@article{kim_rodriguez_macias_rodriguez-puebla_2022, title={Cyclin-dependent kinase 4 expression alters the number of keratinocyte stem cells in the mouse hair follicle}, ISSN={["1095-8355"]}, DOI={10.1002/cbin.11765}, abstractNote={AbstractHair follicles regenerate periodically by spontaneously undergoing cycles of growth, regression, and relative quiescence. During the hair cycle, follicle stem cells residing in a specialized niche remain quiescent, and they are stimulated to proliferate throughout the growth phase of the hair follicle. Although cell cycle regulators play a prominent role during the activation of hair follicle stem cells, the identity and the role of these regulators have not been confirmed. Herein, we reported that stem cells located in the bulge region of the HF (BuSCs) express high levels of cyclin‐dependent kinase 4 (CDK4) through the quiescent phase of the hair cycle. Using gain‐ and loss‐of‐function studies, we have determined that the CDK4 protein level affects the number of BuSCs. Transgenic expression of CDK4 in the bulge region of the hair follicles reduces the number of BuSCs, whereas CDK4 ablation resulted in an increasing number of BuSCs. These results suggest that deregulation of CDK4 protein levels contributes to distorting the self‐renewal/proliferation balance and, in turn, altering the number of BuSCs.}, journal={CELL BIOLOGY INTERNATIONAL}, author={Kim, Sun Hye and Rodriguez, Liliana R. L. and Macias, Everardo and Rodriguez-Puebla, Marcelo L.}, year={2022}, month={Feb} }
 @article{lee_rodriguez_majumdar_de marval_rodriguez-puebla_2021, title={CDK4 has the ability to regulate Aurora B and Cenpp expression in mouse keratinocytes}, volume={22}, ISSN={["1792-1082"]}, DOI={10.3892/ol.2021.12993}, abstractNote={Cyclin-dependent kinase 4 (CDK4) is a critical molecule that regulates key aspects of cell proliferation through phosphorylation of the retinoblastoma (Rb) family of proteins. In the last few years, it has been suggested that CDK4 plays alternative roles in cell proliferation and tumorigenesis. The main aim of the present study was to define a novel CDK4 function as a transcriptional regulator of genes involved in chromosome segregation, contributing to the G2/M phase transition. Herein, chromatin-immunoprecipitation reverse transcription-quantitative PCR assays were performed to demonstrate that CDK4 could occupy the promoter region of genes associated with chromosomal segregation, such as Aurora-B (Aurkb) and Centromere Protein P (CENP-P). Moreover, gain- and loss-of-function experiments showed that CDK4 participated in the transcriptional regulation of Aurkb and CENP-P. The finding that Aurkb may have a crucial role in chromosome bi-orientation and the spindle assembly checkpoint, and that CENP-P could be required for proper kinetochore function suggests that dysregulation of CDK4 expression induces chromosomal instability and, in some cases, cancer development.}, number={4}, journal={ONCOLOGY LETTERS}, author={Lee, Sung Hyun and Rodriguez, Liliana R. L. and Majumdar, Rima and De Marval, Paula L. Miliani and Rodriguez-Puebla, Marcelo L.}, year={2021}, month={Oct} }
 @article{lee_rodriguez_marval_rodriguez-puebla_2020, title={Emergent functions of cyclin-dependent kinase 4 regulating aurora b and cenpp transcription}, volume={80}, ISBN={1538-7445}, DOI={10.1158/1538-7445.AM2020-5814}, abstractNote={Abstract
               A better understanding of the precise molecular mechanisms that control cell proliferation is crucial for the identification of novel cancer therapeutic targets. A critical molecule in this process is the Cyclin-Dependent Kinase 4 (CDK4), which regulates key aspects of the G1 to S phase transition through phosphorylation of the retinoblastoma (Rb) family of proteins. Since dysregulation of this cell cycle mechanism is a hallmark of most cancers, drugs have been developed to inhibit the kinase activity of CDK4. However, such drugs have been met with variable degrees of success and, in some cases, little efficacy. Research performed in the last few years has suggested that CDK4 have alternative targets other than the Rb proteins. Consistent with this idea, we found that CDK4 plays additional roles not related to the canonical function in the CDK-Rb axis. Here, we show that CDK4 remains attached to the chromatin fraction of Balb/MK2 keratinocytes upon the extraction of the soluble components (nucleoplasm and cytoplasm). Chromatin-immunoprecipitation (ChIP) analysis shows that CDK4 occupies the regulatory sites of genes associated with chromosomal segregation, such as Aurkb (Aurora B) and Cenpp (Centromere Protein P). Moreover, gain- and loss-of-function experiments showed that the AurkB and Cenpp promoters are regulated through CDK4 binding. In line with these findings, studies in skin carcinogenesis revealed that transgenic expression of CDK4 in mouse epidermis induces chromosome instability (CIN) and centrosome amplification (CA), two events linked to overexpression of Aurora B. Moreover, Aurora-B has a crucial role in chromosome bi-orientation and the spindle-assembly checkpoint, whereas Cenpp is required for proper kinetochore function. Remarkably, a persistent dysregulation of Aurora B has been reported in numerous human cancers. Thus, our results suggest that CDK4 plays a role in the maintenance of chromosomal stability, implying that additional functions could be inhibited by therapeutically targeting CDK4. Our conclusions are supported by previous reports showing that pharmacological inhibition of CDK4 led to delayed progression from G2 to mitosis in Rb-positive and as well as Rb-negative cells.
               Citation Format: Sung Hyun Lee, Liliana R. Rodriguez, Paula L. Miliani de Marval, Marcelo L. Rodriguez-Puebla. Emergent functions of cyclin-dependent kinase 4 regulating aurora b and cenpp transcription [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 5814.}, number={16}, journal={CANCER RESEARCH}, author={Lee, Sung Hyun and Rodriguez, Liliana R. and Marval, Paula L. Miliani and Rodriguez-Puebla, Marcelo L.}, year={2020}, month={Aug} }
 @article{lee_wang_kim_kim_rodriguez-puebla_2017, title={Cyclin D3 deficiency inhibits skin tumor development, but does not affect normal keratinocyte proliferation}, volume={14}, ISSN={["1792-1082"]}, DOI={10.3892/ol.2017.6551}, abstractNote={Rearrangement and amplification of the D-type cyclin genes have been reported in human cancer. Previous studies have demonstrated that Ras-mediated skin tumorigenesis depends on pathways that act through cyclin D1 and D2; however, the role of cyclin D3 remains unknown. The present study demonstrates that cyclin D3 ablation does not affect keratinocyte proliferation, but instead increases apoptosis levels in the bulge region of the hair follicle. Consequently, cyclin D3 ablation reduces skin papilloma development in a Ras-dependent carcinogenesis model. Previous results revealed that cyclin D3 preferentially binds to cyclin-dependent kinase 6 (CDK6) in mouse keratinocytes and transgenic expression of CDK6 (K5CDK6 mice) inhibits skin tumor development. Thus, we hypothesized that the inhibitory effect of CDK6 is dependent on cyclin D3 expression. To test this hypothesis, a mouse model that overexpresses CDK6 and does not express cyclin D3 (K5CDK6/cyclin D3-/− compound mouse) was developed. Biochemical analysis of the epidermis of K5CDK6/cyclin D3-/− mice revealed that cyclin D3 ablation resulted in increased expression of cyclin D1 protein, with a consequent elevation in the level of CDK6/cyclin D1 and CDK4/cyclin D1 complexes. These findings were concurrent with the increase skin papilloma malignant progression observed in K5CDK6/cyclin D3-/− mice. In summary the absence of cyclin D3 led to fewer number of papillomas in cyclin D3-ablated mice than in the wild-type owing to increased apoptosis, suggesting that alterations in cell survival are a crucial mechanism for crippling cellular defense against neoplasia. The results of the current study also suggest that although cyclin D3 expression does not alter the tumor suppressive role of CDK6 in skin carcinogenesis, the compensatory increase in cyclin D1 can shift the balance towards malignant progression.}, number={3}, journal={ONCOLOGY LETTERS}, author={Lee, Sung Hyun and Wang, Xian and Kim, Sun Hye and Kim, Yongbaek and Rodriguez-Puebla, Marcelo L.}, year={2017}, month={Sep}, pages={2723–2734} }
