patulin gene clusters but tolerated patulin treatment. Finally, hygromycin resistance was observed for both P. chrysogenum isolates, yet they are not multiresistant to apple postharvest fungicides. Overall, we demonstrate the translative potential of P. chrysogenum to serve as an effective biocontrol agent against blue mold decay in apples, pending practical optimization and formulation.}, number={11}, journal={Microorganisms}, publisher={MDPI AG}, author={Bartholomew, Holly P. and Luciano-Rosario, Dianiris and Bradshaw, Michael J. and Gaskins, Verneta L. and Peng, Hui and Fonseca, Jorge M. and Jurick, Wayne M., II}, year={2023}, month={Nov}, pages={2792} }
 @article{bradshaw_aime_rokas_maust_moparthi_jellings_pane_hendricks_pandey_li_et al._2023, title={Extensive intragenomic variation in the internal transcribed spacer region of fungi}, volume={26}, ISSN={["2589-0042"]}, DOI={10.1016/j.isci.2023.107317}, abstractNote={Fungi are among the most biodiverse organisms in the world. Accurate species identification is imperative for studies on fungal ecology and evolution. The internal transcribed spacer (ITS) rDNA region has been widely accepted as the universal barcode for fungi. However, several recent studies have uncovered intragenomic sequence variation within the ITS in multiple fungal species. Here, we mined the genome of 2414 fungal species to determine the prevalence of intragenomic variation and found that the genomes of 641 species, about one-quarter of the 2414 species examined, contained multiple ITS copies. Of those 641 species, 419 (∼65%) contained variation among copies revealing that intragenomic variation is common in fungi. We proceeded to show how these copies could result in the erroneous description of hundreds of fungal species and skew studies evaluating environmental DNA (eDNA) especially when making diversity estimates. Additionally, many genomes were found to be contaminated, especially those of unculturable fungi.}, number={8}, journal={ISCIENCE}, author={Bradshaw, Michael J. and Aime, M. Catherine and Rokas, Antonis and Maust, Autumn and Moparthi, Swarnalatha and Jellings, Keila and Pane, Alexander M. and Hendricks, Dylan and Pandey, Binod and Li, Yuanning and et al.}, year={2023}, month={Aug} }
 @article{götz_kruse_bradshaw_richter_braun_2023, title={Golovinomyces inulae U. Braun & H.D. Shin is the causative agent of powdery mildew on Telekia speciosa L. in Germany}, volume={130}, ISSN={1861-3829 1861-3837}, url={http://dx.doi.org/10.1007/s41348-023-00731-x}, DOI={10.1007/s41348-023-00731-x}, abstractNote={AbstractIn central Europe, including Germany, Telekia speciosa (heart-leaved oxeye) is a synanthropic, non-native plant species commonly grown as an ornamental plant. A powdery mildew has recently been introduced on this host in Germany. This powdery mildew has previously been assigned to Golovinomyces cichoracearum (≡ Erysiphe cichoracearum) sensu lato. Two German specimens of powdery mildew on Telekia have been sequenced and phylogenetically analysed. The analyses revealed that the German sequences obtained from the Telekia powdery mildew are identical with a sequence retrieved from Golovinomyces inulae on Pentanema salicinum (≡ Inula salicina) collected in Switzerland. Furthermore, holotype material of G. inulae, described from Korea, has been sequenced, which confirmed G. inulae as causative agent of the Telekia powdery mildew. The current distribution of G. inulae in Germany is briefly discussed including a first report of this pathogen from Austria.}, number={5}, journal={Journal of Plant Diseases and Protection}, publisher={Springer Science and Business Media LLC}, author={Götz, M. and Kruse, J. and Bradshaw, M. and Richter, U. and Braun, U.}, year={2023}, month={Mar}, pages={1129–1134} }
 @article{bradshaw_braun_quijada_coombes_contreras-paredes_pfister_2023, title={Phylogeny and taxonomy of the genera of Erysiphaceae, part 3: <i>Cystotheca}, volume={115}, ISSN={0027-5514 1557-2536}, url={http://dx.doi.org/10.1080/00275514.2023.2194172}, DOI={10.1080/00275514.2023.2194172}, abstractNote={ABSTRACT This contribution is part of a series devoted to the phylogeny and taxonomy of powdery mildews, with an emphasis on North American taxa. An overview of Cystotheca species is given, including references to ex-type sequences or, if unavailable, proposals for representative reference sequences for phylogenetic-taxonomic purposes. The new species C. mexicana is described, based on Mexican collections on Quercus glaucoides × Quercus microphylla and Quercus liebmannii × Q. microphylla. Cystotheca lanestris is reported for the first time worldwide on Quercus laceyi (Collected in Mexico) and on Q. toumeyi (collected in Arizona, USA). Cystotheca lanestris on Q. agrifolia and on Q. cerris is reported for the first time in Mexico. Epitypes with ex-epitype sequences are designated for Cystotheca wrightii, Lanomyces tjibodensis (= C. tjibodensis), Sphaerotheca kusanoi, and S. lanestris (C. lanestris).}, number={3}, journal={Mycologia}, publisher={Informa UK Limited}, author={Bradshaw, Michael and Braun, Uwe and Quijada, Luis and Coombes, Allen J. and Contreras-Paredes, Carlos and Pfister, Donald H.}, year={2023}, month={May}, pages={427–436} }
 @article{bradshaw_braun_pfister_2023, title={Phylogeny and taxonomy of the genera of Erysiphaceae, part 4:
            <i>Erysiphe
            (the “Uncinula lineage”)}, volume={115}, ISSN={0027-5514 1557-2536}, url={http://dx.doi.org/10.1080/00275514.2023.2230853}, DOI={10.1080/00275514.2023.2230853}, abstractNote={ABSTRACT This is the fourth contribution within an ongoing series dedicated to the phylogeny and taxonomy of powdery mildews. This particular installment undertakes a comprehensive evaluation of a group previously referred to as the “Uncinula lineage” within Erysiphe. The genus Erysiphe is too large to be assessed in a single paper; thus, the treatment of Erysiphe is split into three parts, according to phylogenetic lineages. The first paper, presented here, discusses the most basal lineage of Erysiphe and its relationship to allied basal genera within tribe Erysipheae (i.e., Brasiliomyces and Salmonomyces). ITS+28S analyses are insufficient to resolve the basal assemblage of taxa within the Erysipheae. Therefore, phylogenetic multilocus examinations have been carried out to better understand the evolution of these taxa. The results of our analyses favor maintaining Brasiliomyces, Bulbomicroidium, and Salmonomyces as separate genera, at least for the interim, until further phylogenetic multilocus data are available for additional basal taxa within the Erysipheae. The current analyses also confirmed previous results that showed that the “Uncinula lineage” is not exclusively composed of Erysiphe species of sect. Uncinula but also includes some species that morphologically align with sect. Erysiphe, as well as species that had previously been assigned to Californiomyces and Typhulochaeta. Numerous sequences of Erysiphe species from the “Uncinula lineage” have been included in the present phylogenetic analyses and were confirmed by their position in well-supported species clades. Several species have been sequenced for the first time, including Erysiphe clintonii, E. couchii, E. geniculata, E. macrospora, and E. parvula. Ex-type sequences are provided for 16 taxa including E. nothofagi, E. trinae, and E. variabilis. Epitypes are designated and ex-epitype sequences are added for 18 taxa including Erysiphe carpophila, E. densa, and U. geniculata var. carpinicola. The new species Erysiphe canariensis is described, and the new names E. hosagoudarii and E. pseudoprunastri and the new combination E. ampelopsidis are introduced.}, number={6}, journal={Mycologia}, publisher={Informa UK Limited}, author={Bradshaw, Michael and Braun, Uwe and Pfister, Donald H.}, year={2023}, month={Sep}, pages={871–903} }
 @article{bradshaw_braun_quijada_pfister_2023, title={Phylogeny and taxonomy of the genera of Erysiphaceae, part 5:
            <i>Erysiphe
            (the “
            <i>Microsphaera
            lineage” part 1)}, volume={11}, ISSN={0027-5514 1557-2536}, url={http://dx.doi.org/10.1080/00275514.2023.2252715}, DOI={10.1080/00275514.2023.2252715}, abstractNote={In this contribution, we offer the fifth installment of a series focusing on the phylogeny and taxonomy of powdery mildews. This paper is the second segment evaluating the genus Erysiphe. The first treatment of Erysiphe focused on phylogenetically basal species in the "Uncinula lineage." This research presents a phylogenetic-taxonomic assessment of species that form the group previously referred to as the "Microsphaera lineage." Given the size of the group, we split the treatment of this lineage of Erysiphe species into two parts based on their phylogenetic placement. Phylogenetic trees based on ITS+28S data are supplemented by sequences of additional markers (CAM, GADPH, GS, RPB2, and TUB). Included in the analysis of the Microsphaera lineage is the "Erysiphe aquilegiae complex" (group, clade, cluster), which encompasses sequences obtained from an assemblage of Erysiphe species with insufficient resolution in rDNA analyses. Attempts have been made to resolve this group at the species level by applying a multilocus approach. A detailed discussion of the "Erysiphe aquilegiae complex" is provided. Sequences are provided for the first time for several species, particularly North American species, such as Erysiphe aggregata, E. erineophila, E. parnassiae, and E. semitosta. Ex-type sequences for Microsphaera benzoin and M. magnusii have been retrieved. Alphitomorpha penicillata, Microsphaera vanbruntiana, and M. symphoricarpi are epitypified with ex-epitype sequences. The new species Erysiphe alnicola, E. deutziana, E. cornigena, E. lentaginis, and E. sambucina are described, the new combinations E. lauracearum, E. passiflorae, and E. sambucicola are introduced, and the new name E. santali is proposed.}, journal={Mycologia}, publisher={Informa UK Limited}, author={Bradshaw, Michael and Braun, Uwe and Quijada, Luis and Pfister, Donald H.}, year={2023}, month={Nov}, pages={1–42} }
 @article{bradshaw_braun_takamatsu_németh_seress_pfister_2023, title={The
            <i>Erysiphe alphitoides
            complex (powdery mildews) – unravelling the phylogeny and taxonomy of an intricate assemblage of species}, volume={11}, ISSN={0028-825X 1175-8643}, url={http://dx.doi.org/10.1080/0028825X.2023.2276913}, DOI={10.1080/0028825X.2023.2276913}, abstractNote={Powdery mildews on oaks, caused by Erysiphe species, have serious ecological consequences on a range of Quercus hosts. In addition to Erysiphe quercicola, E. alphitoides is one of the most common and widespread species of Erysiphe having a wide host range among oak species, and a clear economic significance in applied ecology, forestry, and forest pathology. There are many publications addressing these important tree pathogens. Previous phylogenetic examinations have shown that E. alphitoides refers to a complicated species assemblage with insufficient taxonomic resolution in ITS + 28S analyses; the associated sequences form an insufficiently resolved species complex. The majority of species within the E. alphitoides complex cannot be unequivocally identified based solely on ITS + 28S analyses. Most of the additional species of the E. alphitoides complex are distributed in Asia, with a concentration in Japan. The question posed is whether there is a single widespread powdery mildew species, E. alphitoides, or an assemblage of closely allied species. To answer this question, specimens of related recognized species, particularly those from Japan, have been subjected to phylogenetic multilocus examinations, including CAM, GAPDH, GS, ITS + 28S, RPB2, and TUB sequences. An analysis of the concatenated sequences resulted in the confirmation of several distinct species. These species form highly supported clades that include E. alphitoides, E. aucubae, E. euonymicola, E. ipomoeae, E. menispermi var. dahurica, E. orixae, E. pseudolonicerae, E. sinomenii and E. wallrothii. Erysiphe akebiae as well as the relationship between Japanese and North American collections requires further examinations.}, journal={New Zealand Journal of Botany}, publisher={Informa UK Limited}, author={Bradshaw, Michael and Braun, Uwe and Takamatsu, Susumu and Németh, Márk Z. and Seress, Diána and Pfister, Donald H.}, year={2023}, month={Nov}, pages={1–17} }
 @article{braun_bradshaw_pfister_2022, title={(2863) Proposal to conserve the name <i>Golovinomyces</i> against <i>Euoidium</i> (<i>Ascomycota</i>: <i>Erysiphaceae</i>)}, volume={71}, ISSN={0040-0262 1996-8175}, url={http://dx.doi.org/10.1002/tax.12692}, DOI={10.1002/tax.12692}, abstractNote={(2863) Golovinomyces (U. Braun) Heluta in Biol. Zhurn. Armenii 41: 357. 1988 (Erysiphe sect. Golovinomyces U. Braun in Feddes Repert. 88: 659. 1978), nom. cons. prop. Typus: Erysiphe cichoracearum DC. (G. cichoracearum (DC.) Heluta). (=) Euoidium Y.S. Paul & J.N. Kapoor in Indian Phytopathol. 38: 761. 1985, nom. rej. prop. Typus: E. erysiphoides (Fr.) Y.S. Paul & J.N. Kapoor (Oidium erysiphoides Fr., nom. sanct.). Braun (in Feddes Repert. 88: 659. 1978) introduced Erysiphe sect. Golovinomyces, with Erysiphe cichoracearum DC. as type, for powdery mildews characterized by having chasmothecia with mycelium-like appendages, two-spored asci (except in a few cases), and anamorphs with conidiophores that form conidia in genuine chains (catenescent) without fibrosin bodies. Heluta (in Biol. Zhurn. Armenii 41: 357. 1988) raised this section to generic rank. The first analyses of sequences retrieved from species of Erysiphe sect. Golovinomyces (Saenz & Taylor in Canad. J. Bot. 77: 150–169. 1999; Mori & al. in Mycologia 92: 74–93. 2000) revealed that E. sect. Golovinomyces needed to be recognized as a genus of its own as was indicated by Heluta (l.c.). Accordingly, Braun (in Schlechtendalia 3: 52. 1999) recognized the genus Golovinomyces. Golovinomyces is now the name used worldwide for this group of powdery mildews (Shin, Erysiphaceae Korea [Pl. Pathog. Korea 2]: 73. 2000; Matsuda & Takamatsu in Molec. Phylogen. Evol. 27: 314–327. 2003; Bolay in Cryptog. Helv. 20: 84. 2005; Takamatsu & al. in Mycol. Res. 110: 1093–1101. 2006; Voytyuk & al., Biodivers. Powdery Mildew Fungi Israel: 148. 2009; Liu, Erysiphaceae Inner Mongolia: 142. 2010; Braun & Cook, Taxon. Manual Erysiphales (Powdery Mildews) [CBS Biodivers. Series 11]: 432. 2012; Qiu & al. in B. M. C. Microbiol. 20: 51. 2020). Before the abandonment of the dual naming of fungi, Cook & al. (in Mycol. Res. 101: 998. 1997) divided the genus Oidium into subgenera corresponding to the phylogenetically confirmed teleomorph-typified powdery mildew genera, including Oidium subg. Reticuloidium for anamorphs of Golovinomyces. Braun & Cook (l.c.) raised these subgenera to generic rank, except for O. subg. Reticuloidium for which the genus name Euoidium was taken into consideration. They clarified the application of the genus name Euoidium (Paul & Kapoor in Indian Phytopathol. 38: 761. 1985) by neotypification of its type, Oidium erysiphoides Fr. (Syst. Mycol. 3: 432. 1832), with a collection of the anamorph of Golovinomyces biocellatus (Ehrenb.) Heluta (in Ukrayins'k. Bot. Zhurn. 45(5): 62. 1988). Euoidium thus became a heterotypic synonym of Golovinomyces and was used for anamorphs of this genus. However, with the discontinuation of the dual nomenclature of pleomorphic fungi in the Melbourne Code (McNeill & al. in Regnum Veg. 154. 2012), the generic name Euoidium, validly published in 1985, took precedence over Golovinomyces, which had only been introduced at generic rank in 1988. Braun (in IMA Fungus 3: 81–86. 2012) recommended that taxonomists generally give preference to teleomorph-typified names rather than anamorph-typified names for powdery mildews. Braun (in Taxon 62: 1328–1338. 2013) proposed the conservation of the teleomorph-typified name Blumeria against the anamorph-typified name Oidium and 22 teleomorph-typified powdery mildew species names against competing anamorph-typified names, and these have all subsequently been accepted. However, the Golovinomyces/Euoidium issue was not included. The recognition and application of the older name Euoidium for former Golovinomyces species and varieties would necessitate the introduction of about 66 new combinations. Therefore, we propose to conserve Golovinomyces against Euoidium.}, number={2}, journal={TAXON}, publisher={Wiley}, author={Braun, Uwe and Bradshaw, Michael and Pfister, Donald H.}, year={2022}, month={Apr}, pages={459–459} }
 @article{braun_bradshaw_pfister_2022, title={(2864) Proposal to conserve the name <i>Microsphaera alphitoides</i> (<i>Erysiphe alphitoides</i>) (<i>Ascomycota</i>: <i>Erysiphaceae</i>) with a conserved type}, volume={71}, ISSN={0040-0262 1996-8175}, url={http://dx.doi.org/10.1002/tax.12693}, DOI={10.1002/tax.12693}, abstractNote={(2864) Microsphaera alphitoides Griffon & Maubl. in Bull. Trimestriel Soc. Mycol. France 28: 103. 1912, nom. cons. prop. Typus: Switzerland, Neuchâtel, on Quercus robur, 4 Apr 1999, Takamatsu (TNS barcode TNS-F87437), typ. cons. prop. Erysiphe alphitoides (Griffon & Maubl.) U. Braun & S. Takam. (in Schlechtendalia 4: 5. 2000) (≡ Microsphaera alphitoides Griffon & Maubl. in Bull. Trimestriel Soc. Mycol. France 28: 103. 1912) is a common, widespread, and almost cosmopolitan powdery mildew on oaks. It is a pathogen of economic and forest pathological importance (Desprez-Loustau & al. in Fungal Ecol. 36: 39–50. 2018). Griffon & Maublanc (l.c.) described Microsphaera alphitoides from France on Quercus petraea (and not Q. robur as previously assumed). Exact publication dates (month and day) are not given in the journal. For more than 100 years, this name has been used for the most common oak powdery mildew in Asia and Europe (Blumer in Beitr. Kryptogamenfl. Schweiz 7: 317. 1933; Homma in Trans. Sapporo Nat. Hist. Soc. 13: 383. 1937; Braun in Beih. Nova Hedwigia 89: 386. 1987; Braun & Cook, Taxon. Manual Erysiphales (Powdery Mildews) [CBS Biodivers. Series 11]: 432. 2012). Braun (l.c.) assumed that type material of Microsphaera alphitoides was deposited at the PC herbarium in Paris but failed to trace it in this or any other European herbaria. Takamatsu & al. (in Mycol. Res. 111: 814. 2007), assuming the holotype to be lost, proposed a neotype for M. alphitoides, including ex-neotype sequences. However, they overlooked that Griffon & Maublanc (l.c.: t. 5, fig. 25–29) had published an illustration (drawing) that belongs, according to Art. 9.4, to the original material of this name. This must be taken into consideration for lectotypification purposes (Art. 9.3), especially in the absence of the holotype. However, an original specimen of M. alphitoides has recently been found in the Farlow Herbarium (FH), under the name M. quercina. Since this seems to be the only existing specimen of original material, it may be regarded as the holotype (Art. 9.1, Note 1), thus fixing the application of this name. However, results of recently performed sequence analyses of this holotype material (Bradshaw & al. in Forest Pathol. 52: submitted. 2022) revealed that sequences of M. alphitoides are identical to those of the powdery mildew that is currently referred to as Erysiphe quercicola S. Takam. & U. Braun (in Mycol. Res. 111: 819. 2007), i.e., E. quercicola becomes a heterotypic synonym of E. alphitoides. The common oak powdery mildew, which has so far been assigned to E. alphitoides, would require a new name. The grouping of the ex-holotype sequence with E. quercicola is in accordance with recently published findings evaluating the invasion of oak powdery mildew in Europe, which suggested that the common oak powdery mildew, previously referred to as Microsphaera/Erysiphe alphitoides, was not present in European herbaria until 1921; and did not become widespread throughout Europe until after 1960 (Gross & al. in Biol. Invas. 23: 885–901. 2020). The application of names is ruled by the corresponding types (Art. 7.1), i.e., the rediscovery of the holotype of Microsphaera alphitoides would lead to the use of this name for the powdery mildew that has hitherto been referred to as Erysiphe quercicola. The effects of this discovery of the identity of M. alphitoides would be enormous and cause confusions. Without detailed explanations and underlying sequence data, it would be difficult in the future to ascertain which oak powdery mildew was E. alphitoides. To avoid confusion and upheaval we propose to conserve the name M. alphitoides with the "neotype" previously proposed (Takamatsu & al., l.c.) as a conserved type. With this proposal, we intend to maintain the names E. alphitoides and E. quercicola in their present, established sense and circumscription.}, number={2}, journal={TAXON}, publisher={Wiley}, author={Braun, Uwe and Bradshaw, Michael and Pfister, Donald H.}, year={2022}, month={Mar}, pages={460–460} }
 @article{bartholomew_lichtner_bradshaw_gaskins_fonseca_bennett_jurick_2022, title={Comparative Penicillium spp. Transcriptomics: Conserved Pathways and Processes Revealed in Ungerminated Conidia and during Postharvest Apple Fruit Decay}, volume={10}, ISSN={2076-2607}, url={http://dx.doi.org/10.3390/microorganisms10122414}, DOI={10.3390/microorganisms10122414}, abstractNote={Blue mold, caused by Penicillium spp., is an impactful postharvest disease resulting in significant economic losses due to reduced pome fruit quality and mycotoxin contamination. Using two Penicillium species with different levels of aggressiveness, transcriptomics were implemented in order to identify genes expressed during apple fruit decay and loci expressed in ungerminated conidia. Total RNA was isolated from ungerminated conidia and decayed apple fruit infected with P. expansum R19 or P. polonicum RS1. There were 2442 differentially expressed genes (DEGs) between the R19 and RS1 in apple. Comparisons within species between apple and conidia revealed 4404 DEGs for R19 and 2935 for RS1, respectively. Gene ontology (GO) analysis revealed differential regulation in fungal transport and metabolism genes during decay, suggesting a flux in nutrient acquisition and detoxification strategies. In R19, the oxidoreductase GO category comprised 20% of all DEG groups in apple verses conidia. Ungerminated conidia from both species showed DEGs encoding the glyoxylate shunt and beta-oxidation, specifying the earliest metabolic requirements for germination. This is the first study to identify pre-loaded transcripts in conidia from blue mold fungi, reveal unique genes between species expressed during apple decay, and show the expression dynamics of known fungal virulence factors. These findings will enable development of targeted approaches for blue mold abatement strategies.}, number={12}, journal={Microorganisms}, publisher={MDPI AG}, author={Bartholomew, Holly P. and Lichtner, Franz J. and Bradshaw, Michael and Gaskins, Verneta L. and Fonseca, Jorge M. and Bennett, Joan W. and Jurick, Wayne M., II}, year={2022}, month={Dec}, pages={2414} }
 @article{feng_liu_braun_takamatsu_bradshaw_khodaparast_bulgakov_guan_zhao_tang_2022, title={Discovery of a cryptic species, Erysiphe salicina sp. nov., and reconstruction of the phylogeny of powdery mildews on Populus and Salix spp.}, volume={21}, ISSN={1617-416X 1861-8952}, url={http://dx.doi.org/10.1007/s11557-022-01793-1}, DOI={10.1007/s11557-022-01793-1}, abstractNote={Recently performed phylogenetic-taxonomic analyses of species belonging to Erysiphe sect. Uncinula on willows (Salix spp.) demonstrated a much higher diversity than previously assumed. Phylogenetic analyses and morphological examinations of Chinese Erysiphe collections on Salix abscondita (= S. raddeana), S. sinica and S. taraikensis, all belonging to Salix subgen. Vetrix sect. Vetrix, revealed an additional cryptic species which is described as Erysiphe salicina. The new species is morphologically and phylogenetically distinguished from all other powdery mildew species. The phylogeny of the new species and closely related species on Populus and Salix spp. (Salicaceae) was reconstructed and discussed using a combined alignment of the internal transcribed spacer (ITS) regions and partial 28S rDNA sequences. The present phylogenetic analyses suggest that the recently described E. salicicola (on Salix gracilistyla in Republic of Korea) has to be reduced to synonymy with E. salicis-gracilistylae comb. nov. (≡ Uncinula salicis-gracilistylae).}, number={6}, journal={Mycological Progress}, publisher={Springer Science and Business Media LLC}, author={Feng, Jing and Liu, Shu-Yan and Braun, Uwe and Takamatsu, Susumu and Bradshaw, Michael and Khodaparast, Seyed Akbar and Bulgakov, Timur S. and Guan, Guan-Xiu and Zhao, Feng-Yun and Tang, Shu-Rong}, year={2022}, month={May} }
 @article{bradshaw_carey_liu_bartholomew_jurick_hambleton_hendricks_schnittler_scholler_2023, title={Genetic time traveling: sequencing old herbarium specimens, including the oldest herbarium specimen sequenced from kingdom Fungi, reveals the population structure of an agriculturally significant rust}, volume={237}, ISSN={0028-646X 1469-8137}, url={http://dx.doi.org/10.1111/nph.18622}, DOI={10.1111/nph.18622}, abstractNote={Summary


Sequencing herbarium specimens can be instrumental in answering ecological, evolutionary, and taxonomic inquiries. We developed a protocol for sequencing herbarium specimens of rust fungi (Pucciniales) and proceeded to sequence specimens ranging from 4 to 211 yr old from five different genera.