 @article{sistrunk_kim_wang_lee_kim_macias_rodriguez-puebla_2013, title={Skp2 Deficiency Inhibits Chemical Skin Tumorigenesis Independent of p27(Kip1) Accumulation}, volume={182}, ISSN={["0002-9440"]}, DOI={10.1016/j.ajpath.2013.01.016}, abstractNote={S-phase kinase-associated protein 2 (Skp2) functions as the receptor component of the Skp-Cullin-F-box complex and is implicated in the degradation of several cell cycle regulators, such as p21(Cip1), p27(Kip1), p57(Kip2), and cyclin E. Numerous studies in human and experimental tumors have demonstrated low p27(Kip1) levels and elevated Skp2 expression. However, a direct association between the inverse correlation of Skp2 and p27(Kip1) with tumorigenesis has not been demonstrated. Herein, we provide evidence that skin tumorigenesis is inhibited in Skp2(-/-) mice. An analysis of mouse keratinocytes indicates that increased p27(Kip1) levels in Skp2(-/-) epidermis cause reduced cell proliferation that is alleviated in the epidermis from Skp2(-/-)/p27(-/-) compound mice. In contrast, we establish that a p27(Kip1) deficiency does not overturn the reduced skin tumorigenesis experienced by Skp2(-/-) mice. In addition, Skp2(-/-) epidermis exhibits an accumulation of p53-cofactor CBP/p300 that is associated with elevated apoptosis in hair follicles and decreased skin tumorigenesis. We conclude that p27(Kip1) accumulation is responsible for the hypoplasia observed in normal tissues of Skp2(-/-) mice but does not have a preponderant function in reducing skin tumorigenesis.}, number={5}, journal={AMERICAN JOURNAL OF PATHOLOGY}, author={Sistrunk, Christopher and Kim, Sun Hye and Wang, Xian and Lee, Sung Hyun and Kim, Yongbaek and Macias, Everardo and Rodriguez-Puebla, Marcelo L.}, year={2013}, month={May}, pages={1854–1864} }
 @article{wang_sistrunk_marval_kim_rodriguez-puebla_2012, title={Combined effect of cyclin D3 expression and abrogation of cyclin D1 prevent mouse skin tumor development}, volume={11}, ISSN={["1551-4005"]}, DOI={10.4161/cc.11.2.18774}, abstractNote={We have previously demonstrated that ras-mediated skin tumorigenesis depends on signaling pathways that act preferentially through cyclin D1 and D2. Interestingly, the expression of cyclin D3 inhibits skin tumor development, an observation that conflicts with the oncogenic role of D-type cyclins in the mouse epidermis. Here, we show that simultaneous up and downregulation of particular members of the D-type cyclin family is a valuable approach to reduce skin tumorigenesis. We developed the K5D3/cyclin D1-/- compound mouse, which overexpresses cyclin D3 but lacks expression of cyclin D1 in the skin. Similar to K5D3 transgenic mice, keratinocytes from K5D3/cyclin D1-/- compound mice show a significant reduction of cyclin D2 levels. Therefore, this model allows us to determine the effect of cyclin D3 expression when combined with reduced or absent expression of the remaining two members of the D-type cyclin family in mouse epidermis. Our data show that induced expression of cyclin D3 compensates for the reduced level of cyclin D1 and D2, resulting in normal keratinocyte proliferation. However, simultaneous ablation of cyclin D1 and downregulation of cyclin D2 via cyclin D3 expression resulted in a robust reduction in ras-mediated skin tumorigenesis. We conclude that modulation of the levels of particular members of the D-type cyclin family could be useful to inhibit tumor development and, in particular, ras-mediated tumorigenesis.}, number={2}, journal={CELL CYCLE}, author={Wang, Xian and Sistrunk, Christopher and Marval, Paula L. Miliani and Kim, Yongbaek and Rodriguez-Puebla, Marcelo L.}, year={2012}, month={Jan}, pages={335–342} }
 @article{sistrunk_macias_nakayama_kim_rodriguez-puebla_2011, title={Skp2 Is Necessary for Myc-Induced Keratinocyte Proliferation but Dispensable for Myc Oncogenic Activity in the Oral Epithelium}, volume={178}, ISSN={["0002-9440"]}, DOI={10.1016/j.ajpath.2011.02.034}, abstractNote={The proto-oncogene c-Myc encodes a transcription factor that is implicated in the regulation of cellular proliferation, differentiation, and apoptosis. Myc accelerates the rate of cell proliferation, at least in part, through its ability to down-regulate the expression of the cell cycle inhibitor p27(Kip1). Moreover, p27(Kip1) protein levels are regulated by ubiquitin-mediated turnover, leading to destruction by the E3 ubiquitin ligase SCF(Skp2). Therefore, we hypothesize that a lack of Skp2 expression should lead to increased p27(Kip1) levels and further inhibition of Myc-mediated proliferation and tumorigenesis. Myc expression in epithelial tissues of transgenic mice (K5-Myc) led to increased keratinocyte proliferation and the development of spontaneous tumors within the oral cavity. We generated K5-Myc-transgenic mice in an Skp2-null background. Consistent with our hypothesis, we found that Myc-mediated keratinocyte hyperproliferation was abolished by the loss of Skp2. However, Skp2 ablation did not affect Myc-driven tumorigenesis because the incidence, latency, and degree of differentiation of oral tumors were identical between K5-Myc/Skp2(+/+) and K5-Myc/Skp2(-/-) mice. Altogether, these findings suggest that Skp2 and p27(Kip1) are critical for Myc-driven keratinocyte proliferation; however, Myc-mediated tumorigenesis in the oral epithelium is independent of the Skp2-p27(Kip1) axis.}, number={6}, journal={AMERICAN JOURNAL OF PATHOLOGY}, author={Sistrunk, Christopher and Macias, Everardo and Nakayama, Keiichi and Kim, Yongbaek and Rodriguez-Puebla, Marcelo L.}, year={2011}, month={Jun}, pages={2470–2477} }
 @article{mengoni_vichera_rigano_rodriguez-puebla_galliano_cafferata_pivetta_moreno_vojnov_2011, title={Suppression of COX-2, IL-1 beta and TNF-alpha expression and leukocyte infiltration in inflamed skin by bioactive compounds from Rosmarinus officinalis L.}, volume={82}, ISSN={["1873-6971"]}, DOI={10.1016/j.fitote.2010.11.023}, abstractNote={In the present study, we evaluated the effects of extracts and purified compounds from fresh leaves of Rosmarinus officinalis L. Pretreatment with the major anti-inflammatory compounds, carnosic acid (CA) and carnosol (CS), inhibited phorbol 12-myristate 13-acetate (PMA)-induced ear inflammation in mice with an EC50 of 10.20 μg/cm2 and 10.70 μg/cm2, respectively. To further understand the anti-inflammatory mechanism of these compounds, we analyzed the in vivo expression of several inflammation-associated genes in mouse skin by reverse transcriptase-polymerase chain reaction (RT-PCR). Our data showed that CA and CS reduced the expression of IL-1β and TNF-α but had less effect on fibronectin and ICAM-1 expression. Interestingly, both compounds selectively inhibited COX-2 but not COX-1. Histopathological analysis of hematoxylin and eosin (H&E)-stained tissue revealed a marked reduction in leukocyte infiltration and epidermal ulceration of PMA-treated ears when ears were pretreated with ethanolic extracts or pure CA. In vitro, we showed that ethanolic extract, carnosic acid and carnosol significantly inhibited the overproduction of nitric oxide (NO) in a dose-dependent manner in the RAW 264.7 murine macrophage cell line. For the first time in vivo, we showed that CA and CS differentially regulate the expression of inflammation-associated genes, thus demonstrating the pharmacological basis for the anti-inflammatory properties reported for CA and CS.}, number={3}, journal={FITOTERAPIA}, author={Mengoni, Eleonora S. and Vichera, Gabriel and Rigano, Luciano A. and Rodriguez-Puebla, Marcelo L. and Galliano, Silvia R. and Cafferata, Eduardo E. and Pivetta, Omar H. and Moreno, Sivia and Vojnov, Adrian A.}, year={2011}, month={Apr}, pages={414–421} }
 @article{wang_sistrunk_rodriguez-puebla_2011, title={Unexpected Reduction of Skin Tumorigenesis on Expression of Cyclin-Dependent Kinase 6 in Mouse Epidermis}, volume={178}, ISSN={["0002-9440"]}, DOI={10.1016/j.ajpath.2010.11.032}, abstractNote={Cyclin-dependent kinases (CDKs) 4 and 6 are important regulators of the G1 phase of the cell cycle, share 71% amino acid identity, and are expressed ubiquitously. As a result, it was assumed that each of these kinases plays a redundant role regulating normal and neoplastic proliferation. In previous reports, we have described the effects of CDK4 expression in transgenic mice, including the development of epidermal hyperplasia and increased malignant progression to squamous cell carcinoma. To study the role of CDK6 in epithelial growth and tumorigenesis, we generated transgenic mice carrying the CDK6 gene under the keratin 5 promoter (K5CDK6). Similar to K5CDK4 mice, epidermal proliferation increased substantially in K5CDK6 mice; however, no hyperplasia was observed. CDK6 overexpression also triggered keratinocyte apoptosis in interfollicular and follicular epidermis as a compensatory mechanism to override aberrant proliferation. Unexpectedly, CDK6 overexpression results in decreased skin tumor development compared with wild-type siblings. The inhibition in skin tumorigenesis was similar to that previously reported in K5-cyclin D3 mice. Furthermore, biochemical analysis of the K5CDK6 epidermis showed preferential complex formation between CDK6 and cyclin D3, suggesting that this particular complex plays an important role in tumor restraint. These studies provide in vivo evidence that CDK4 and CDK6 play a similar role as a mediator of keratinocyte proliferation but differ in apoptosis activation and skin tumor development. Cyclin-dependent kinases (CDKs) 4 and 6 are important regulators of the G1 phase of the cell cycle, share 71% amino acid identity, and are expressed ubiquitously. As a result, it was assumed that each of these kinases plays a redundant role regulating normal and neoplastic proliferation. In previous reports, we have described the effects of CDK4 expression in transgenic mice, including the development of epidermal hyperplasia and increased malignant progression to squamous cell carcinoma. To