We then obtained sequences from an economically important biological control agent, Puccinia suaveolens, to highlight the potential of sequencing herbarium specimens in an ecological sense and to evaluate the following hypotheses: (1) The population structure of a plant pathogen changes over time, and (2) introduced pathogens are more diverse in their native range.

Our efforts resulted in sequences from 87 herbarium specimens that revealed a high level of diversity with a population structure that exhibited spatial–temporal patterns. The specimens sequenced from Europe showed more diversity than the ones from North America, uncovering an invasion pattern likely related to its European native host in North America. Additionally, to the best of our knowledge, the specimen from France collected in c. 1811 is the oldest herbarium specimen sequenced from kingdom Fungi.

In conclusion, sequencing old herbarium specimens is an important tool that can be extrapolated to better understand plant–microbe evolution and to evaluate old type specimens to solidify the taxonomy of plant pathogenic fungi.

}, number={4}, journal={New Phytologist}, publisher={Wiley}, author={Bradshaw, Michael J. and Carey, Julie and Liu, Miao and Bartholomew, Holly P. and Jurick, Wayne M., II and Hambleton, Sarah and Hendricks, Dylan and Schnittler, Martin and Scholler, Markus}, year={2023}, month={Feb}, pages={1463–1473} }
 @article{bradshaw_quijada_tobin_braun_newlander_potterfield_alford_contreras_coombes_moparthi_et al._2022, title={More Than Just Plants: Botanical Gardens Are an Untapped Source of Fungal Diversity}, volume={57}, ISSN={0018-5345 2327-9834}, url={http://dx.doi.org/10.21273/HORTSCI16755-22}, DOI={10.21273/HORTSCI16755-22}, abstractNote={Botanical gardens have extensive spatial databases of their plant specimens; however, the fungi occurring in them are generally unstudied. Botanical gardens, with their great plant diversity, undoubtedly harbor a wide range of symbiotic fungi, including those that are plant-pathogenic. One such group of fungi is powdery mildews (Erysiphaceae). The powdery mildews are among the most prevalent and economically important plant pathogens in the world, with an estimated 906 species in 19 genera. They are known to infect more than 10,000 species of flowering plants and although some species occur across a range of hosts, many are associated with specific plants. Powdery mildews have undergone a long and dynamic coevolution with their host plants, resulting in co-speciation. Botanical gardens provide a living laboratory in which to study these fungi, leading to a wealth of undiscovered fungal diversity. Furthermore, monitoring pathogens in botanical gardens has led to important ecological findings related to the plant sciences and plant protection. Between 2018 and 2022, a collaborative citizen science project was established with 10 botanical gardens in the United States and Mexico. A total of more than 300 powdery mildew specimens were collected on 220 different host taxa. We sequenced the entire internal transcribed spacer (ITS) and large subunit (LSU) rDNA loci and phylogenetically and morphologically analyzed these collections revealing 130 species, of which 31 are likely unknown to science. This research highlights the importance of botanical gardens as a reservoir of fungal diversity. Future research will further elucidate the coevolutionary relationship between powdery mildews and their hosts and extend the current study to evaluate other plant pathogens and fungi in botanical gardens.}, number={10}, journal={HortScience}, publisher={American Society for Horticultural Science}, author={Bradshaw, Michael J. and Quijada, Luis and Tobin, Patrick C. and Braun, Uwe and Newlander, Cindy and Potterfield, Tom and Alford, Élan R. and Contreras, Carlos and Coombes, Allen and Moparthi, Swarnalatha and et al.}, year={2022}, month={Oct}, pages={1289–1293} }
 @article{bartholomew_bradshaw_macarisin_gaskins_fonseca_jurick_2022, title={More than a Virulence Factor: Patulin Is a Non-Host-Specific Toxin that Inhibits Postharvest Phytopathogens and Requires Efflux for <i>Penicillium</i> Tolerance}, volume={112}, ISSN={0031-949X 1943-7684}, url={http://dx.doi.org/10.1094/phyto-09-21-0371-r}, DOI={10.1094/phyto-09-21-0371-r}, abstractNote={ Mycotoxin contamination is a leading cause of food spoilage and waste on a global scale. Patulin, a mycotoxin produced by Penicillium spp. during postharvest pome fruit decay, causes acute and chronic effects in humans, withstands pasteurization, and is not eliminated by fermentation. While much is known about the impact of patulin on human health, there are significant knowledge gaps concerning the effect of patulin during postharvest fruit–pathogen interactions. Application of patulin on six apple cultivars reproduced some blue mold symptoms that were cultivar-independent and dose-dependent. Identical symptoms were also observed in pear and mandarin orange. Six Penicillium isolates exposed to exogenous patulin exhibited delayed germination after 24 h, yet all produced viable colonies in 7 days. However, four common postharvest phytopathogenic fungi were completely inhibited by patulin during conidial germination and growth, suggesting the toxin is important for Penicillium to dominate the postharvest niche. Using clorgyline, a broad-spectrum efflux pump inhibitor, we demonstrated that efflux plays a role in Penicillium auto-resistance to patulin during conidial germination. The work presented here contributes new knowledge of patulin auto-resistance, its mode of action, and inhibitory role in fungal–fungal interactions. Our findings provide a solid foundation to develop toxin and decay mitigation approaches. }, number={5}, journal={Phytopathology®}, publisher={Scientific Societies}, author={Bartholomew, Holly P. and Bradshaw, Michael J. and Macarisin, Otilia and Gaskins, Verneta L. and Fonseca, Jorge M. and Jurick, Wayne M., II}, year={2022}, month={May}, pages={1165–1174} }
 @article{jurick_messinger_wallis_peter_villani_bradshaw_bartholomew_buser_aćimović_fonseca_et al._2022, title={PATHMAP (Pathogen And Tree fruit Health MAP): A Smartphone App and Interactive Dashboard to Record and Map Tree Fruit Diseases, Disorders, and Insect Pests}, volume={2}, ISSN={2690-5442}, url={http://dx.doi.org/10.1094/PHYTOFR-06-22-0070-TA}, DOI={10.1094/PHYTOFR-06-22-0070-TA}, abstractNote={ PATHMAP (Pathogen And Tree fruit Health MAP) is a smartphone application (app) and interactive dashboard developed specifically for support specialists, extension personnel, and university scientists supporting the tree fruit industry. The PATHMAP app collects detailed information about observed diseases, insect pests, and disorders and provides the option to attach photos. The data are then visualized using a graphical interface dashboard displaying an interactive color-coded map. Prior to the development of PATHMAP, abundant tree fruit disorder data were collected each year, but a central interactive repository for archiving data and facilitating communication of field observations did not exist. PATHMAP has been beta tested by university extension personnel, private consultants, and university scientists to ensure usability and functionality. PATHMAP will be used within the tree fruit industry for monitoring known pest patterns, occurrences, and outbreaks of emerging pathogens. It will augment existing extension diagnosis listservs that have value in visual diagnosis but are cumbersome and have no archiving capabilities. Data obtained through the tool can be used in epidemiological meta-analyses and to develop new predictive models, and can serve as a platform to track emerging pathogens, insects, and disorders for a variety of cropping systems.  [Formula: see text] The author(s) have dedicated the work to the public domain under the Creative Commons CC0 “No Rights Reserved” license by waiving all of his or her rights to the work worldwide under copyright law, including all related and neighboring rights, to the extent allowed by law, 2022. }, number={4}, journal={PhytoFrontiers™}, publisher={Scientific Societies}, author={Jurick, Wayne M., II and Messinger, Lindsey and Wallis, Anna and Peter, Kari A. and Villani, Sara and Bradshaw, Michael J. and Bartholomew, Holly P. and Buser, Michael and Aćimović, Srđan G. and Fonseca, Jorge M. and et al.}, year={2022}, month={Dec}, pages={331–338} }
 @article{lichtner_jurick_bradshaw_broeckling_bauchan_broders_2022, title={Penicillium raperi, a species isolated from Colorado cropping soils, is a potential biological control agent that produces multiple metabolites and is antagonistic against postharvest phytopathogens}, volume={21}, ISSN={1617-416X 1861-8952}, url={http://dx.doi.org/10.1007/s11557-022-01812-1}, DOI={10.1007/s11557-022-01812-1}, number={7}, journal={Mycological Progress}, publisher={Springer Science and Business Media LLC}, author={Lichtner, Franz J. and Jurick, Wayne M., II and Bradshaw, Michael and Broeckling, Corey and Bauchan, Gary and Broders, Kirk}, year={2022}, month={Jun} }
 @article{liu_bradshaw_braun_götz_khodaparast_liu_bulgakov_darsaraei_hofbauer_li_et al._2022, title={Phylogeny and taxonomy of <i>Erysiphe berberidis</i> (s. lat.) revisited}, volume={63}, ISSN={1340-3540 1618-2545}, url={http://dx.doi.org/10.47371/mycosci.2022.07.005}, DOI={10.47371/mycosci.2022.07.005}, abstractNote={Phylogenetic and morphological analyses have been conducted on powdery mildew specimens on different Berberis and Mahonia spp. from Asia, Europe and North America. The present study showed that collections of Erysiphe berberidis exhibit a high degree of morphological plasticity of the sexual morph, in contrast to their morphologically, rather uniform, asexual morph. In phylogenetic tree, all sequences cluster in a large strongly supported clade, without any indication and support for further differentiation into cryptic species. There are three morphological types within E. berberidis s. lat. that contain consistent differences. Until future multi-locus analyses will be available, we prefer to treat these 'morphological types' as varieties. These include Erysiphe berberidis var. berberidis, E. berberidis var. asiatica, and E. berberidis var. dimorpha comb. nov. (≡ Microsphaera berberidis var. dimorpha, M. berberidicola, and M. multappendicis). To fix the application of species name E. berberidis, an appropriate epitype was designated, with an ITS sequences.}, number={5}, journal={Mycoscience}, publisher={The Mycological Society of Japan}, author={Liu, Li and Bradshaw, Michael and Braun, Uwe and Götz, Monika and Khodaparast, Seyed Akbar and Liu, Tie-zhi and Bulgakov, Timur S. and Darsaraei, Hamideh and Hofbauer, Wolfgang Karl and Li, Yu and et al.}, year={2022}, month={Sep}, pages={222–234} }
 @article{tymon_bradshaw_götz_braun_peever_edmonds_2022, title={Phylogeny and taxonomy of <i>Erysiphe</i> spp. on <i>Rhododendron</i>, with a special emphasis on North American species}, volume={114}, ISSN={0027-5514 1557-2536}, url={http://dx.doi.org/10.1080/00275514.2022.2090219}, DOI={10.1080/00275514.2022.2090219}, abstractNote={ABSTRACT The genus Rhododendron comprises over 1000 evergreen and deciduous species. In the Pacific Northwest Coast region of North America (PNWC), powdery mildews infecting deciduous Rhododendron spp. are well documented but less so on evergreen Rhododendron spp. Infections of both groups of hosts historically have been attributed to Erysiphe azaleae or E. vaccinii. No formal characterizations of powdery mildew fungi infecting either deciduous or evergreen Rhododendron spp. in the PNWC have been completed. The objectives of this study were to identify the powdery mildew pathogens infecting evergreen Rhododendron spp. in the PNWC and to assess the phylogenetic position of these fungi within the Erysiphaceae. To ascertain valid taxonomic conclusions, and to determine whether potential introductions of exotic Rhododendron powdery mildews in North America have occurred, it was necessary to put the new North American phylogenetic data into a worldwide context. Therefore, available phylogenetic data from all Erysiphe spp. on Rhododendron have been included in our analyses. Based on analyses of numerous new internal transcribed spacer (ITS) and 28S rDNA sequences and already available sequences deposited in GenBank retrieved from evergreen and deciduous Rhododendron spp., the following Erysiphe spp. could be phylogenetically confirmed (all belonging to Erysiphe sect. Microsphaera): Erysiphe azaleae nom. cons. (Oidium ericinum could be verified as a synonym), E. digitata (holotype sequenced), E. izuensis, and E. vaccinii. Erysiphe azaleae and E. vaccinii are epitypified with sequenced specimens, and an ex-neotype sequence has been obtained for Oidium ericinum. Erysiphe rhododendri (Erysiphe sect. Erysiphe), only known from two collections in India (Himalayan region), was not available for phylogentic analyses.}, number={5}, journal={Mycologia}, publisher={Informa UK Limited}, author={Tymon, Lydia S. and Bradshaw, Michael and Götz, Monika and Braun, Uwe and Peever, Tobin L. and Edmonds, Robert L.}, year={2022}, month={Jul}, pages={887–899} }
 @article{bradshaw_braun_götz_pfister_2022, title={Phylogeny and taxonomy of the genera of the Erysiphaceae, part 2, Neoerysiphe}, volume={114}, DOI={10.1080/00275514.2022.2115420}, abstractNote={ABSTRACT The second contribution to a new series devoted to the phylogeny and taxonomy of powdery mildews is presented. An overview of Neoerysiphe species is given, including references to ex-type sequences or, if unavailable, representative reference sequences for phylogenetic-taxonomic purposes are provided. The new species N. stachydis is described, and Striatoidium jaborosae is reduced to synonymy with Neoerysiphe macquii. Epitypes with ex-epitype sequences are designated for Alphitomorpha ballotae, A. labiatarum, Erysiphe galii, E. chelones, and E. galeopsidis. Based on phylogenetic analyses, it has been demonstrated that Neoerysiphe cumminsiana is confined to its type host, Roldana hartwegii (= Senecio seemannii), and other North and South American parasites on Asteraceae hosts, previously assigned to this species, pertain to N. macquii. The first record of N. macquii from Europe (Germany) on cultivated Bidens aurea was confirmed by sequencing. Sequence analysis of type material of N. rubiae reveals that this species should be excluded from Neoerysiphe; however, the true affinity of this taxon is not yet clear.}, number={6}, journal={Mycologia}, author={Bradshaw, Michael J. and Braun, Uwe and Götz, Monika and Pfister, Donald H.}, year={2022}, pages={994–1007} }
 @misc{moparthi_bradshaw_2022, title={Podosphaera spiraeae (Japanese spiraea powdery mildew)}, url={http://dx.doi.org/10.1079/cabicompendium.57273799}, DOI={10.1079/cabicompendium.57273799}, abstractNote={This datasheet on Podosphaera spiraeae covers Identity, Overview, Distribution, Dispersal, Hosts/Species Affected, Vectors & Intermediate Hosts, Diagnosis, Biology & Ecology, Environmental Requirements, Impacts, Prevention/Control, Further Information.}, journal={CABI Compendium}, publisher={CABI Publishing}, author={Moparthi, Swarnalatha and Bradshaw, M}, year={2022}, month={Jan} }
 @article{bradshaw_braun_pfister_2022, title={Powdery mildews on <i>Quercus</i>: A worldwide distribution and rediscovered holotype provide insights into the spread of these ecologically important pathogens}, volume={52}, ISSN={1437-4781 1439-0329}, url={http://dx.doi.org/10.1111/efp.12742}, DOI={10.1111/efp.12742}, abstractNote={AbstractPowdery mildew on oak, caused by Erysiphe spp., has been shown to have serious ecological consequences on a range of Quercus hosts. Erysiphe alphitoides and E. quercicola are two of the most heavily studied and common powdery mildews known to occur on Quercus species. In recent years, these species have been noted throughout the world on a range of hosts within and outside the Quercus genus. Reports that E. alphitoides was absent in European herbaria before 1921 and the discovery of the holotype of E. alphitoides from 1911 in an American herbarium (FH) led to the current study in which we genetically analysed six specimens of E. alphitoides s. lat including, most importantly, the holotype of E. alphitoides from France collected in 1911. The results of our analyses revealed that: (1) The sequence of the E. alphitoides holotype falls within the E. quercicola clade, confirming that E. alphitoides did not spread to Europe until ~1921. (2) E. alphitoides var. chenii forms a monophyletic clade with E. epigena and should be reduced to synonymy with that species and (3) through sequence analyses E. alphitoides and E. quercicola are confirmed to have spread to North America. The sequencing results of the E. alphitoides holotype have severe nomenclatural‐taxonomic consequences. A proposal was submitted simultaneously with the present manuscript to conserve the name E. alphitoides so that the traditional usage of the names E. alphitoides and E. quercicola could be maintained. The sequences obtained for the current study provide new insight into the taxonomy and spread of these ecologically significant, globally distributed species. The present study highlights the importance of sequencing specimens from type material, above all when morphological similar species are involved.}, number={3}, journal={Forest Pathology}, publisher={Wiley}, author={Bradshaw, Michael and Braun, Uwe and Pfister, Donald H.}, year={2022}, month={Apr} }
 @article{bradshaw_guan_nokes_braun_liu_pfister_2022, title={Secondary DNA Barcodes (CAM, GAPDH, GS, and RpB2) to Characterize Species Complexes and Strengthen the Powdery Mildew Phylogeny}, volume={10}, ISSN={2296-701X}, url={http://dx.doi.org/10.3389/fevo.2022.918908}, DOI={10.3389/fevo.2022.918908}, abstractNote={Powdery mildews are a group of economically and ecologically important plant pathogens. In the past 25 years the use of ribosomal DNA (rDNA) in the powdery mildews has led to major taxonomic revisions. However, the broad scale use of rDNA has also revealed multiple species complexes that cannot be differentiated based on ITS + LSU data alone. Currently, there are only two powdery mildew taxonomic studies that took a multi-locus approach to resolve a species complex. In the present study, we introduce primers to sequence four additional regions (CAM, GAPDH, GS, and RPB2) that have the potential to improve support values in both broad and fine scale phylogenetic analyses. The primers were applied to a broad set of powdery mildew genera in China and the United States, and phylogenetic analyses included some of the common complexes. In taxa with nearly identical ITS sequences the analyses revealed a great amount of diversity. In total 154 non-rDNA sequences from 11 different powdery mildew genera were deposited in NCBI’s GenBank, laying the foundation for secondary barcode databases for powdery mildews. The combined and single loci phylogenetic trees constructed generally followed the previously defined species/genus concepts for the powdery mildews. Future research can use these primers to conduct in depth phylogenetic, and taxonomic studies to elucidate the evolutionary relationships of species and genera within the powdery mildews.}, journal={Frontiers in Ecology and Evolution}, publisher={Frontiers Media SA}, author={Bradshaw, Michael J. and Guan, Guan-Xiu and Nokes, Liam and Braun, Uwe and Liu, Shu-Yan and Pfister, Donald H.}, year={2022}, month={Jun} }
 @article{bradshaw_braun_elliott_kruse_liu_guan_tobin_2021, title={A global genetic analysis of herbarium specimens reveals the invasion dynamics of an introduced plant pathogen}, volume={125}, ISSN={1878-6146}, url={http://dx.doi.org/10.1016/j.funbio.2021.03.002}, DOI={10.1016/j.funbio.2021.03.002}, abstractNote={The introduction, spread, and impact of fungal plant pathogens is a critical concern in ecological systems. In this study, we were motivated by the rather sudden appearance of Acermacrophyllum heavily infected with powdery mildew. We used morphological and genetic analyses to confirm the pathogen causing the epidemic was Sawadaea bicornis. In subsequent field studies, this pathogen was found in several locations in western North America, and in greenhouse studies, A. macrophyllum was found to be significantly more susceptible to S. bicornis than nine other Acer species tested. A genetic analysis of 178 specimens of powdery mildew from freshly collected and old herbarium specimens from 15 countries revealed seven different haplotypes. The high diversity of haplotypes found in Europe coupled with sequence results from a specimen from 1864 provides evidence that S. bicornis has a European origin. Furthermore, sequence data from a specimen from 1938 in Canada show that the pathogen has been present in North America for at least 82 years revealing a considerable lag time between the introduction and current epidemic. This study used old herbarium specimens to genetically hypothesize the origin, the native host, and the invasion time of a detrimental fungal plant pathogen.}, number={8}, journal={Fungal Biology}, publisher={Elsevier BV}, author={Bradshaw, Michael and Braun, Uwe and Elliott, Marianne and Kruse, Julia and Liu, Shu-Yan and Guan, Guanxiu and Tobin, Patrick}, year={2021}, month={Aug}, pages={585–595} }
 @article{bradshaw_bartholomew_hendricks_maust_jurick_2021, title={An Analysis of Postharvest Fungal Pathogens Reveals Temporal–Spatial and Host–Pathogen Associations with Fungicide Resistance-Related Mutations}, volume={111}, ISSN={0031-949X 1943-7684}, url={http://dx.doi.org/10.1094/PHYTO-03-21-0119-R}, DOI={10.1094/PHYTO-03-21-0119-R}, abstractNote={ Fungicides are the primary tools to control a wide range of postharvest fungal pathogens. Fungicide resistance is a widespread problem that has reduced the efficacy of fungicides. Resistance to FRAC-1 (Fungicide Resistance Action Committee-1) chemistries is associated with mutations in amino acid position 198 in the β-tubulin gene. In our study, we conducted a meta-analysis of β-tubulin sequences to infer temporal, spatial, plant host, and pathogen genus patterns of fungicide resistance in postharvest fungal pathogens. In total, data were acquired from 2,647 specimens from 12 genera of fungal phytopathogens residing in 53 countries on >200 hosts collected between 1926 and 2020. The specimens containing a position 198 mutation were globally distributed in a variety of pathosystems. Analyses showed that there are associations among the mutation and the year an isolate was collected, the pathogen genus, the pathogen host, and the collection region. Interestingly, fungicide-resistant β-tubulin genotypes have been in a decline since their peak between 2005 and 2009. FRAC-1 fungicide usage data followed a similar pattern in that applications have been in a decline since their peak between 1997 and 2003. The data show that, with the reduction of selection pressure, FRAC-1 fungicide resistance in fungal populations will decline within 5 to 10 years. Based on this line of evidence, we contend that a β-tubulin position 198 mutation has uncharacterized fitness cost(s) on fungi in nature. The compiled dataset can inform end users on the regions and hosts that are most prone to contain resistant pathogens and assist decisions concerning fungicide resistance management strategies. }, number={11}, journal={Phytopathology®}, publisher={Scientific Societies}, author={Bradshaw, Michael J. and Bartholomew, Holly P. and Hendricks, Dylan and Maust, Autumn and Jurick, Wayne M., II}, year={2021}, month={Nov}, pages={1942–1951} }
 @article{bradshaw_braun_götz_takamatsu_brand_cabrera_dirchwolf_kummer_medina_moparthi_et al._2021, title={Contributions to the knowledge of the phylogeny and taxonomy of the Erysiphaceae (powdery mildews) – part 1}, volume={73}, DOI={10.12905/0380.sydowia73-2020-0089}, abstractNote={The phylogeny and taxonomy of several powdery mildews (Erysiphaceae) have been examined. Sequences of the rDNA ITS region retrieved from several collections of Erysiphe spp. belonging to the E. aquilegiae complex (cluster) and collected on new hosts are listed and discussed, including a critical assessment of the phylogenetic-taxonomic interpretation of this complex. Based on results of sequence analyses, E. tortilis proved to pertain to this complex as well. This species is epitypified, which is supplemented with an ex-epitype reference sequence. The phylogeny and taxonomy of the powdery mildew on Manihot esculenta (cassava, manioc), which is widespread and common wherever this tuber crop is cultivated, has been examined. Morphological re-examinations and phylogenetic analyses of collections from Argentina and Brazil revealed that this powdery mildew belongs to the genus Erysiphe, phylogenetically included in the E. trifoliorum complex. The new combination Erysiphe manihoticola is introduced for this powdery mildew. Based on the re-examination of type material, it has become clear that the name Oidium manihotis, which was used in the past for this powdery mildew, is not conspecific with E. manihoticola and most likely not congeneric with Erysiphe. On the basis of sequences retrieved from type material of Erysiphe baptisiae and a North American collection on Baptisia, we reveal that E. baptisiae has to be reduced to synonymy with E. guarinonii. Erysiphe euonymicola on Euonymus fortunei is recorded from North America for the first time. The identity of Golovinomyces on Cynara and Echinops in North America is discussed. Type material of Golovinomyces echinopis has been sequenced, and G. montagnei is epitypified with a collection from Germany, which is supplemented by ex-epitype sequence data. Based on morphological analyses and a comparison of sequence data with ex-holotype sequences, North American powdery mildew collections on Echinops could be confirmed to belong to G. echinopis. However, a North American powdery mildew collection on Cynara cardunculus turned out to be close to G. depressus and not, as expected, to G. montagnei. Golovinomyces verbenae, described from North America, is epitypified with ex-epitype sequence data, and G. glandulariae, recently described from Australia, is reduced to synonymy with G. verbenae. The phylogenetic positions of Podosphaera physocarpi and P. spiraeae-douglasii have been revealed on the basis of collections from North America and Germany (the first record for Germany and the second for Europe of P. physocarpi), including the first descriptions, pictures and illustrations of the asexual morphs for both of these species. Furthermore, Podosphaera prunicola is epitypified.}, journal={Sydowia}, author={Bradshaw, M. and Braun, U. and Götz, M. and Takamatsu, S. and Brand, T. and Cabrera, M.G. and Dirchwolf, P. and Kummer, V. and Medina, R. and Moparthi, S. and et al.}, year={2021}, pages={89–112} }