study the role of CDK6 in epithelial growth and tumorigenesis, we generated transgenic mice carrying the CDK6 gene under the keratin 5 promoter (K5CDK6). Similar to K5CDK4 mice, epidermal proliferation increased substantially in K5CDK6 mice; however, no hyperplasia was observed. CDK6 overexpression also triggered keratinocyte apoptosis in interfollicular and follicular epidermis as a compensatory mechanism to override aberrant proliferation. Unexpectedly, CDK6 overexpression results in decreased skin tumor development compared with wild-type siblings. The inhibition in skin tumorigenesis was similar to that previously reported in K5-cyclin D3 mice. Furthermore, biochemical analysis of the K5CDK6 epidermis showed preferential complex formation between CDK6 and cyclin D3, suggesting that this particular complex plays an important role in tumor restraint. These studies provide in vivo evidence that CDK4 and CDK6 play a similar role as a mediator of keratinocyte proliferation but differ in apoptosis activation and skin tumor development. Normal cell growth and differentiation require precise control of the mechanisms that govern the entry into, passage through, and exit from the cell cycle. Progress through the G1 phase of the mammalian cell cycle is mediated by D-type cyclins, which associate and activate cyclin-dependent kinases (CDKs) 4 and 6.1Sherr C.J. D-type cyclins.Trends Biochem Sci. 1995; 20: 187-190Abstract Full Text PDF PubMed Scopus (883) Google Scholar, 2Weinberg R.A. The retinoblastoma protein and cell cycle control.Cell. 1995; 81: 323-330Abstract Full Text PDF PubMed Scopus (4310) Google Scholar The Retinoblastoma (pRb) family of proteins, pRb, p107, and p130, are key substrates for G1-CDK/cyclin complexes and negatively regulate the passage of cells from G1 to S phase.2Weinberg R.A. The retinoblastoma protein and cell cycle control.Cell. 1995; 81: 323-330Abstract Full Text PDF PubMed Scopus (4310) Google Scholar Therefore, CDK4 and CDK6 act as master integrators in the G1 phase, coupling with cell cycle mitogenic signals and their oncogenic properties in cancer cells.3Blain S.W. Montalvo E. Massague J. Differential interaction of the cyclin-dependent kinase (Cdk) inhibitor p27Kip1 with cyclin A-Cdk2 and cyclin D2-Cdk4.J Biol Chem. 1997; 272: 25863-25872Crossref PubMed Scopus (246) Google Scholar, 4Sherr C.J. McCormick F. The RB and p53 pathways in cancer.Cancer Cell. 2002; 2: 103-112Abstract Full Text Full Text PDF PubMed Scopus (1312) Google Scholar, 5Sherr C.J. Roberts J.M. CDK inhibitors: positive and negative regulators of G1-phase progression.Genes Dev. 1999; 10: 1491-1502Google Scholar CDK4 and CDK6 share 71% amino acid identity, and both are expressed ubiquitously.6Meyerson M. Harlow E. Identification of G1 kinase activity for cdk6, a novel cyclin D partner.Mol Cell Biol. 1994; 14: 2077-2086Crossref PubMed Scopus (734) Google Scholar As a result, it was assumed that both play a redundant function in the G1 phase and tumorigenesis. However, in the last few years, relevant differences were determined between the functional properties of these G1 kinases. Initial experiments identified CDK6 activity in T cells, suggesting that cell type–specific expression might explain the need for two G1 kinases.7Lucas J.J. Szepesi A. Modiano J.F. Domenico J. Gelfand E.W. Regulation of synthesis and activity of the PLSTIRE protein (cyclin-dependent kinase 6 (cdk6)), a major cyclin D-associated cdk4 homologue in normal human T lymphocytes.J Immunol. 1995; 154: 6275-6284PubMed Google Scholar Supporting this hypothesis, CDK6-deficient mice showed a reduced number of red blood cells and lymphocytes and pronounced thymic atrophy due to decreased proliferation and blockage of differentiation.8Malumbres M. Sotillo R. Santamaria D. Galan J. Cerezo A. Ortega S. Dubus P. Barbacid M. Mammalian cells cycle without the D-type cyclin-dependent kinases Cdk4 and Cdk6.Cell. 2004; 118: 493-504Abstract Full Text Full Text PDF PubMed Scopus (623) Google Scholar, 9Hu M.G. Deshpande A. Enos M. Mao D. Hinds E.A. Hu G.F. Chang R. Guo Z. Dose M. Mao C. Tsichlis P.N. Gounari F. Hinds P.W. A requirement for cyclin-dependent kinase 6 in thymocyte development and tumorigenesis.Cancer Res. 2009; 69: 810-818Crossref PubMed Scopus (89) Google Scholar Recently, Bockstaele et al10Bockstaele L. Bisteau X. Paternot S. Roger P.P. Differential regulation of cyclin-dependent kinase 4 (CDK4) and CDK6, evidence that CDK4 might not be activated by CDK7, and design of a CDK6 activating mutation.Mol Cell Biol. 2009; 29: 4188-4200Crossref PubMed Scopus (54) Google Scholar reported differences in CDK4 and CDK6 regulation. They showed that CDK6, but not CDK4, is regulated by CDK-Activating Kinase (CAK) and suggested a proline-directed kinase to be the main regulator of CDK4. Novel functions of CDK6 have recently been reported, for instance, residue selectivity of these kinases on the retinoblastoma protein,11Takaki T. Fukasawa K. Suzuki-Takahashi I. Semba K. Kitagawa M. Taya Y. Hirai H. Preferences for phosphorylation sites in the retinoblastoma protein of D-type cyclin-dependent kinases Cdk4 and Cdk6, in vitro.J Biochem. 2005; 137: 381-386Crossref PubMed Scopus (40) Google Scholar different subcellular localizations,12Grossel M.J. Baker G.L. Hinds P.W. cdk6 can shorten G(1) phase dependent upon the N-terminal INK4 interaction domain.J Biol Chem. 1999; 274: 29960-29967Crossref PubMed Scopus (53) Google Scholar, 13Ericson K.K. Krull D. Slomiany P. Grossel M.J. Expression of cyclin-dependent kinase 6, but not cyclin-dependent kinase 4, alters morphology of cultured mouse astrocytes.Mol Cancer Res. 2003; 1: 654-664PubMed Google Scholar and a specific role of CDK6 during the differentiation of a variety of cell types.13Ericson K.K. Krull D. Slomiany P. Grossel M.J. Expression of cyclin-dependent kinase 6, but not cyclin-dependent kinase 4, alters morphology of cultured mouse astrocytes.Mol Cancer Res. 2003; 1: 654-664PubMed Google Scholar, 14Matushansky I. Radparvar F. Skoultchi A.I. CDK6 blocks differentiation: coupling cell proliferation to the block to differentiation in leukemic cells.Oncogene. 2003; 22: 4143-4149Crossref PubMed Scopus (71) Google Scholar, 15Ogasawara T. Kawaguchi H. Jinno S. Hoshi K. Itaka K. Takato T. Nakamura K. Okayama H. Bone morphogenetic protein 2-induced osteoblast differentiation requires Smad-mediated down-regulation of Cdk6.Mol Cell Biol. 2004; 24: 6560-6568Crossref PubMed Scopus (105) Google Scholar, 16Ogasawara T. Katagiri M. Yamamoto A. Hoshi K. Takato T. Nakamura K. Tanaka S. Okayama H. Kawaguchi H. Osteoclast differentiation by RANKL requires NF-kappaB-mediated downregulation of cyclin-dependent kinase 6 (Cdk6).J Bone Miner Res. 2004; 19: 1128-1136Crossref PubMed Scopus (61) Google Scholar Moreover, CDK6 plays a role in halting inappropriate cellular proliferation through a mechanism involving the accumulation of p53 and p130 growth-suppressing proteins,17Nagasawa M. Gelfand E.W. Lucas J.J. Accumulation of high levels of the p53 and p130 growth-suppressing proteins in cell lines stably over-expressing cyclin-dependent kinase 6 (cdk6).Oncogene. 2001; 20: 2889-2899Crossref PubMed Scopus (19) Google Scholar and the activation of CDK6 precedes CDK4 activation in T cells.18Lucas J.J. Terada N. Szepesi A. Gelfand E.W. Regulation of synthesis of p34cdc2 and its homologues and their relationship to p110Rb phosphorylation during cell cycle progression of normal human T cells.J Immunol. 1992; 148: 1804-1811PubMed Google Scholar, 19Lucas J.J. Szepesi A. Domenico J. Tordai A. Terada N. Gelfand E.W. Differential regulation of the synthesis and activity of the major cyclin-dependent kinases, p34cdc2, p33cdk2, and p34cdk4, during cell cycle entry and progression in normal human T lymphocytes.J Cell Physiol. 1995; 165: 406-416Crossref PubMed Scopus (28) Google Scholar Data from tumor studies also suggested similarity and differences between these kinases. For instance, both CDK4 and CDK6 have been found to be overexpressed in human gliomas.20Costello J.F. Plass C. Arap W. Chapman V.M. Held W.A. Berger M.S. Su Huang H.J. Cavenee W.K. Cyclin-dependent kinase 6 (CDK6) amplification in human gliomas identified using two-dimensional separation of genomic DNA.Cancer Res. 1997; 57: 1250-1254PubMed Google Scholar, 21Ichimura K. Schmidt E.E. Goike H.M. Collins V.P. Human glioblastomas with no alterations of the CDKN2A (p16INK4A. MTS1) and CDK4 genes have frequent mutations of the retinoblastoma gene.Oncogene. 1996; 13: 1065-1072PubMed Google Scholar, 22Lam P.Y. Di Tomaso E. Ng H.K. Pang J.C. Roussel M.F. Hjelm N.M. Expression of p19INK4d CDK4, CDK6 in glioblastoma multiforme.Br J Neurosurg. 2000; 14: 28-32Crossref PubMed Scopus (49) Google Scholar, 23Schmidt E.E. Ichimura K. Reifenberger G. Collins V.P. CDKN2 (p16/MTS1) gene deletion or CDK4 amplification occurs in the majority of glioblastomas.Cancer Res. 1994; 54: 6321-6324PubMed Google Scholar On the other hand, CDK4, but not CDK6, is specifically targeted in melanomas,24Zuo L. Weger J. Yang Q. Goldstein A.M. Tucker M.A. Walker G.J. Hayward N. Dracopoli N.C. Germline mutations in the p16INK4a binding domain of CDK4 in familial melanoma.Nat Genet. 