 @article{bradshaw_bartholomew_fonseca_gaskins_prusky_jurick_2021, title={Delivering the goods: Fungal secretion modulates virulence during host–pathogen interactions}, volume={36}, ISSN={1749-4613}, url={http://dx.doi.org/10.1016/j.fbr.2021.03.007}, DOI={10.1016/j.fbr.2021.03.007}, abstractNote={Fungi secrete a variety of compounds that have wide ranging effects on society and govern the outcome of host–pathogen interactions. The secreted products range from powerful toxins and carcinogens, to beneficial compounds such as ethanol used in common commercial practices, and the 'wonder drug' penicillin. Much research in the past 50 y has focused on identifying the genes and their functions relating to the fungal secretome. Recent advances into the mechanisms by which phytopathogenic fungal secretion systems function and modulate virulence have broad implications for the agricultural and biotechnological industries. In this review, we focus on secretion mechanisms in phytopathogenic fungi with examples from key plant–pathogen systems. Current progress and knowledge gaps regarding secretion pathways and their regulation are discussed. We highlight possible approaches to using novel molecular techniques to generate alternative control methods to synthetic pesticides.}, journal={Fungal Biology Reviews}, publisher={Elsevier BV}, author={Bradshaw, Michael J. and Bartholomew, Holly P. and Fonseca, Jorge M. and Gaskins, Verneta L. and Prusky, Dov and Jurick, Wayne M., II}, year={2021}, month={Jun}, pages={76–86} }
 @article{bradshaw_goolsby_mason_tobin_2021, title={Evolution of Disease Severity and Susceptibility in the Asteraceae to the Powdery Mildew <i>Golovinomyces latisporus</i>: Major Phylogenetic Structure Coupled With Highly Variable Disease Severity at Fine Scales}, volume={105}, ISSN={0191-2917 1943-7692}, url={http://dx.doi.org/10.1094/PDIS-06-20-1375-RE}, DOI={10.1094/PDIS-06-20-1375-RE}, abstractNote={ Pathogen host range and pathogen severity are dependent on interactions with their hosts and are hypothesized to have evolved as products of a coevolutionary arms race. An understanding of the factors that affect host range and pathogen severity is especially crucial in introduced pathogens that infect evolutionarily naïve hosts and cause substantial damage to ecosystems. Powdery mildews are detrimental pathogens found worldwide in managed and natural systems. Golovinomyces latisporus is a powdery mildew species that is especially damaging to plants within Asteraceae and to plants within the genus Helianthus in particular. In this study, we evaluated 126 species within Asteraceae to measure the role of host plant morphophysiological traits and evolutionary history on susceptibility to G. latisporus and disease severity. We observed phylogenetic signal in both susceptibility and severity within and among major clades of the Asteraceae. In general, there was a major phylogenetic structure of host severity to G. latisporus; however, there was some fine-scale phylogenetic variability. Phylogenetic statistical methods showed that chlorophyll content, biomass, stomatal index, and trichome density were not associated with disease severity, thus providing evidence that phylogenetic structure, rather than observed plant morphophysiological traits, is the most reliable predictor of pathogen severity. This work sheds light on the role that evolutionary history plays in plant susceptibility and severity to disease and underscores the relative unimportance of commonly assessed host plant traits in powdery mildew severity. }, number={2}, journal={Plant Disease}, publisher={Scientific Societies}, author={Bradshaw, Michael and Goolsby, Eric and Mason, Chase and Tobin, Patrick C.}, year={2021}, month={Feb}, pages={268–275} }
 @article{bradshaw_bartholomew_lichtner_gaskins_jurick_2022, title={First Report of Blue Mold Caused by <i>Penicillium polonicum</i>on Apple in the United States}, volume={106}, ISSN={0191-2917 1943-7692}, url={http://dx.doi.org/10.1094/pdis-06-21-1136-pdn}, DOI={10.1094/pdis-06-21-1136-pdn}, abstractNote={Apples (Malus domestica, Rosaceae) are one of the most widely grown and economically valuable fruits worldwide. In Hood River County, Oregon in 1991 decayed apples exhibiting blue mold signs and symptoms were collected and spores from the causal agent of the disease were isolated. The decayed area of the infected apples was brown colored with soft, decayed tissue, which had bluish-green colored spores on the fruit surface. The whole genome of this isolate was sequenced (GenBank number: JYNM00000000) and it was originally identified as Penicillium solitum strain RS1 (Yu et al. 2016). Subsequent genome-wide species-level investigations showed higher homology to P. polonicum. Therefore, we taxonomically and phylogenetically reevaluated the fungus in question. Colonies were analyzed growing on potato dextrose agar (PDA), Czapek yeast autolysate agar (CYA) and malt extract agar (MEA) at 25°C. Colonies on PDA were blue-green and growth was moderately deep and raised at the center with low margins. Colonies on CYA were blue-green. The range of the colony diameter after 7 days at 25ºC was 24-27 mm on CYA and 20-25 mm on MEA. Colony reverse color on CYA was yellow-brown and on MEA was cream. Conidiophores were terverticillate. Stipes were septate with smooth walls and measured 62-250 × 3-5 µm, x̄ = 111.1 × 3.8 µm with 1-4 branches per stipe. Branches measured 8-25 × 2-6 µm, x̄ = 4.9 × 16.3 µm with 2-4 metulae per branch. Metulae measured 7-14 × 2-5 µm, x̄ = 10.1 × 3.6 µm with 1-3 phialides per metulae. Phialides were flask shaped and measured 5-11 × 2-5 µm, x̄ = 7.5 × 3.4 µm. Conidia were globose to subglobose, borne in columns measuring 2.2-5.4 × 2.1-5.3 µm, x̄ = 3.6 × 3.4 µm. Morphologically, the fungal strain RS1 matched the description of Penicillium polonicum K. Zaleski from Bashir et al. (2017), Duduk et al. (2014) and Frisvad and Sampson (2004) with some minor differences. The ITS, TUB and RpB2 sequences of the strain RS1 were extracted from GenBank accession number JYNM00000000. The sequences were then submitted for nucleotide BLAST (NCBI) analysis in GenBank and evaluated. The ITS sequence aligned 100% with the type specimen (CBS 222.28) of P. polonicum (GenBank number: NR_103687). The TUB sequence aligned over 99% with P. polonicum (GenBank numbers: MK450898, MK450935, MK450899). The RpB2 sequences aligned 99.9% or higher with multiple P. polonicum specimens deposited in CBS and CMV (GenBank numbers: MK450847, MK450846, JN985414 and JN985415). Koch's postulates were conducted. Ten apples were wounded with the point of a 16-penny nail, and 10ul of a conidial suspension adjusted to 106 conidia-distilled water/tween solution was added to the wound. Ten separate apples served as a control that were wounded and 10ul of sterile Tween treated water was used to simulate inoculation. None of the control apples developed signs or symptoms of the disease. The inoculated apples all developed typical blue mold symptoms. The fungus was reisolated from the fruit and deemed to be morphologically identical to those of the original RS1, P. polonicum isolate. To the best of our knowledge this is the first report of blue mold caused by P. polonicum in the USA on apples (Farr and Rossman 2021). This information is important for the apple industry for which blue mold is a major problem.}, number={2}, journal={Plant Disease}, publisher={Scientific Societies}, author={Bradshaw, Michael J. and Bartholomew, Holly P. and Lichtner, Franz and Gaskins, Verneta L. and Jurick, Wayne M., II}, year={2022}, month={Feb}, pages={762} }
 @article{liu_jin_götz_bradshaw_liu_takamatsu_braun_2021, title={Phylogeny and taxonomy of <i>Podosphaera filipendulae</i> (<i>Erysiphaceae</i>) revisited}, volume={62}, ISSN={1340-3540 1618-2545}, url={http://dx.doi.org/10.47371/mycosci.2021.07.001}, DOI={10.47371/mycosci.2021.07.001}, abstractNote={The phylogeny and taxonomy of Podosphaera filipendulae (including P. filipendulensis, syn. nov.) have been examined. Asian, European and North American collections were examined and the nucleotides sequences of their partial rDNA region were determined. In particular, the relationship between P. filipendulae and P. spiraeae was analysed. The results confirmed P. filipendulae and P. spiraeae as two separate, morphologically similar species. The phylogenetic analysis revealed a similar phylogeny to that of the host genera. Although ITS sequences retrieved from Asian, European and North American specimens of P. filipendulae on various Filipendula spp. are identical to sequences from P. macularis on hop, there is consistently one base substitution at the 5'-end of 28S rRNA gene between the species. This result provides evidence that the hop powdery mildew and P. filipendulae are biologically and morphologically clearly distinguished, and should be maintained as two separate species.}, number={6}, journal={Mycoscience}, publisher={The Mycological Society of Japan}, author={Liu, Shu-Yan and Jin, Danni and Götz, Monika and Bradshaw, Michael and Liu, Miao and Takamatsu, Susumu and Braun, Uwe}, year={2021}, month={Nov}, pages={390–394} }
 @article{bradshaw_braun_meeboon_tobin_2021, title={Phylogeny and taxonomy of powdery mildew caused by <i>Erysiphe</i> species on <i>Corylus</i> hosts}, volume={113}, ISSN={0027-5514 1557-2536}, url={http://dx.doi.org/10.1080/00275514.2020.1837568}, DOI={10.1080/00275514.2020.1837568}, abstractNote={ABSTRACT Erysiphe species (powdery mildews) on Corylus and Ostrya hosts (Betulaceae subfam. Coryloideae) in Asia and North America are widespread pathogens on these economically and ecologically valuable nut crops. An improved understanding of their phylogeny and taxonomy is of ecological and applied importance. Phylogenetic analyses and morphological reexaminations conducted in this study revealed a higher degree of diversity and cryptic speciation than reflected in earlier species concepts. North American collections on C. cornuta, which were previously assigned to E. corylacearum, proved to constitute a species of its own and are herein introduced as E. cornutae, sp. nov. Two additional North American species, E. coryli-americanae, sp. nov. and E. ostryae, sp. nov., have been detected on C. americana and O. virginiana and are described. They are morphologically similar to E. cornutae, but genetically distinct. Based on phylogenetic analyses, E. corylacearum is an Asian species confined to various Asian Corylus species. Sequence data retrieved from Japanese type material of E. corylicola revealed that this species clusters with sequences from E. elevata on Catalpa species, distant from all other Erysiphe species on Corylus. Morphologically similar, yet distinct, specimens on C. sieboldiana, which were previously assigned to E. corylicola, form a distinct, distant clade. The species involved is described herein as E. pseudocorylacearum, sp. nov. Additionally, an unusual infection of C. sieboldiana in Japan by E. syringae has been shown by means of sequence data. The phylogeny and taxonomy of Erysiphe species belonging to the Corylioideae are discussed in detail, and a key to the species concerned is provided.}, number={2}, journal={Mycologia}, publisher={Informa UK Limited}, author={Bradshaw, Michael and Braun, Uwe and Meeboon, Jamjan and Tobin, Patrick}, year={2021}, month={Feb}, pages={459–475} }
 @article{bradshaw_braun_götz_jurick ιι_2021, title={Phylogeny and taxonomy of powdery mildew caused by <i>Erysiphe</i> species on <i>Lupinus</i> hosts}, volume={114}, ISSN={0027-5514 1557-2536}, url={http://dx.doi.org/10.1080/00275514.2021.1973287}, DOI={10.1080/00275514.2021.1973287}, abstractNote={ABSTRACT The genus Lupinus (Fabaceae) consists of over 250 plant species located throughout the world. Powdery mildew, caused by Erysiphe species, is a common disease infecting these ecologically, ornamentally, and agriculturally important plants. In the present work, we conducted phylogenetic and taxonomic analyses on Erysiphe species colonizing hosts of the leguminous genus Lupinus, using sequences from the internal transcribed spacer (ITS) and 28S genomic regions. Powdery mildews of the genus Erysiphe on Fabaceae are taxonomically intricate and challenging. Therefore, it is necessary to phylogenetically analyze the DNA retrieved from powdery mildew on lupines in a broad context that includes common and allied powdery mildew species that occur on a range of leguminous plants such as Erysiphe astragali, E. baeumleri, E. pisi, and E. trifoliorum. A new species Erysiphe lupini, found in the USA on Lupinus lepidus, L. polyphyllus, and Lupinus sp., is described. Additionally, Erysiphe intermedia (≡ Microsphaera trifolii var. intermedia) has been confirmed as a North American lupine powdery mildew that is a sister species to E. astragali on Astragalus spp. European Erysiphe collections on lupines were often referred to as E. intermedia, but our analyses have shown that they pertain to E. trifoliorum. The E. trifoliorum clade is composed of several species (i.e. E. baeumleri, E. euonymi, E. hyperici, and E. trifoliorum), that cannot be sufficiently resolved based solely on ITS+28S sequences. Morphological and biological differences between the species are discussed and provide evidence that the species concerned should be maintained. Finally, a sequence obtained from a powdery mildew collected in Portugal on the native Lupinus micranthus pertained to the Erysiphe guarinonii clade. This collection is tentatively treated as Erysiphe sp. To fix the application of the species names E. astragali, E. baeumleri (including its synonym E. marchica), and E. intermedia, epitypes have been designated with ex-epitype sequences.}, number={1}, journal={Mycologia}, publisher={Informa UK Limited}, author={Bradshaw, Michael and Braun, Uwe and Götz, Monika and Jurick ΙΙ, Wayne}, year={2021}, month={Dec}, pages={76–88} }
 @article{darsaraei_khodaparast_takamatsu_abbasi_asgari_sajedi_götz_liu_feng_bradshaw_et al._2021, title={Phylogeny and taxonomy of the Erysiphe adunca complex (Erysiphaceae, Helotiales) on poplars and willows}, volume={20}, ISSN={1617-416X 1861-8952}, url={http://dx.doi.org/10.1007/s11557-021-01688-7}, DOI={10.1007/s11557-021-01688-7}, number={4}, journal={Mycological Progress}, publisher={Springer Science and Business Media LLC}, author={Darsaraei, Hamideh and Khodaparast, Seyed Akbar and Takamatsu, Susumu and Abbasi, Mehrdad and Asgari, Bita and Sajedi, Sepideh and Götz, Monika and Liu, Shu-Yan and Feng, Jing and Bradshaw, Michael and et al.}, year={2021}, month={Apr}, pages={517–537} }
 @article{moparthi_bradshaw_2021, title={Powdery mildew epidemics in the nursery: role of chasmothecia in epidemic initiation and fungicide regimes to limit chasmothecia formation}, volume={20}, ISSN={1617-416X 1861-8952}, url={http://dx.doi.org/10.1007/s11557-021-01678-9}, DOI={10.1007/s11557-021-01678-9}, number={5}, journal={Mycological Progress}, publisher={Springer Science and Business Media LLC}, author={Moparthi, Swarnalatha and Bradshaw, Michael}, year={2021}, month={Mar}, pages={641–646} }
 @article{bartholomew_bradshaw_jurick_fonseca_2021, title={The Good, the Bad, and the Ugly: Mycotoxin Production During Postharvest Decay and Their Influence on Tritrophic Host–Pathogen–Microbe Interactions}, volume={12}, ISSN={1664-302X}, url={http://dx.doi.org/10.3389/fmicb.2021.611881}, DOI={10.3389/fmicb.2021.611881}, abstractNote={Mycotoxins are a prevalent problem for stored fruits, grains, and vegetables. Alternariol, aflatoxin, and patulin, produced by Alternaria spp., Aspergillus spp., and Penicillium spp., are the major mycotoxins that negatively affect human and animal health and reduce fruit and produce quality. Control strategies for these toxins are varied, but one method that is increasing in interest is through host microbiome manipulation, mirroring a biocontrol approach. While the majority of mycotoxins and other secondary metabolites (SM) produced by fungi impact host–fungal interactions, there is also an interplay between the various organisms within the host microbiome. In addition to SMs, these interactions involve compounds such as signaling molecules, plant defense and growth hormones, and metabolites produced by both the plants and microbial community. Therefore, studies to understand the impact of the various toxins impacting the beneficial and harmful microorganisms that reside within the microbiome is warranted, and could lead to identification of safe analogs for antimicrobial activity to reduce fruit decay. Additionally, exploring the composition of the microbial carposphere of host plants is likely to shed light on developing a microbial consortium to maintain quality during storage and abate mycotoxin contamination.}, journal={Frontiers in Microbiology}, publisher={Frontiers Media SA}, author={Bartholomew, Holly P. and Bradshaw, Michael and Jurick, Wayne M., II and Fonseca, Jorge M.}, year={2021}, month={Feb} }
 @article{de luccia_peterson_bradshaw_tobin_2020, title={Effectiveness of herbicides on <i>Lysimachia vulgaris</i>: a 17-year case study}, volume={13}, ISSN={1939-7291 1939-747X}, url={http://dx.doi.org/10.1017/inp.2020.26}, DOI={10.1017/inp.2020.26}, abstractNote={AbstractGarden loosestrife (Lysimachia vulgaris L.), is an invasive wetland plant that is subject to management in King County, WA, USA. Large-scale management efforts are generally conducted using herbicides. In this case study, we analyzed 17 yr of monitoring and treatment data in four riparian areas in King County to estimate the rate of spread of L. vulgaris and the efficacy of herbicidal treatments against L. vulgaris populations. In each area, herbicide treatments were applied annually. In three of the areas, the area infested with L. vulgaris did not change over time, while in the fourth area populations of L. vulgaris were spreading at a rate of 0.79 m2 yr−1. There were a greater number of sampled locations infested with L. vulgaris over the 17-yr period, and because populations were either not spreading or spreading slowly, it is possible that populations were becoming more fragmented. There was no relationship between the percentage of the infested area treated with herbicides and the area infested in the following year. However, there was a negative relationship between the area treated and the percent change in the invaded area; specifically, in years when <80% of the infested area was treated, there was an increase in the percent change of the invaded area between the year of treatment and the following year. The results of this study suggest that at the current level of management effort, the spatial extent of L. vulgaris did not retract over the 17-yr study period.}, number={4}, journal={Invasive Plant Science and Management}, publisher={Cambridge University Press (CUP)}, author={De Luccia, Marisa R. and Peterson, Ben and Bradshaw, Michael J. and Tobin, Patrick C.}, year={2020}, month={Oct}, pages={282–287} }
 @article{bradshaw_pane_2020, title={Field inoculations of nitrogen fixing endophytes on turfgrass}, volume={112}, ISSN={0885-5765}, url={http://dx.doi.org/10.1016/j.pmpp.2020.101557}, DOI={10.1016/j.pmpp.2020.101557}, abstractNote={Turfgrass is the number one irrigated crop in the United States. Lawn care regimes require high chemical fertilizer and water inputs. Endophytes, defined as microorganisms that live within plants, have the potential to decrease the high water and high fertilizer requirements of turfgrass. This study evaluated the inoculation of multiple mutualistic endophytes on a commonly planted turfgrass mix in field trials. Previous studies, in greenhouse and lab settings, found these same endophytes increase drought tolerance and grass greenness. Nine 3 ft by 3 ft turfgrass plots were inoculated with an endophyte consortium in the spring and fall of 2017. Inoculated plots were compared with non-inoculated controls for overall chlorophyll content, overall plot greenness, and mean total height accumulation. The results of the study indicated that there was no significant effect of endophyte inoculations on the turfgrass. Additionally, endophytes were extracted, cultured and sequenced from the plots two months post inoculation. The endophytes applied were not detected, indicating that they were unable to survive the entire growing season within the turfgrass. The current research will be one of the first studies to show that endophytes, inoculated onto a novel host, were unable to survive field conditions in a perennial crop and yield the benefits that were observed in vitro and in greenhouse trials. Future research should evaluate the success of these endophytes on other plant species in the field and in non-limiting environments and run a quantitative PCR experiment using isolate specific primers to determine endophyte survival over time in the field.}, journal={Physiological and Molecular Plant Pathology}, publisher={Elsevier BV}, author={Bradshaw, Michael J. and Pane, Alexander M.}, year={2020}, month={Dec}, pages={101557} }
 @article{moparthi_bradshaw_2020, title={Fungicide efficacy trials for the control of powdery mildew (<i>Podosphaera cerasi</i>) on sweet cherry trees (<i>Prunus avium</i>)}, volume={30}, ISSN={0958-3157 1360-0478}, url={http://dx.doi.org/10.1080/09583157.2020.1755616}, DOI={10.1080/09583157.2020.1755616}, abstractNote={ABSTRACT Powdery mildew is a detrimental foliar disease of sweet cherry trees. The disease is predominantly managed by spraying synthetic fungicides throughout the growing season. The emergence of resistant powdery mildew populations, to some commonly used synthetic fungicides, highlights the need for research into alternative control methods. Between 2012 and 2015, the efficacy of two different biofungicides (Bacillus subtilis and Bacillus pumilus) and electrolysed oxidised (EO) water were evaluated to determine if they could be a viable replacement for four commonly used synthetic fungicides (fluopyram/trifloxystrobin, triflumizole, quinoxyfen and myclobutanil) in a greenhouse, nursery and commercial orchard. Electrolysed oxidised water and fluopyram/trifloxystrobin significantly lowered disease severity and incidence in all of the locations tested, however, biweekly applications of EO water had little effect on the fungus and weekly applications were phytotoxic in the nursery and greenhouse. Before EO water is implemented into integrated pest management programmes, the optimal spray frequency needs to be evaluated to eliminate its phytotoxic effects. The biofungicides evaluated in this study had minimal effects on powdery mildew severity and incidence and should not be recommended for control on sweet cherry trees. Currently, synthetic fungicides are the best method for the control of powdery mildew as fluopyram/trifloxystrobin was the only fungicide that was successful in lowering disease incidence and severity over the duration of the powdery mildew epidemic in both the nursery and greenhouse. Future research should evaluate integrated pest management strategies, including additional biofungicides, that could supplement and reduce synthetic fungicide applications.}, number={7}, journal={Biocontrol Science and Technology}, publisher={Informa UK Limited}, author={Moparthi, Swarnalatha and Bradshaw, Michael}, year={2020}, month={Apr}, pages={659–670} }
 @article{qiu_liu_bradshaw_rooney-latham_takamatsu_bulgakov_tang_feng_jin_aroge_et al._2020, title={Multi-locus phylogeny and taxonomy of an unresolved, heterogeneous species complex within the genus Golovinomyces (Ascomycota, Erysiphales), including G. ambrosiae, G. circumfusus and G. spadiceus}, volume={20}, ISSN={1471-2180}, url={http://dx.doi.org/10.1186/s12866-020-01731-9}, DOI={10.1186/s12866-020-01731-9}, abstractNote={Abstract
                Background
                Previous phylogenetic analyses of species within the genus Golovinomyces (Ascomycota, Erysiphales), based on ITS and 28S rDNA sequence data, revealed a co-evolutionary relationship between powdery mildew species and hosts of certain tribes of the plant family Asteraceae. Golovinomyces growing on host plants belonging to the Heliantheae formed a single lineage, comprised of a morphologically differentiated complex of species, which included G. ambrosiae, G. circumfusus, and G. spadiceus. However, the lineage also encompassed sequences retrieved from Golovinomyces specimens on other Asteraceae tribes as well as other plant families, suggesting the involvement of a plurivorous species. A multilocus phylogenetic examination of this complex, using ITS, 28S, IGS (intergenic spacer), TUB2 (beta-tubulin), and CHS1 (chitin synthase I) sequence data was carried out to clarify the discrepancies between ITS and 28S rDNA sequence data and morphological differences. Furthermore, the circumscription of species and their host ranges were emended.
              
                Results
                The phylogenetic and morphological analyses conducted in this study revealed three distinct species named, viz., (1) G. ambrosiae emend. (including G. spadiceus), a plurivorous species that occurs on a multitude of hosts including, Ambrosia spp., multiple species of the Heliantheae and plant species of other tribes of Asteraceae including the Asian species of Eupatorium; (2) G. latisporus comb. nov. (≡ Oidium latisporum), the closely related, but morphologically distinct species confined to hosts of the Heliantheae genera Helianthus, Zinnia, and most likely Rudbeckia; and (3) G. circumfusus confined to Eupatorium cannabinum in Europe.
              
                Conclusions
                The present results provide strong evidence that the combination of multi-locus phylogeny and morphological analysis is an effective way to identify species in the genus Golovinomyces.