1996; 12: 97-99Crossref PubMed Scopus (668) Google Scholar, 25Wölfel T. Hauer M. Schneider J. Serrano M. Wölfel C. Klehmann-Hieb E. De Plaen E. Hankeln T. Meyer zum Büschenfelde K.H. Beach D. A p16INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma.Science. 1995; 269: 1281-1284Crossref PubMed Scopus (1001) Google Scholar whereas CDK6 activity has been found elevated in squamous cell carcinomas (SCCs)26Timmermann S. Hinds P.W. Munger K. Elevated activity of cyclin-dependent kinase 6 in human squamous cell carcinoma lines.Cell Growth Differ. 1997; 8: 361-370PubMed Google Scholar, 27Piboonniyom S.O. Timmermann S. Hinds P. Munger K. Aberrations in the MTS1 tumor suppressor locus in oral squamous cell carcinoma lines preferentially affect the INK4A gene and result in increased cdk6 activity.Oral Oncol. 2002; 38: 179-186Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar and neuroblastomas28Easton J. Wei T. Lahti J.M. Kidd V.J. Disruption of the cyclin D/cyclin-dependent kinase/INK4/retinoblastoma protein regulatory pathway in human neuroblastoma.Cancer Res. 1998; 58: 2624-2632PubMed Google Scholar without alteration of CDK4 activity. The two-stage mouse skin carcinogenesis protocol is a well-suited model for understanding the multistage nature of tumor progression. In this model, tumor initiation is accomplished through a single topical application of a carcinogen, typically, 7,12-dimethylbenz(a)anthracene (DMBA). This produces a genetic inheritable mutation in the Ha-ras oncogene. Tumor promotion takes place when the initiated cells are expanded because of multiple applications of a tumor promoter, usually 12-O-tetradecanoylphorbol-13-acetate (TPA). This stimulus induces hyperproliferation that promotes the generation of benign tumors, so-called papillomas. Finally, although papilloma regression is a common event, in some cases, malignant progression occurs and papillomas evolve to SCCs. In the last few years, we and others have used the mouse skin model to study the role of positive and negative regulators of cell cycle in normal and neoplastic proliferation.29Zhang S.-Y. Liu S.-C. Goodrow T. Morris R. Klein-Szanto A.J.P. Increased expression of G1 cyclins and cyclin-dependent kinases during tumor progression of chemically induced mouse skin neoplasms.Mol Carcinog. 1997; 18: 142-152Crossref PubMed Scopus (39) Google Scholar, 30Rodriguez-Puebla M.L. LaCava M. Gimenez-Conti I.B. Johnson D.G. Conti C.J. Deregulated expression of cell-cycle proteins during premalignant progression in SENCAR mouse skin.Oncogene. 1998; 17: 2251-2258Crossref PubMed Scopus (33) Google Scholar, 31Rodriguez-Puebla M.L. LaCava M. Conti C.J. Cyclin D1 overexpression in mouse epidermis increases cyclin-dependent kinase activity and cell proliferation in vivo but does not affect skin tumor development.Cell Growth Differ. 1999; 10: 467-472PubMed Google Scholar, 32Rodriguez-Puebla M.L. Miliani de Marval P.L. LaCava M. Moons D.S. Kiyokawa H. Conti C.J. Cdk4 deficiency inhibits skin tumor development but does not affect normal keratinocyte proliferation.Am J Pathol. 2002; 161: 405-411Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 33Miliani de Marval P.L. Macias E. Conti C.J. Rodriguez-Puebla M.L.R. Enhanced malignant tumorigenesis in Cdk4 transgenic miceR.Oncogene. 2004; 23R: 1863-1873Crossref Scopus (55) Google Scholar, 34Rojas P. Benavides F. Blando J. Perez C. Cardenas K. Richie E. Knudsen E.S. Johnson D.G. Senderowicz A.M. Rodriguez-Puebla M.L. Conti C.J. Enhanced skin carcinogenesis and lack of thymus hyperplasia in transgenic mice expressing human cyclin D1b (CCND1b).Mol Carcinog. 2009; 48: 508-516Crossref PubMed Scopus (8) Google Scholar, 35Macias E. Kim Y. Miliani de Marval P.L. Klein-Szanto A. Rodriguez-Puebla M.L. Cdk2 deficiency decreases ras/CDK4-dependent malignant progression, but not myc-induced tumorigenesis.Cancer Res. 2007; 67: 9713-9720Crossref PubMed Scopus (26) Google Scholar, 36Macias E. Miliani de Marval P.L. De Siervi A. Conti C.J. Senderowicz A.M. Rodriguez-Puebla M.L. CDK2 activation in mouse epidermis induces keratinocyte proliferation but does not affect skin tumor development.Am J Pathol. 2008; 173: 526-535Abstract Full Text Full Text PDF PubMed Scopus (12) Google Scholar, 37Miliani de Marval P.L. Gimenez-Conti I.B. LaCava M. Martinez L.A. Conti C.J. Rodriguez-Puebla M.L. Transgenic expression of cyclin-dependent kinase 4 results in epidermal hyperplasia, hypertrophy, and severe dermal fibrosis.Am J Pathol. 2001; 159: 369-379Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar, 38Miliani de Marval P.L. Macias E. Rounbehler R. Sicinski P. Kiyokawa H. Johnson D.G. Conti C.J. Rodriguez-Puebla M.L. Lack of cyclin-dependent kinase 4 inhibits c-myc tumorigenic activities in epithelial tissues.Mol Cell Biol. 2004; 24: 7538-7547Crossref PubMed Scopus (89) Google Scholar, 39Rodriguez-Puebla M.L. LaCava M. Miliani De Marval P.L. Jorcano J.L. Richie E.R. Conti C.J. Cyclin D2 overexpression in transgenic mice induces thymic and epidermal hyperplasia whereas cyclin D3 expression results only in epidermal hyperplasia.Am J Pathol. 2000; 157: 1039-1050Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 40Rojas P. Cadenas M.B. Lin P.C. Benavides F. Conti C.J. Rodriguez-Puebla M.L. Cyclin D2 and cyclin D3 play opposite roles in mouse skin carcinogenesis.Oncogene. 2007; 26: 1723-1730Crossref PubMed Scopus (16) Google Scholar Work from our group and other laboratories has shown that CDK4 is mechanistically involved in the development of human and experimental epidermal tumors.32Rodriguez-Puebla M.L. Miliani de Marval P.L. LaCava M. Moons D.S. Kiyokawa H. Conti C.J. Cdk4 deficiency inhibits skin tumor development but does not affect normal keratinocyte proliferation.Am J Pathol. 2002; 161: 405-411Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 33Miliani de Marval P.L. Macias E. Conti C.J. Rodriguez-Puebla M.L.R. Enhanced malignant tumorigenesis in Cdk4 transgenic miceR.Oncogene. 2004; 23R: 1863-1873Crossref Scopus (55) Google Scholar, 35Macias E. Kim Y. Miliani de Marval P.L. Klein-Szanto A. Rodriguez-Puebla M.L. Cdk2 deficiency decreases ras/CDK4-dependent malignant progression, but not myc-induced tumorigenesis.Cancer Res. 2007; 67: 9713-9720Crossref PubMed Scopus (26) Google Scholar, 38Miliani de Marval P.L. Macias E. Rounbehler R. Sicinski P. Kiyokawa H. Johnson D.G. Conti C.J. Rodriguez-Puebla M.L. Lack of cyclin-dependent kinase 4 inhibits c-myc tumorigenic activities in epithelial tissues.Mol Cell Biol. 2004; 24: 7538-7547Crossref PubMed Scopus (89) Google Scholar, 41Yu Q. Sicinska E. Geng Y. Ahnstrom M. Zagozdzon A. Kong Y. Gardner H. Kiyokawa H. Harris L.N. Stal O. Sicinski P. Requirement for CDK4 kinase function in breast cancer.Cancer Cell. 2006; 9: 23-32Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar, 42Zou X. Ray D. Aziyu A. Christov K. Boiko A.D. Gudkov A.V. Kiyokawa H. Cdk4 disruption renders primary mouse cells resistant to oncogenic transformation, leading to Arf/p53-independent senescence.Genes Dev. 2002; 16: 2923-2934Crossref PubMed Scopus (123) Google Scholar These studies showed that forced expression of CDK4 in the epidermis results in increased malignant progression to SCCs,33Miliani de Marval P.L. Macias E. Conti C.J. Rodriguez-Puebla M.L.R. Enhanced malignant tumorigenesis in Cdk4 transgenic miceR.Oncogene. 2004; 23R: 1863-1873Crossref Scopus (55) Google Scholar whereas CDK4 ablation completely inhibits skin tumor development.32Rodriguez-Puebla M.L. Miliani de Marval P.L. LaCava M. Moons D.S. Kiyokawa H. Conti C.J. Cdk4 deficiency inhibits skin tumor development but does not affect normal keratinocyte proliferation.Am J Pathol. 2002; 161: 405-411Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar On the other hand, the overexpression of CDK2 or the indirect activation of CDK2 in mouse epidermis induces keratinocyte proliferation but does not affect skin tumor development.35Macias E. Kim Y. Miliani de Marval P.L. Klein-Szanto A. Rodriguez-Puebla M.L. Cdk2 deficiency decreases ras/CDK4-dependent malignant progression, but not myc-induced tumorigenesis.Cancer Res. 2007; 67: 9713-9720Crossref PubMed Scopus (26) Google Scholar, 36Macias E. Miliani de Marval P.L. De Siervi A. Conti C.J. Senderowicz A.M. Rodriguez-Puebla M.L. CDK2 activation in mouse epidermis induces keratinocyte proliferation but does not affect skin tumor development.Am J Pathol. 