              }, number={1}, journal={BMC Microbiology}, publisher={Springer Science and Business Media LLC}, author={Qiu, Peng-Lei and Liu, Shu-Yan and Bradshaw, Michael and Rooney-Latham, Suzanne and Takamatsu, Susumu and Bulgakov, Timur S. and Tang, Shu-Rong and Feng, Jing and Jin, Dan-Ni and Aroge, Temitope and et al.}, year={2020}, month={Mar} }
 @article{bradshaw_braun_wang_liu_feng_shin_choi_takamatsu_bulgakov_tobin_2020, title={Phylogeny and taxonomy of powdery mildew on <i>Viburnum</i> species}, volume={112}, ISSN={0027-5514 1557-2536}, url={http://dx.doi.org/10.1080/00275514.2020.1739508}, DOI={10.1080/00275514.2020.1739508}, abstractNote={ABSTRACT The phylogeny and taxonomy of powdery mildew on Viburnum species is evaluated and discussed. Morphological and phylogenetic analyses revealed two new species and demonstrated that Erysiphe hedwigii and E. viburni should be reduced to synonymy and are referred to herein as E. viburni. The two new species, E. viburniphila and E. pseudoviburni, previously hidden under E. viburni (including E. hedwigii), is described on the basis of European, North American, and East Asian powdery mildew collections on Viburnum edule, V. tinus, V. odoratissimum var. awabuki, and V. sieboldii. The sexual morph of E. viburniphila is similar to that of E. viburni; however, morphological differences exist in their asexual morphs. Analyses of sequences from the internal transcribed spacer (ITS) and 28S genomic regions of Erysiphe species obtained on Viburnum species (and other closely allied Eryisphe species) throughout the world reveled that E. viburniphila and E. pseudoviburni are in two different monophyletic groups that are separate from all other Erysiphe species. Erysiphe hedwigii and E. viburni on Viburnum species have often been recognized as separate species based on morphological differences in the size of their chasmothecia and the number of chasmothecial appendages. Taxonomic conclusions based on these morphological distinctions within these species are unreliable (these characters are rather variable and often have overlapping ranges). The present phylogenetic analyses suggest that E. hedwigii has to be reduced to synonymy with E. viburni. To fix the application of the species names E. hedwigii and E. viburni, epitypes have been designated for these taxa with ex-epitype sequences. Additionally, the Asian species E. miranda is phylogenetically confirmed as a species of its own, described in detail and discussed.}, number={3}, journal={Mycologia}, publisher={Informa UK Limited}, author={Bradshaw, Michael and Braun, Uwe and Wang, Serena and Liu, Shuyan and Feng, Jing and Shin, Hyeon-Dong and Choi, Young-Joon and Takamatsu, Susumu and Bulgakov, Timur S. and Tobin, Patrick C.}, year={2020}, month={May}, pages={616–632} }
 @article{bradshaw_tobin_2020, title={Sequencing Herbarium Specimens of a Common Detrimental Plant Disease (Powdery Mildew)}, volume={110}, ISSN={0031-949X 1943-7684}, url={http://dx.doi.org/10.1094/PHYTO-04-20-0139-PER}, DOI={10.1094/PHYTO-04-20-0139-PER}, abstractNote={ Powdery mildew (Erysiphaceae) is a detrimental plant disease that occurs on a variety of economically important crops. Powdery mildew consists of over 873 species of fungal pathogens that affect over 10,000 plant species. Genetic identification of powdery mildew is accomplished using the internal transcribed spacer (ITS) and large subunit (LSU) regions of the nuclear ribosomal RNA gene cluster. The ITS and LSU regions of powdery mildews can be useful in ecological, epidemiological, phylogenetic, and taxonomic investigations. However, sequencing these regions is not without its challenges. For example, powdery mildew sequences are often contaminated with plant and/or fungal DNA. Also, there tends to be a limited amount and older specimens’ DNA can fragment over time. The success of sequencing powdery mildew often depends on the primers used for running polymerase chain reaction (PCR). The primers need to be broad enough that they match the majority of powdery mildew DNA yet specific enough that they do not align with other organisms. A review of the taxonomy and phylogeny of the powdery mildews is presented with an emphasis on sequencing the ITS + LSU genomic regions. Additionally, we introduce a new nested primer protocol for sequencing powdery mildew herbarium samples that includes six new powdery mildew-specific primers. The new sequencing protocol presented allows specimens up to 130 years old to be sequenced consistently. Sequencing herbarium specimens can be extremely useful for addressing many ecological, epidemiological, phylogenetic, and taxonomic problems in multiple plant pathogenic systems including the powdery mildews. }, number={7}, journal={Phytopathology®}, publisher={Scientific Societies}, author={Bradshaw, Michael and Tobin, Patrick C.}, year={2020}, month={Jul}, pages={1248–1254} }
 @article{bradshaw_braun_götz_takamatsu_2021, title={Taxonomy and phylogeny of the <i>Erysiphe lonicerae</i> complex (<i>Helotiales</i>, <i>Erysiphaceae</i>) on <i>Lonicera</i> spp.}, volume={7}, ISSN={2589-3823}, url={http://dx.doi.org/10.3114/fuse.2021.07.03}, DOI={10.3114/fuse.2021.07.03}, abstractNote={The phylogeny and taxonomy of powdery mildews, belonging to the genus Erysiphe, on Lonicera species throughout the world are examined and discussed. Phylogenetic analyses revealed that sequences retrieved from Erysiphe lonicerae, a widespread powdery mildew species
 distributed in the Northern Hemisphere on a wide range of Lonicera  spp., constitutes a complex of two separate species, viz., E. lonicerae (s. str.) and Erysiphe ehrenbergii comb. nov. Erysiphe lonicerae occurs on Lonicera  spp. belonging to
 Lonicera  subgen. Lonicera (= subgen. Caprifolium and subgen. Periclymenum ), as well as L. japonica. Erysiphe ehrenbergii comb. nov. occurs on Lonicera spp. of Lonicera  subgen. Chamaecerasus. Phylogenetic and morphological analyses
 have also revealed that Microsphaera caprifoliacearum  (≡ Erysiphe caprifoliacearum) should be reduced to synonymy with E. lonicerae  (s. str.). Additionally, Erysiphe lonicerina sp. nov. on Lonicera japonica in Japan is described and the new
 name Erysiphe flexibilis, based on Microsphaera lonicerae  var. flexuosa, is introduced. The phylogeny of Erysiphe ehrenbergii  and E. lonicerae as well as other Erysiphe species on honeysuckle is discussed, and a survey of all species, including a
 key to the species concerned, is provided.}, number={1}, journal={Fungal Systematics and Evolution}, publisher={Westerdijk Fungal Biodiversity Institute}, author={Bradshaw, M. and Braun, U. and Götz, M. and Takamatsu, S.}, year={2021}, month={Jun}, pages={49–65} }
 @article{moparthi_grove_pandey_bradshaw_latham_braun_meeboon_romberg_2019, title={Phylogeny and taxonomy of <i>Podosphaera cerasi</i>, sp. nov., and <i>Podosphaera prunicola</i> sensu lato}, volume={111}, ISSN={0027-5514 1557-2536}, url={http://dx.doi.org/10.1080/00275514.2019.1611316}, DOI={10.1080/00275514.2019.1611316}, abstractNote={ABSTRACT Powdery mildew of Prunus spp. is a significant disease in most cherry growing regions of Washington, USA. Powdery mildews on Prunus virginiana and Pr. avium were previously assigned to Podosphaera clandestina s. lat. (= Po. oxyacanthae) or Po. prunicola. In this report, we confirm the presence of two distinct Podosphaera species on these hosts. Phylogenetic analyses of nuc rDNA sequences from the internal transcribed spacer region (ITS1-5.8S-ITS2 = ITS) and 28S subunit confirmed the presence of two distinct species. A morphological comparison with type material of Po. prunicola and additional collections demonstrated that the powdery mildew on Pr. virginiana (including var. demissa and var. melanocarpa) is in fact Po. prunicola. The powdery mildew on Pr. avium is genetically, morphologically, and biologically distinct from Po. prunicola and is described here as the new species Po. cerasi. Cross-inoculation experiments confirmed that these two species are host specific. Podosphaera prunicola was unable to colonize Pr. avium, whereas Po. cerasi was unable to colonize Pr. virginiana. Morphological reexamination of numerous specimens identified as Po. prunicola on a broad range of Prunus species suggests that Po. prunicola is probably confined to species in Prunus subgen.Padus (= Prunus subgen. Cerasus sect. Laurocerasus, including sect. Padus), with Pr. virginiana as the principal host. Podosphaera cerasi occurs on hosts in Prunus subgen. Cerasus, and our work confirms a newly described species of powdery mildew on Pr. avium. This work also includes the first documented and genetically proven European record of Po. prunicola on Pr. serotina and its widespread occurrence in the United States.}, number={4}, journal={Mycologia}, publisher={Informa UK Limited}, author={Moparthi, Swarnalatha and Grove, Gary G. and Pandey, Binod and Bradshaw, Michael and Latham, Suzanne Rooney and Braun, Uwe and Meeboon, Jamjan and Romberg, Megan}, year={2019}, month={Jun}, pages={647–659} }
 @article{bradshaw_2018, title={First Report of Powdery Mildew Caused by <i>Erysiphe aquilegiae</i> on Columbine in the United States}, volume={19}, ISSN={1535-1025}, url={http://dx.doi.org/10.1094/PHP-11-17-0069-BR}, DOI={10.1094/PHP-11-17-0069-BR}, abstractNote={ Columbine (Aquilegia sp., Ranunculaceae) is a late summer to fall flowering ornamental. Powdery mildew was collected from columbine plants growing outdoors in the botanical garden at the Center for Urban Horticulture, University of Washington (47.65°N; 122.29°W) in October 2016. Morphological characteristics of the fungus were consistent with those of Erysiphe aquilegiae. To confirm species identification, the internal transcribed (ITS) region of rDNA was amplified with the primers ITS4/ITS6. E. aquilegiae (LC009944) was the most similar species with eight nucleotide differences (98.6% similarity). Based on morphological and molecular characteristics, it was concluded that the powdery mildew fungus was E. aquilegiae. To the author’s knowledge, this is the first unequivocal report of E. aquilegiae occurring within the United States. These results are important for the U.S. floral industry, for which Aquilegia is a major crop. }, number={1}, journal={Plant Health Progress}, publisher={Scientific Societies}, author={Bradshaw, Michael}, year={2018}, month={Jan}, pages={69–70} }
 @article{moparthi_bradshaw_grove_2018, title={First Report of Powdery Mildew on <i>Verbascum thapsus</i> Caused by <i>Golovinomyces verbasci</i> in the United States}, volume={102}, ISSN={0191-2917 1943-7692}, url={http://dx.doi.org/10.1094/PDIS-09-17-1453-PDN}, DOI={10.1094/PDIS-09-17-1453-PDN}, abstractNote={HomePlant DiseaseVol. 102, No. 6First Report of Powdery Mildew on Verbascum thapsus Caused by Golovinomyces verbasci in the United States PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Powdery Mildew on Verbascum thapsus Caused by Golovinomyces verbasci in the United StatesS. Moparthi, M. Bradshaw, and G. GroveS. Moparthi†Corresponding author: S. Moparthi; E-mail: E-mail Address: [email protected]Search for more papers by this author, M. BradshawSearch for more papers by this author, and G. GroveSearch for more papers by this authorAffiliationsAuthors and Affiliations S. Moparthi † , Washington State University, Prosser, 99350 M. Bradshaw , University of Washington, Seattle, 98125 G. Grove , Washington State University, Prosser, 99350. Published Online:27 Mar 2018https://doi.org/10.1094/PDIS-09-17-1453-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Great mullein (Verbascum thapsus) is a biennial forb belonging to the family Scrophulariaceae. In Europe it is primarily cultivated as a medicinal herb. This plant is an invasive species across the United States that can grow more than 6 ft tall. The leaves are thick, leathery, and densely covered with hairs. In the fall of 2017, great mullein plants grown at the Pierce County Master Garden located at WSU Puyallup Research and Extension Center (47.2258°N, 122.4347°W) showed signs and symptoms of powdery mildew. The adaxial leaf surfaces were covered with white mycelia and conidia, whereas the abaxial surfaces were less infected. The hyphal appressoria were nipple shaped, and the foot cells of the conidiophores measured 216 × 12 μm. Conidia were borne in chains with as many as five conidia per chain. They were hyaline, elliptical, and had no fibrosin bodies. They (n = 52) ranged from 29 to 42 μm long (average = 38 μm) and 16 to 27 μm wide (average = 21 μm). Chasmothecia were not observed. These features were consistent with those of Golovinomyces verbasci as described in Braun and Cook (2012). To confirm the identification, the complete internal transcribed spacer (ITS) region and the 5′ end of the large subunit rDNA containing D1, D2, and D3 were amplified using the primers ITS1-F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and TW14 (GCTATCCTGAGGGAAACTTC) (Hamby et al. 1988) and deposited into GenBank (accession no. MF 972905). The 684-bp amplicon had 99% homology with two sequences of G. verbasci (accession nos. AB 769469.1 and AB769468) from Lithuania and Japan. Pathogenicity was confirmed through inoculation by gently pressing diseased leaves onto leaves of healthy V. thapsus plants. Five leaves per plant (three plants and a total of 15 leaves) were inoculated. The same number of leaves, maintained at room temperature, were used as a control without inoculation. Fifteen days after inoculation, symptoms and signs of powdery mildew developed on inoculated leaves. No symptoms developed on the leaves used as a control. The conidial morphology of the fungus that developed on inoculated plants was identical to the original fungus. To our knowledge, this is the first unequivocal report of G. verbasci on any host, including V. thapsus, in the United States (Farr and Rossman 2016). In many states great mullein is considered a noxious weed, making this information important for the U.S. Department of Ecology and the U.S. agriculture industry. It is also important for the horticulture industry, where this plant is grown and sold across the United States.References:Braun, U., and Cook, R. T. A. 2012. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series 11. CBS, Utrecht, the Netherlands. Google ScholarFarr, D. F., and Rossman, A. Y. 2016. Fungal Databases, Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved January 13, 2016, from https://nt.ars-grin.gov/fungaldatabases/ Google ScholarGardes, M., and Bruns, T. D. 1993. Mol. Ecol. 2:113. https://doi.org/10.1111/j.1365-294X.1993.tb00005.x Crossref, ISI, Google ScholarHamby, R., et al. 1988. Plant Mol. Biol. Report. 6:175. Crossref, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 102, No. 6 June 2018SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 25 May 2018Published: 27 Mar 2018First Look: 1 Jan 2018Accepted: 28 Dec 2017 Pages: 1177-1177 Information© 2018 The American Phytopathological SocietyCited bySequencing Herbarium Specimens of a Common Detrimental Plant Disease (Powdery Mildew)Michael Bradshaw and Patrick C. Tobin3 June 2020 | Phytopathology®, Vol. 110, No. 7}, number={6}, journal={Plant Disease}, publisher={Scientific Societies}, author={Moparthi, S. and Bradshaw, M. and Grove, G.}, year={2018}, month={Jun}, pages={1177–1177} }