2008; 173: 526-535Abstract Full Text Full Text PDF PubMed Scopus (12) Google Scholar Despite the evidences that G1-CDKs are involved in proliferation and tumorigenesis, the actual role of CDK6 in epidermis has not been established. Therefore, to study the role of CDK6 in epithelial growth, differentiation, and tumorigenesis, we generated a transgenic mouse carrying the CDK6 gene under the control of the keratin 5 promoter (K5CDK6). As expected, transgenic mice showed expression of CDK6 in the epidermal basal cell layer. Analogous to K5CDK4 mice, epidermal proliferation increased substantially in K5CDK6 mice, although no hyperplasia was observed. Interestingly, the overexpression of CDK6 also results in augmented apoptosis in interfollicular epidermis and hair follicles. Biochemical analysis of K5CDK6 epidermal tissues showed increased CDK6 kinase activity with no effect on CDK4 and CDK2 kinase activities, suggesting that sequestration of p27Kip1 and indirect activation of CDK2 is not a relevant mechanism in the K5CDK6 epidermis. We have also studied the susceptibility of K5CDK6 mice to the two-stage chemical carcinogenesis protocol. Surprisingly, we found that forced expression of CDK6 leads to decreased skin tumor development. Moreover, skin tumors from K5CDK6 mice show no progression to SCCs, as we previously observed in K5CDK4 mice. These results mimic the effect of cyclin D3 overexpression in K5–cyclin D3 mouse epidermis,40Rojas P. Cadenas M.B. Lin P.C. Benavides F. Conti C.J. Rodriguez-Puebla M.L. Cyclin D2 and cyclin D3 play opposite roles in mouse skin carcinogenesis.Oncogene. 2007; 26: 1723-1730Crossref PubMed Scopus (16) Google Scholar which also showed reduced tumorigenesis, suggesting that CDK6/cyclin D3 complexes might play an important role in tumor inhibition. Supporting this hypothesis, biochemical analysis of the K5CDK6 epidermis showed preferential formation of CDK6/cyclin D3 complexes. Overall, we have established that the development of ras-induced skin tumors is diminished by overexpression of CDK6, which results in a surprisingly opposite effect to that observed in K5CDK4 mice. Thus, this model provides in vivo evidence that CDK4 and CDK6 play a similar role as mediator of keratinocyte proliferation but differ in the activated mechanisms, leading to an opposite effect in tumor development. As a result, we hypothesize that particular CDK/cyclin D complexes play different roles in epidermis homeostasis and tumor development. K5CDK6 transgenic mice were developed by cloning human-Cdk6 cDNA into the vector pBK5, which contains a 5.2-kb bovine keratin 5 regulatory sequence, the β-globin intron 2, and the 3′ SV40-polyadenylylation sequence. This construct was designated as pK5-CDK6. The transgene was excised from the plasmid vector by digestion with BssHII and microinjected into C57BL/6 × DBA2 hybrid embryos at the Animal Model Core, University of North Carolina School of Medicine. Several founders for K5CDK6 were obtained from the transgenic facility. Positive founders were genotyped by PCR using specific primers for the human transgene Cdk6 and β-globin intron sequence. Mice used in this study were generated by mating transgenic and wild-type animals for five to seven generations. Genomic DNA was extracted from mouse tail clips and used for PCR detection of the transgene. We used an upstream primer CTGACCAGCAGTACGAATG and a downstream primer GAGTCCAATCACGTCCAAG specific for the β-globin intron sequence or upstream CTGACCAGCAGTACGAATG and downstream TTTCTTTGCACCTTTCCAGG primers for human CDK6. With this process, we screened all of the transgenic mice lines. The DNA amplification renders a 450-bp PCR product with β-globin primers or an 850-bp band with human-CDK6 primers. PCR was performed by denaturation at 95°C for 1 minute, followed by 32 cycles of amplification as follows: denaturation at 95°C for 30 seconds, annealing at 60°C for 40 seconds, and extension at 72°C for 45 seconds, with a final extension at 72°C for 10 minutes. The dorsal sides of the mice were shaved. After they were sacrificed, the dorsal skins were treated with a depilatory agent for 1 minute and then washed. The epidermal tissue was scraped off with a razor blade, placed into homogenization buffer [50 mmol/L HEPES, pH 7.5, 150 mmol/L NaCl, 2.5 mmol/L EGTA, 1 mmol/L EDTA acid, 0.1% Tween 20, 1 mmol/L dithiothreitol, 0.1 mmol/L phenylmethylsulfonyl fluoride (PMSF), 0.2 U/ml of aprotinin, 10 mmol/L b-glycerophosphate, 0.1 mmol/L sodium vanadate, and 1 mmol/L NaF], and homogenized using a manual homogenizer. The epidermal homogenate was centrifuged at 14,000 × g at 4°C to collect the supernatant, which was used directly for Western blotting analysis or stored at −80°C. The protein concentration was measured with the Bio-Rad protein assay system (Bio-Rad Laboratories, Richmond, CA). Protein lysates (25 μg from each sample) were electrophoresed through 12% acrylamide gels and electrophoretically transferred onto nitrocellulose membranes. After being blocked with 5% nonfat powdered milk in Dulbecco PBS, the membranes were incubated with 1 μg/ml of specific antibodies. The following antibodies were used: polyclonal antibodies against cyclin D2 (M20), CDK4 (C22), CDK2 (M2), CDK6 (C21), pRb (M153), p107 (C18) (Santa Cruz Biotech, Santa Cruz, CA), and p53 (1C12) (Cell Signaling Tech Inc., Boston, MA), and monoclonal antibodies against cyclin D1 (DCS-6), CDK6 (DCS-83) (Santa Cruz Biotech). Secondary antibodies followed by enhanced chemiluminescence (ECL detection kit; GE Health Care, Piscataway, NJ) were used for immunoblotting detection. To study CDK/D-type cyclin complex formations and kinase activities, we used polyclonal antibodies against CDK4 (C-22) and CDK6 (C-21) (Santa Cruz Biotech) and a monoclonal antibody against cyclin D3 (Ab-1) (NeoMarkers, Fremont, CA) conjugated with protein A–sepharose beads (Thermo Scientific Inc., Rockford, IL) or Dynabeads Protein G (Invitrogen, Carlsbad, CA). Fresh protein lysates from epidermal tissue (500 μg) were immunoprecipitated for 1 hour at 4°C with constant rotation. After washing 3 times with extraction buffer, proteins that co-immunoprecipitated were analyzed by Western blot as described previously. Protein lysate (50 μg) was loaded as a control input. The immunoprecipitation was repeated 3 times using 250, 500, or 1000 mg of protein lysate with identical results. To study the kinase activities, 500 μg of fresh protein was extracted and immunoprecipitated in NP-40 lysis buffer (Tris [pH 7.5], 150 mmol/L NaCl, 0.5% NP-40, 50 mmol/L NaF, 1 mmol/L Na3VO4, 1 mmol/L DTT, and 1 mmol/L PMSF) with precoated antibodies against CDK2, CDK4, and CDK6 for 2 hours at 4°C. Beads were washed twice each with NP-40 buffer and once with kinase buffer (50 mmol/L HEPES [pH 7], 10 mmol/L MgCl2, 5 mmol/L MnCl2). Then, 30 μL of kinase buffer, 1 μg of pRb or histone H1 (Upstate Biotechnology Inc., Charlottesville, VA) substrate, 5 μCi of [γ-32P] ATP (6000 Ci/mmol), 1 mmol/L DTT, and 5 μmol/L ATP was added to the bead pellet and incubated for 30 minutes at 30°C. SDS sample buffer was added, and each sample was boiled for 3 minutes to stop the reaction and electrophoresed through polyacrylamide gels. Western blot and kinase assay bands were quantified using UN-SCANT IT gel software for Windows. Epithelial cell proliferation was measured by intraperitoneal injection of 60 μg/g of 5-bromodeoxyuridine (BrdU) 30 minutes before the mice were sacrificed by CO2 asphyxiation. BrdU incorporation was detected by immunohistochemical staining of paraffin-embedded skin sections with a mouse anti-BrdU (ab-2) monoclonal antibody (Calbiochem; EMB Biosciences, San Diego, CA), biotin-conjugated antimouse antibody (Vector Laboratories, Burlingame, CA), and avidin-biotin Vectastain Elite peroxidase kit (Vector Laboratories) with diaminobenzidine as a chromogen. Apoptotic cells were determined by terminal deoxynucleotidyl transferase–mediated dUTP nick-end labeling assays with the FragEL DNA Fragmentation Detection Kit, Colorimetric-TdT enzyme (Calbiochem; EMB Biosciences) following the manufacturer's instructions. Briefly, the terminal deoxynucleotidyl transferase (TdT enzyme) binds to the exposed 3-OH ends of a DNA fragment generated in apoptosis progression and catalyzes the addition of biotin-labeled and unlabeled deoxynucleotides. Biotinylated nucleotides were detected using a streptavidin–horseradish peroxidase conjugate. Counterstaining with methyl green allows for quantification of normal and apoptotic cells. The numbers of apoptotic cells in the tumors were determined in sections of 250 μm2 with a reticule grid. Apoptotic keratinocytes in interfollicular and follicular epidermis were quantified in 2-cm sections. To determine the incidence of follicular apoptosis, hair follicles carrying at least 1 apoptotic cell in the bulge area were counted as a positive hair follicle. In all cases, 12 fields were counted per section on a total of 10 paraffin-embedded sections, representing 5 mice per genotype. Two K5-CDK6 transgenic lines were used for the two-stage carcinogenesis protocol. Mouse experiments were performed with sibling animals to reduce the influence of the genetic background. Eight mice for each transgenic and wild-type group were used (K5CDK6[H], K5CDK6[L], wild-type[H], and wild-type[L]) for a total of 16 transgenic and 16 wild-type siblings. Three-week-old K5CDK6 and wild-type mice were initiated with the topical application of 200 nmol DMBA in 200 μL of acetone on the dorsal surface of the mice. Two weeks later, mice were dosed topically twice weekly with 4 μg of TPA in 200 μL of acetone for 25 weeks. Papilloma development was tracked weekly for 25 weeks. Papillomas were counted if 1 mm or larger. Multiplicity and incidence of tumor-bearing animals were compared between K5CDK6 and wild-type mice using Fisher's exact test. Statistical analysis was performed using GraphPad Prism 4 Software (GraphPad Software Inc., San Diego, CA). To study the role of CDK6 in squamous epithelial tissues, we generated transgenic mice overexpressing CDK6 driven by the}, number={1}, journal={AMERICAN JOURNAL OF PATHOLOGY}, author={Wang, Xian and Sistrunk, Christopher and Rodriguez-Puebla, Marcelo L.}, year={2011}, month={Jan}, pages={345–354} }
 @article{macias_marval_de siervi_conti_senderowicz_rodriguez-puebla_2008, title={CDK2 activation in mouse epidermis induces keratinocyte proliferation but does not affect skin tumor development}, volume={173}, ISSN={["1525-2191"]}, DOI={10.2353/ajpath.2008.071124}, abstractNote={It has been widely assumed that elevated CDK2 kinase activity plays a contributory role in tumorigenesis. We have previously shown that mice overexpressing CDK4 under control of the keratin 5 promoter (K5CDK4 mice) develop epidermal hyperplasia and increased susceptibility to squamous cell carcinomas. In this model, CDK4 overexpression results in increased CDK2 activity associated with the noncatalytic function of CDK4, sequestration of p21(Cip1) and p27(Kip1). Furthermore, we have shown that ablation of Cdk2 reduces Ras-Cdk4 tumorigenesis, suggesting that increased CDK2 activity plays an important role in Ras-mediated tumorigenesis. To investigate this hypothesis, we generated two transgenic mouse models of elevated CDK2 kinase activity, K5Cdk2 and K5Cdk4(D158N) mice. The D158N mutation blocks CDK4 kinase activity without interfering with its binding capability. CDK2 activation via overexpression of CDK4(D158N), but not of CDK2, resulted in epidermal hyperplasia. We observed elevated levels of p21(Cip1) in K5Cdk2, but not in K5Cdk4(D158N), epidermis, suggesting that CDK2 overexpression elicits a p21(Cip1) response to maintain keratinocyte homeostasis. Surprisingly, we found that neither CDK2 overexpression nor the indirect activation of CDK2 enhanced skin tumor development. Thus, although the indirect activation of CDK2 is sufficient to induce keratinocyte hyperproliferation, activation of CDK2 alone does not induce malignant progression in Ras-mediated tumorigenesis.}, number={2}, journal={AMERICAN JOURNAL OF PATHOLOGY}, author={Macias, Everardo and Marval, Paula L. Miliani and De Siervi, Adriana and Conti, Claudio J. and Senderowicz, Adrian M. and Rodriguez-Puebla, Marcelo L.}, year={2008}, month={Aug}, pages={526–535} }
 @article{rojas_benavides_blando_perez_cardenas_richie_knudsen_johnson_senderowicz_rodriguez-puebla_et al._2009, title={Enhanced Skin Carcinogenesis and Lack of Thymus Hyperplasia in Transgenic Mice Expressing Human Cyclin D1b (CCND1b)}, volume={48}, ISSN={["1098-2744"]}, DOI={10.1002/mc.20489}, abstractNote={AbstractCyclin D1b is an alternative transcript of the cyclin D1 gene (CCND1) expressed in human tumors. Its abundance is regulated by a single base pair polymorphism at the exon 4/intron 4 boundary (nucleotide 870). Epidemiological studies have shown a correlation between the presence of the G870A allele (that favors the splicing for cyclin D1b) with increased risk and less favorable outcome in several forms of cancer. More recently, it has been shown that, unlike cyclin D1a, the alternative transcript D1b by itself has the capacity to transform fibroblasts in vitro. In order to study the oncogenic potential of cyclin D1b, we developed transgenic mice expressing human cyclin D1b under the control of the bovine K5 promoter (K5D1b mice). Seven founders were obtained and none of them presented any significant phenotype or developed spontaneous tumors. Interestingly, K5D1b mice do not develop the fatal thymic hyperplasia, which is characteristic of the cyclin D1a transgenic mice (K5D1a). Susceptibility to skin carcinogenesis was tested in K5D1b mice using two‐stage carcinogenesis protocols. In two independent experiments, K5D1b mice developed higher papilloma multiplicity as compared with wild‐type littermates. However, when K5D1b mice were crossed with cyclin D1KO mice, the expression of cyclin D1b was unable to rescue the carcinogenesis‐resistant phenotype of the cyclin D1 KO mice. To further explore the role of cyclin D1b in mouse models of carcinogenesis we carried out in silico analysis and in vitro experiments to evaluate the existence of a mouse homologous of the human cyclin D1b transcript. We were unable to find any evidence of an alternatively spliced transcript in mouse Ccnd1. These results show that human cyclin D1b has different biological functions than cyclin D1a and confirm its oncogenic properties. © 2008 Wiley‐Liss, Inc.}, number={6}, journal={MOLECULAR CARCINOGENESIS}, author={Rojas, Paola and Benavides, Fernando and Blando, Jorge and Perez, Carlos and Cardenas, Kim and Richie, Ellen and Knudsen, Erik S. and Johnson, David G. and Senderowicz, Adrian M. and Rodriguez-Puebla, Marcelo L. and et al.}, year={2009}, month={Jun}, pages={508–516} }
 @article{macias_marva_senderowicz_cullen_rodriguez-puebla_2008, title={Expression of CDK4 or CDK2 in mouse oral cavity is retained in adult pituitary with distinct effects on tumorigenesis}, volume={68}, ISSN={["0008-5472"]}, DOI={10.1158/0008-5472.CAN-07-2461}, abstractNote={Abstract
               The keratin 5 (K5) promoter drives transgenic expression to the basal cell layer of stratified epithelia. Surprisingly, analysis of K5CDK4 and K5CDK2 transgenic mouse embryos showed CDK4 and CDK2 expression not only in the expected tissues, but also in the adenohypophysis. This organ is derived from an upwards growth of the primitive oropharnyx, a K5-expressing tissue. We show that transgenic expression of CDKs in the embryonic oral ectoderm is specifically retained in undifferentiated cells from the pars intermedia of the adenohypophysis. Interestingly, we found that K5CDK4 mice show a decreased number of pituitary stem cells, even though CDK4 is not expressed in the stem cells but in transit-amplifying (TA)–like cells. Interestingly, CDK4-expressing cells, but not CDK2-expressing cells, strongly synergize with lack of p27Kip1 to generate pituitary carcinomas that appear with shortened latency and are drastically more aggressive than those arising in p27−/− mice. Thus, we show that deregulation of CDK expression in the primitive oral epithelium plays a unique function, providing a selective advantage that gives rise to transgene-positive TA-like pituitary cells. Furthermore, retention of CDK4 in these TA-like pituitary cells synergizes with loss of p27Kip1 to induce pituitary adenocarcinomas. This model suggests that forced expression of CDK4 sensitizes cells and synergizes with a second change resulting in tumor development. [Cancer Res 2008;68(1):162–71]}, number={1}, journal={CANCER RESEARCH}, author={Macias, Everardo and Marva, Paula L. Miliani and Senderowicz, Adrian and Cullen, John and Rodriguez-Puebla, Marcelo L.}, year={2008}, month={Jan}, pages={162–171} }
 @article{patil_lee_macias_lam_xu_jones_ho_rodriguez-puebla_chen_2009, title={Robe of Cyclin D1 as a Mediator of c-Met- and beta-Catenin-Induced Hepatocarcinogenesis}, volume={69}, ISSN={["1538-7445"]}, DOI={10.1158/0008-5472.CAN-08-2514}, abstractNote={Abstract
               Activation of c-Met signaling and β-catenin mutations are frequent genetic events observed in liver cancer development. Recently, we demonstrated that activated β-catenin can cooperate with c-Met to induce liver cancer formation in a mouse model. Cyclin D1 (CCND1) is an important cell cycle regulator that is considered to be a downstream target of β-catenin. To determine the importance of CCND1 as a mediator of c-Met– and β-catenin–induced hepatocarcinogenesis, we investigated the genetic interactions between CCND1, β-catenin, and c-Met in liver cancer development using mouse models. We coexpressed CCND1 with c-Met in mice and found CCND1 to cooperate with c-Met to promote liver cancer formation. Tumors induced by CCND1/c-Met had a longer latency period, formed at a lower frequency, and seemed to be more benign compared with those induced by β-catenin/c-Met. In addition, when activated β-catenin and c-Met were coinjected into CCND1-null mice, liver tumors developed despite the absence of CCND1. Intriguingly, we observed a moderate accelerated tumor growth and increased tumor malignancy in these CCND1-null mice. Molecular analysis showed an up-regulation of cyclin D2 (CCND2) expression in CCND1-null tumor samples, indicating that CCND2 may replace CCND1 in hepatic tumorigenesis. Together, our results suggest that CCND1 functions as a mediator of β-catenin during HCC pathogenesis, although other molecules may be required to fully propagate β-catenin signaling. Moreover, our data suggest that CCND1 expression is not essential for liver tumor development induced by c-Met and β-catenin. [Cancer Res 2009;69(1):253–61]}, number={1}, journal={CANCER RESEARCH}, author={Patil, Mohini A. and Lee, Susie A. and Macias, Everardo and Lam, Ernest T. and Xu, Chuanrui and Jones, Kirk D. and Ho, Coral and Rodriguez-Puebla, Marcelo and Chen, Xin}, year={2009}, month={Jan}, pages={253–261} }
 @article{macias_kim_marval_klein-szanto_rodriguez-puebla_2007, title={Cdk2 deficiency decreases ras/CDK4-dependent malignant progression, but not myc-induced tumorigenesis}, volume={67}, ISSN={["1538-7445"]}, DOI={10.1158/0008-5472.CAN-07-2119}, abstractNote={Abstract