 @article{braun_bradshaw_zhao_cho_shin_2018, title={Taxonomy of the <i>Golovinomyces cynoglossi</i> Complex (<i>Erysiphales, Ascomycota</i>) Disentangled by Phylogenetic Analyses and Reassessments of Morphological Traits}, volume={46}, ISSN={1229-8093 2092-9323}, url={http://dx.doi.org/10.1080/12298093.2018.1509512}, DOI={10.1080/12298093.2018.1509512}, abstractNote={Abstract The name Golovinomyces cynoglossi s. lat. is traditionally applied to a complex of morphologically similar powdery mildews on hosts of the plant family Boraginaceae. The current species-level taxonomy within this complex is ambiguous due to the lack of phylogenetic examinations. The present study applied phylogenetic methods to clarify the taxonomy of G. cynoglossi s. lat. Phylogenetic analysis of rDNA ITS sequences retrieved from Asian, European and North American specimens revealed that G. cynoglossi s. lat. collections from different hosts involved several species in five clearly separated lineages. Clade I consists primarily of Golovinomyces cynoglossi s. str. on Cynoglossum. Clade III consists of Golovinomyces sequences retrieved from the host genera Symphytum and Pulmonaria. The taxa within clade III are now assigned to G. asperifoliorum comb. nov. Clade V encompasses G. cynoglossi s. lat. on the host genera Bothriospermum, Buglossoides, Echium, Myosotis, and Trigonotis. The taxa within clade V are now assigned to G. asperifolii comb. nov. The species concerned in this study were lecto- and epitypified to stabilize their nomenclature.}, number={3}, journal={Mycobiology}, publisher={Informa UK Limited}, author={Braun, Uwe and Bradshaw, Michael and Zhao, Ting-Ting and Cho, Sung-Eun and Shin, Hyeon-Dong}, year={2018}, month={Jul}, pages={192–204} }
 @article{bradshaw_2017, title={Controlling powdery mildew: researchers look at four common compounds used in commercial organic fungicides for the control of powdery mildew}, url={http://www.diggermagazine.com/controlling-powdery-mildew/}, journal={Digger Magazine}, author={Bradshaw, M.}, year={2017}, month={Aug} }
 @article{moparthi_bradshaw_grove_2018, title={First Report of Powdery Mildew Caused by Golovinomyces spadiceus on Helianthus annuus}, volume={102}, ISSN={0191-2917 1943-7692}, url={http://dx.doi.org/10.1094/PDIS-09-17-1434-PDN}, DOI={10.1094/PDIS-09-17-1434-PDN}, abstractNote={Helianthus annuus is a perennial plant native to the USA. Commonly known as a sunflower, H. annuus is grown ornamentally as well as for its oil and seeds. It can grow up to 8 feet in height. In August 2017, Helianthus annus ‘Lemon Queen’ leaves showing signs of powdery mildew were collected from the Pierce County master garden located at WSU Puyallup Research and Extension Center (47.2258oN, 122.4347oW). Signs of the powdery mildew included dense patches of white to greyish mycelia on the leaf surfaces. The fungus formed superficial branched hyphae with septa. The foot cells were straight and were followed by one to three short cells bearing conidia. The conidiophores contained short chains of up to 5 conidia. The hyphal appressoria were nipple shaped. The conidia were hyaline and ellipsoidal. Eudoidium type of conidial germination with a short germ tube developed. The conidia (N=55) ranged from 29 to 39 μm long (average=36 μm) by 16 to 24 μm wide (average=18.61 μm). Chasmothecia showed myceloid appendage...}, number={6}, journal={Plant Disease}, publisher={Scientific Societies}, author={Moparthi, S. and Bradshaw, M. J. and Grove, G. G.}, year={2018}, month={Jun}, pages={1176} }
 @article{moparthi_grove_bradshaw_2018, title={First Report of Powdery Mildew on <i>Spiraea japonica</i> Caused by <i>Podosphaera spiraeae</i> in the United States}, volume={102}, ISSN={0191-2917 1943-7692}, url={http://dx.doi.org/10.1094/PDIS-09-17-1419-PDN}, DOI={10.1094/PDIS-09-17-1419-PDN}, abstractNote={Spiraea japonica is a perennial ornamental plant that belongs to the family Rosaceae. It is grown as an ornamental plant throughout the USA. In the summer of 2017, Japanese Spiraea plants growing at Washington State University Puyallup Research and Extension Center (47.1882oN, 122.3290oW) showed signs of powdery mildew. Signs of powdery mildew include dense patches of white to greyish mycelia on leaf surfaces. The fungus formed superficial branched hyphae with septa. The foot cells of the conidiophore were straight followed by one to three short cells bearing conidia in short chains. The size of the foot cell ranged from 55 to 105 μm with an average of 93.76 μm (n=30). Appressorium was nipple shaped and the germ tubes of the conidia were terminal. Conidia were formed in chains of up to 5-7 hyaline, broad ellipsoidal spores which measured 25 × 15 (21 to 28 × 12 to 19) μm. Chasmothecia did not form during the time of observation (July- October of 2017). These features were consistent with the description of...}, number={3}, journal={Plant Disease}, publisher={Scientific Societies}, author={Moparthi, S. and Grove, G. G. and Bradshaw, M.}, year={2018}, month={Mar}, pages={682} }
 @article{bradshaw_braun_götz_meeboon_takamatsu_2017, title={Powdery mildew of <i>Chrysanthemum</i> × <i>morifolium</i>: phylogeny and taxonomy in the context of <i>Golovinomyces</i> species on <i>Asteraceae</i> hosts}, volume={109}, ISSN={0027-5514 1557-2536}, url={http://dx.doi.org/10.1080/00275514.2017.1358136}, DOI={10.1080/00275514.2017.1358136}, abstractNote={ABSTRACT The taxonomic history of the common powdery mildew of Chrysanthemum × morifolium (chrysanthemum, florist’s daisy), originally described in Germany as Oidium chrysanthemi, is discussed. The position of O. chrysanthemi was investigated on the basis of morphological traits and molecular phylogenetic analyses. Based on the results of this study, this species, which is closely related to Golovinomyces artemisae, was reassessed and reallocated to Golovinomyces. The phylogenetic analysis and taxonomic reassessment of the chrysanthemum powdery mildew is supplemented by a morphological description, a summary of its worldwide distribution data, and a brief discussion of the introduction of this fungus to North America. G. chrysanthemi differs from true G. artemisiae in that it has much longer conidiophores, is not constricted at the base, and has much larger and most importantly longer conidia. The close affinity of Golovinomyces to Artemisia and Chrysanthemum species signifies a coevolutionary event between the powdery mildews concerned and their host species in the subtribe Artemisiinae (Asteraceae tribe Anthemideae). This conclusion is fully supported by the current phylogeny and taxonomy of the host plant genera and the coevolution that occurred with the host and pathogen. The following powdery mildew species, which are associated with hosts belonging to the tribe Anthemideae of the Asteraceae, are epitypified: Alphitomorpha depressa β artemisiae (≡ Alphitomorpha artemisiae), Erysiphe artemisiae, and Oidium chrysanthemi. Erysiphe macrocarpa is neotypified. Their sequences were retrieved from the epitype collections and have been added to the phylogenetic tree. Golovinomyces orontii, an additional powdery mildew species on Chrysanthemum ×morifolium, is reported. This species is rarely found as a spontaneous infection and was obtained from inoculation experiments.}, number={3}, journal={Mycologia}, publisher={Informa UK Limited}, author={Bradshaw, Michael and Braun, Uwe and Götz, Monika and Meeboon, Jamjan and Takamatsu, Susumu}, year={2017}, month={May}, pages={508–519} }
 @article{bradshaw_elliott_reichard_2016, title={First Report of Powdery Mildew Caused by <i>Euoidium chrysanthemi</i> on <i>Chrysanthemum</i> × <i>morifolium</i> in the United States}, volume={100}, ISSN={0191-2917 1943-7692}, url={http://dx.doi.org/10.1094/PDIS-04-16-0452-PDN}, DOI={10.1094/PDIS-04-16-0452-PDN}, abstractNote={HomePlant DiseaseVol. 100, No. 11First Report of Powdery Mildew Caused by Euoidium chrysanthemi on Chrysanthemum × morifolium in the United States PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Powdery Mildew Caused by Euoidium chrysanthemi on Chrysanthemum × morifolium in the United StatesM. Bradshaw, M. Elliott, and S. ReichardM. BradshawSearch for more papers by this author, M. ElliottSearch for more papers by this author, and S. ReichardSearch for more papers by this authorAffiliationsAuthors and Affiliations M. Bradshaw , University of Washington, Seattle, WA 98125 M. Elliott , Washington State University, Puyallup, WA 98371 S. Reichard , University of Washington, Seattle, WA 98125. Published Online:16 Aug 2016https://doi.org/10.1094/PDIS-04-16-0452-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Chrysanthemum (Asteraceae) is a late summer to fall flowering ornamental with Chrysanthemum × morifolium being the most popular species in the floral industry. Powdery mildew was collected from C. × morifolium plants growing outdoors in the botanical garden at the Center for Urban Horticulture, University of Washington (47.65° N; 122.29° W) in October of 2014. Fungal colonies were circular, dense, white, and covered the surface of infected leaves, stems, and flowers. In the greenhouse, a pathogenicity test was conducted by using a sterile paintbrush to spread spores from two infected plants to 12 healthy plants. Each of these originally healthy plants developed signs of powdery mildew. Twelve different C. × morifolium plants were left in a separate room and served as controls. None of the control plants developed signs of powdery mildew. Signs on the newly infected plants were first observed 7 days postinoculation. Symptomatology on artificially infected plants was identical to that of naturally infected plants with leaves becoming covered by mycelia. Chlorotic and necrotic symptoms were noted, followed by premature leaf senescence. Hyphae were flexuous and branched close to septa at right angles. Conidia were hyaline, ellipsoid, lacked fibrosin bodies, and formed in chains of three to five. Conidia (n = 10) measurements ranged from 31.7 to 40.6 µm long (avg. 37.4 µm) by 17.8 to 21.0 µm wide (avg. 20.0 µm). Conidial length to width ratio ranged from 1.6 to 2.4 µm (avg. 1.9 µm). Conidiophores occurred unbranched with cylindrical foot cells (n = 10) that ranged from 80.7 to 140.4 µm long (avg. 116.7 µm) by 9.1 to 14.1 µm wide (avg. 12.1 µm). One to two cells occurred between the foot cells and conidia. These cells ranged from 19.7 to 26.0 µm long (avg. 22.3 µm). Germ tubes (n = 10) were simple with an average width of 3.4 µm. Appressoria were unlobed and indistinct. Chasmothecia were not observed. Morphological characteristics of the fungus were consistent with those of Euoidium chrysanthemi (Braun and Cook 2012). To confirm species identification, the internal transcribed (ITS) region of rDNA was amplified with the primers ITS4/ITS6 (White et al. 1990) from samples collected from two separate plants. The two samples had an identical sequence. A GenBank BLAST search of the resulting 537-bp ITS sequence (KU679967) was conducted. E. chrysanthemi (AB077654) was the most similar species with only one nucleotide difference (99.8% similarity). Based on morphological and molecular characteristics, it was concluded that the powdery mildew fungus was E. chrysanthemi. This is the first unequivocal report of E. chrysanthemi occurring within the United States (Farr and Rossman 2016). It is possible that E. chrysanthemi was previously collected in the United States and reported as E. chichoracearum. These results are important for the United States floral industry for which chrysanthemum is a major crop.References:Braun, U., and Cook, R. T. A. 2012. Taxonomic Manual of the Erysiphales (Powdery Mildews), CBS Biodiversity Series 11. CBS, Utrecht, the Netherlands. Google ScholarFarr, D. F., and Rossman, A. Y. 2016. Fungal Databases, Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved 13 January 2016 from http://nt.ars-grin.gov/fungaldatabases/ Google ScholarWhite, T. J., et al. 1990. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego. Crossref, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 100, No. 11 November 2016SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 7 Oct 2016Published: 16 Aug 2016First Look: 27 Jun 2016Accepted: 18 Jun 2016 Page: 2325 Information© 2016 The American Phytopathological SocietyCited byMore Than Just Plants: Botanical Gardens Are an Untapped Source of Fungal DiversityHortScience, Vol. 57, No. 10Powdery mildew of Chrysanthemum × morifolium : phylogeny and taxonomy in the context of Golovinomyces species on Asteraceae hosts30 August 2017 | Mycologia, Vol. 109, No. 3}, number={11}, journal={Plant Disease}, publisher={Scientific Societies}, author={Bradshaw, M. and Elliott, M. and Reichard, S.}, year={2016}, month={Nov}, pages={2325} }