               We have previously shown that forced expression of CDK4 in mouse skin (K5CDK4 mice) results in increased susceptibility to squamous cell carcinoma (SCC) development in a chemical carcinogenesis protocol. This protocol induces skin papilloma development, causing a selection of cells bearing activating Ha-ras mutations. We have also shown that myc-induced epidermal proliferation and oral tumorigenesis (K5Myc mice) depends on CDK4 expression. Biochemical analysis of K5CDK4 and K5Myc epidermis as well as skin tumors showed that keratinocyte proliferation is mediated by CDK4 sequestration of p27Kip1 and p21Cip1, and activation of CDK2. Here, we studied the role of CDK2 in epithelial tumorigenesis. In normal skin, loss of CDK2 rescues CDK4-induced, but not myc-induced epidermal hyperproliferation. Ablation of CDK2 in K5CDK4 mice results in decreased incidences and multiplicity of skin tumors as well as malignant progression to SCC. Histopathologic analysis showed that K5CDK4 tumors are drastically more aggressive than K5CDK4/CDK2−/− tumors. On the other hand, we show that CDK2 is dispensable for myc-induced tumorigenesis. In contrast to our previous report of K5Myc/CDK4−/−, K5Myc/CDK2−/− mice developed oral tumors with the same frequency as K5Myc mice. Overall, we have established that ras-induced tumors are more susceptible to CDK2 ablation than myc-induced tumors, suggesting that the efficacy of targeting CDK2 in tumor development and malignant progression is dependent on the oncogenic pathway involved. [Cancer Res 2007;67(20):9713–20]}, number={20}, journal={CANCER RESEARCH}, author={Macias, Everardo and Kim, Yongbaek and Marval, Paula L. Miliani and Klein-Szanto, Andres and Rodriguez-Puebla, Marcelo L.}, year={2007}, month={Oct}, pages={9713–9720} }
 @article{rojas_cadenas_lin_benavides_conti_rodriguez-puebla_2007, title={Cyclin D2 and cyclin D3 play opposite roles in mouse skin carcinogenesis}, volume={26}, DOI={10.1038/sj.onc.1209970}, abstractNote={D-type cyclins are components of the cell-cycle engine that link cell signaling pathways and passage throughout G1 phase. We previously described the effects of overexpression cyclin D1, D2 or D3 in mouse epidermis and tumor development. We now asked whether cyclin D2 and/or cyclin D3 play a relevant role in ras-dependent tumorigenesis. Here, we described the effect of cyclin D3 and cyclin D2 overexpression in mouse skin tumor development. Notably, overexpression of cyclin D3 results in reduced tumor development and malignant progression to squamous cell carcinomas (SCC). Biochemical analysis of keratinocytes shows that overexpression of cyclin D3 results in strong reduction of cyclin D2 and its associated kinase activity. Furthermore, we found that reinstatement of cyclin D2 level in the cyclin D3/cyclin D2 bigenic mice results in a complete reversion of the inhibitory action of cyclin D3. Supporting these results, ablation of cyclin D2 results in reduced tumorigenesis and malignant progression. On the other hand, overexpression of cyclin D2 results in an increased number of papillomas and malignant progression. We conclude that cyclin D3 and cyclin D2 play opposite roles in mouse skin tumor development and that the suppressive activity of cyclin D3 is associated with cyclin D2 downregulation.}, number={12}, journal={Oncogene}, author={Rojas, P. and Cadenas, M. B. and Lin, P. C. and Benavides, F. and Conti, C. J. and Rodriguez-Puebla, M. L.}, year={2007}, pages={1723–1730} }
 @article{chien_rabin_macias_marval_garrison_orthel_rodriguez-puebla_fero_2006, title={Genetic mosaics reveal both cell-autonomous and cell-nonautonomous function of murine p27(Kip1)}, volume={103}, ISSN={["0027-8424"]}, DOI={10.1073/pnas.0509514103}, abstractNote={
            Loss of the cyclin-dependent kinase inhibitor p27
            Kip1
            leads to an overall increase in animal growth, pituitary tumors, and hyperplasia of hematopoietic organs, yet it is unknown whether all cells function autonomously in response to p27
            Kip1
            activity or whether certain cells take cues from their neighbors. In addition, there is currently no genetic evidence that tumor suppression by p27
            Kip1
            is cell-autonomous because biallelic gene inactivation is absent from tumors arising in p27
            Kip1
            hemizygous mice. We have addressed these questions with tissue-specific targeted mouse mutants and radiation chimeras. Our results indicate that the suppression of pars intermedia pituitary tumors by p27
            Kip1
            is cell-autonomous and does not contribute to overgrowth or infertility phenotypes. In contrast, suppression of spleen growth and hematopoietic progenitor expansion is a consequence of p27
            Kip1
            function external to the hematopoietic compartment. Likewise, p27
            Kip1
            suppresses thymocyte hyperplasia through a cell-nonautonomous mechanism. The interaction of p27
            Kip1
            loss with epithelial cell-specific cyclin-dependent kinase 4 overexpression identifies the thymic epithelium as a relevant site of p27
            Kip1
            activity for the regulation of thymus growth.
          }, number={11}, journal={PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA}, author={Chien, WM and Rabin, S and Macias, E and Marval, PLM and Garrison, K and Orthel, J and Rodriguez-Puebla, M and Fero, ML}, year={2006}, month={Mar}, pages={4122–4127} }
 @article{marval_macias_conti_rodriguez-puebla_2004, title={Enhanced malignant tumorigenesis in Cdk4 transgenic mice}, volume={23}, ISSN={["1476-5594"]}, DOI={10.1038/sj.onc.1207309}, abstractNote={In a previous study, we reported that overexpression of cyclin-dependent kinase-4 (CDK4) in mouse epidermis results in epidermal hyperplasia, hypertrophy and severe dermal fibrosis. In this study, we have investigated the susceptibility to skin tumor formation by forced expression of CDK4. Skin tumors from transgenic mice showed a dramatic increase in the rate of malignant progression to squamous cell carcinomas (SCC) in an initiation-promotion protocol. Histopathological analysis of papillomas from transgenic mice showed an elevated number of premalignant lesions characterized by dysplasia and marked atypia. Interestingly, transgenic mice also developed tumors in initiated but not promoted skin, demonstrating that CDK4 replaced the action of tumor promoters. These results suggest that expression of cyclin D1 upon ras activation synergizes with CDK4 overexpression. However, cyclin D1 transgenic mice and double transgenic mice for cyclin D1 and CDK4 did not show increased malignant progression in comparison to CDK4 transgenic mice. Biochemical analysis of tumors showed that CDK4 sequesters the CDK2 inhibitors p27Kip1 and p21Cip1, suggesting that indirect activation of CDK2 plays an important role in tumor development. These results indicate that, contrary to the general assumption, the catalytic subunit, CDK4, has higher oncogenic activity than cyclin D1, revealing a potential use of CDK4 as therapeutic target.}, number={10}, journal={ONCOGENE}, author={Marval, PLM and Macias, E and Conti, CJ and Rodriguez-Puebla, ML}, year={2004}, month={Mar}, pages={1863–1873} }
 @article{rodriguez-puebla_marval_lacava_moons_kiyokawa_conti_2002, title={cdk4 deficiency inhibits skin tumor development but does not affect normal keratinocyte proliferation}, volume={161}, ISSN={["1525-2191"]}, DOI={10.1016/S0002-9440(10)64196-X}, abstractNote={Most human tumors have mutations that result in deregulation of the cdk4/cyclin-Ink4-Rb pathway. Overexpression of D-type cyclins or cdk4 and inactivation of Ink4 inhibitors are common in human tumors. Conversely, lack of cyclin D1 expression results in significant reduction in mouse skin and mammary tumor development. However, complete elimination of tumor development was not observed in these models, suggesting that other cyclin/cdk complexes play an important role in tumorigenesis. Here we described the effects of cdk4 deficiency on mouse skin proliferation and tumor development. Cdk4 deficiency resulted in a 98% reduction in the number of tumors generated through the two-stage carcinogenesis model. The absence of cdk4 did not affect normal keratinocyte proliferation and both wild-type and cdk4 knockout epidermis are equally affected after topical treatment with the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA), resulting in epidermal hyperplasia. In similar fashion, cdk4 knockout keratinocytes proliferated well in an in vivo model of wound-induced proliferation. Biochemical studies in mouse epidermis showed that cdk6 activity increased twofold in cdk4-deficient mice compared to wild-type siblings. These results suggest that therapeutic approaches to inhibit cdk4 activity could provide a target to inhibit tumor development with minimal or no effect in normal tissue. Most human tumors have mutations that result in deregulation of the cdk4/cyclin-Ink4-Rb pathway. Overexpression of D-type cyclins or cdk4 and inactivation of Ink4 inhibitors are common in human tumors. Conversely, lack of cyclin D1 expression results in significant reduction in mouse skin and mammary tumor development. However, complete elimination of tumor development was not observed in these models, suggesting that other cyclin/cdk complexes play an important role in tumorigenesis. Here we described the effects of cdk4 deficiency on mouse skin proliferation and tumor development. Cdk4 deficiency resulted in a 98% reduction in the number of tumors generated through the two-stage carcinogenesis model. The absence of cdk4 did not affect normal keratinocyte proliferation and both wild-type and cdk4 knockout epidermis are equally affected after topical treatment with the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA), resulting in epidermal hyperplasia. In similar fashion, cdk4 knockout keratinocytes proliferated well in an in vivo model of wound-induced proliferation. Biochemical studies in mouse epidermis showed that cdk6 activity increased twofold in cdk4-deficient mice compared to wild-type siblings. These results suggest that therapeutic approaches to inhibit cdk4 activity could provide a target to inhibit tumor development with minimal or no effect in normal tissue. The cyclin-dependent kinases (cdks) are a family of key cell-cycle regulators that function by association with cyclins, the regulatory subunits, at specific points of the cell cycle to phosphorylate various proteins during cell cycle progression.1He J Allen JR Collins VP Allalunis-Turner MJ Godbout R Day RS James CD CDK4 amplification is an alternative mechanism to p16 homozygous deletion in glioma cell lines.Cancer Res. 1994; 54: 5804-5807PubMed Google Scholar, 2Ichimura K Schmidt EE Goike HM Collins VP Human glioblastomas with no alterations of the CDKN2A and CDK4 genes have frequent mutations of the retinoblastoma gene.Oncogene. 1996; 13: 1065-1072PubMed Google Scholar cdk4 and cdk6 form complexes with D-type cyclins (cyclin D1, D2, and D3) during the G1 phase of the cell cycle.3Sherr CJ Mammalian G1 cyclins.Cell. 1993; 73: 1059-1065Abstract Full Text PDF PubMed Scopus (1996) Google Scholar, 4Sherr CJ D-type cyclins.Trends Biochem Sci. 1995; 20: 187-190Abstract Full Text PDF PubMed Scopus (896) Google Scholar A key substrate for G1 cyclin/cdk complexes is the retinoblastoma protein, pRb. Phosphorylation of pRb, a tumor suppressor gene product, has been attributed to cyclin/cdk complexes and implicated in the regulation of proliferation in keratinocytes and other cell types.5Munger K Pieternpol JA Pittelkow MR Holt JT Moses HL Transforming growth factor B1 regulation of c-myc expression, pRb phosphorylation, and cell cycle progression in keratinocytes.Cell Growth Differ. 1992; 3: 291-298PubMed Google Scholar, 6Nevins JR E2F: a link between the Rb tumor suppressor protein and viral oncoproteins.Science. 1992; 258: 424-429Crossref PubMed Scopus (1366) Google Scholar cdk4,6/D-type cyclins complex formation is induced during the middle of the G1 phase and performs the first step of pRb phosphorylation. Then cyclin E binds and activates cdk2 at the G1/S phase transition and the second step of pRb phosphorylation is carried out on a different pRb motif.7Kitagawa MH Higasashi HK Jung I Suzuki-Takahashi M Ikeda K Tamai I Kato K Segawa E Yoshida S Nishimura S Taya Y The consensus motif for phosphorylation by cyclin D1-CDK4 is different from that for phosphorylation by cyclin A/E-CDK2.EMBO J. 1996; 15: 7060-7069Crossref PubMed Scopus (538) Google Scholar Thus, phosphorylation of pRb blocks its ability to suppress the activity of S-phase promoting transcription factors such as E2F.5Munger K Pieternpol JA Pittelkow MR Holt JT Moses HL Transforming growth factor B1 regulation of c-myc expression, pRb phosphorylation, and cell cycle progression in keratinocytes.Cell Growth Differ. 1992; 3: 291-298PubMed Google Scholar, 6Nevins JR E2F: a link between the Rb tumor suppressor protein and viral oncoproteins.Science. 1992; 258: 424-429Crossref PubMed Scopus (1366) Google Scholar Phosphorylation of the C-terminal region of pRb by cdk4,6 triggers sequential intramolecular interactions that progressively block pRb functions as cells move through G1.8Zhang HS Gavin M Dahiya A Postigo AA Ma D Luo RX Harbour JW Dean DC Exit from G1 and S phase of the cell cycle is regulated by repressor complexes containing HDAC-Rb-hSWI/SNF and Rb-hSWI/SNF.Cell. 2000; 101: 79-89Abstract Full Text Full Text PDF PubMed Scopus (543) Google Scholar, 9Harbour JW Luo RX Dei Santi A Postigo AA Dean DC Cdk phosphorylation triggers sequential intramolecular interactions that progressively block Rb functions as cells move through G1.Cell. 1999; 98: 859-869Abstract Full Text Full Text PDF PubMed Scopus (833) Google Scholar The first phosphorylation facilitates a second interaction that leads to phosphorylation by cdk2 and further S phase progression.9Harbour JW Luo RX Dei Santi A Postigo AA Dean DC Cdk phosphorylation triggers sequential intramolecular interactions that progressively block Rb functions as cells move through G1.Cell. 1999; 98: 859-869Abstract Full Text Full Text PDF PubMed Scopus (833) Google Scholar cdk4-Deficient mice were generated and showed normal development, although the mutant mice show defects associated with growth retardation such as testicular atrophy, insulin-deficient diabetes and perturbed corpus luteum formation.10Rane SG Dubus P Mettus RV Galbreath EJ Boden G Premkumar Reddy E Barbacid M Loss of Cdk4 expression causes insulin-deficient diabetes and Cdk4 activation results in B-islet cell hyperplasia.Nat Genet. 1999; 22: 44-52Crossref PubMed Scopus (614) Google Scholar, 11Tsutsui T Hesabi B Moons DS Pandolfi P Hansel K Koff A Kiyokawa H Targeted disruption of CDK4 delays cell cycle entry with enhanced p27Kip1 activity.Mol Cell Biol. 1999; 19: 7011-7019Crossref PubMed Scopus (360) Google Scholar Consistent with this observation, Rane et al have shown that cdk4 activation in a knockin mouse resulted in β-islet cell hyperplasia.10Rane SG Dubus P Mettus RV Galbreath EJ Boden G Premkumar Reddy E Barbacid M Loss of Cdk4 expression causes insulin-deficient diabetes and Cdk4 activation results in B-islet cell hyperplasia.Nat Genet. 1999; 22: 44-52Crossref PubMed Scopus (614) Google Scholar In addition, we reported that overexpression of cdk4 is associated with epidermal hyperplasia and hypertrophy in basal cell layers of the epidermis of cdk4 transgenic mice (K5-cdk4).12Miliani de Marval P Gimenez-Conti I LaCava M Martinez L Conti C Rodriguez-Puebla M Transgenic expression of CDK4 results in epidermal hyperplasia and severe dermal fibrosis.Am J Pathol. 2001; 159: 369-379Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar Consistent with those results, overexpression of cdk4 in mouse astrocytes results in an increased cell size as well as hyperploidy.13Holland EC Hively WP Gallo V Varmus HE Modeling mutations in the G1 arrest pathway in human gliomas: overexpression of CDK4 but not loss of INK4a-ARF induces hyperploidy in cultured mouse astrocytes.Genes Dev. 1998; 12: 3644-3649Crossref PubMed Scopus (101) Google Scholar Amplification or translocation of cdk4 or cdk6 has been demonstrated in several sarcomas and leukemias.14Corcoran M Mould S Orchard J Ibbotson R Chapman R Boright A Platt C Tsui L Scherer S Oscier D Dysregulation of cyclin dependent kinase 6 expression in splenic marginal zone lymphoma through chromosome 7q translocations.Oncogene. 1999; 18: 675-684Crossref Scopus (120) Google Scholar, 15Khatib Z Matsushime H Valentine M Coamplification of the Cdk4 gene with MDM2 and GL1 in human sarcomas.Cancer Res. 1993; 53: 5535-5541PubMed Google Scholar In addition, cdk4 amplification and overexpression have been implicated in glioma development, in this case, mutually exclusive mutations of p16INK4a or cdk4 were observed.1He J Allen JR Collins VP Allalunis-Turner MJ Godbout R Day RS James CD CDK4 amplification is an alternative mechanism to p16 homozygous deletion in glioma cell lines.Cancer Res. 1994; 54: 5804-5807PubMed Google Scholar, 2Ichimura K Schmidt EE Goike HM Collins VP Human glioblastomas with no alterations of the CDKN2A and CDK4 genes have frequent mutations of the retinoblastoma gene.Oncogene. 1996; 13: 1065-1072PubMed Google Scholar, 13Holland EC Hively WP Gallo V Varmus HE Modeling mutations in the G1 arrest pathway in human gliomas: overexpression of CDK4 but not loss of INK4a-ARF induces hyperploidy in cultured mouse astrocytes.Genes Dev. 1998; 12: 3644-3649Crossref PubMed Scopus (101) Google Scholar Also, a mutation in cdk4 has been described in patients with familial melanoma16Ohta M Nagai H Shimizu M Rasio D Berd D Mastrangelo M Singh AD Shields JA Shields CJ Croce CM Rarity of somatic and germline mutations of the cyclin-dependent kinase 4 inhibitor gene, CDK4I, in melanoma.Cancer Res. 1994; 54: 5269-5272PubMed Google Scholar, 17Soufir N Avril MF Chompret A Demenais F Bombled J Spatz A Stoppa-Luonnet D Bernard J Bressac-de Paillerets R Prevalence of p16 and CDK4 germline mutations in 48 melanoma-prone families in France.Hum Mol Genet. 1998; 7: 209-216Crossref PubMed Scopus (351) Google Scholar, 18Wölfel T Hauer M Schneider J Serrano M Wölfel C Klehmann-Hieb E De Plaen E Hankeln T Meyer zum Büschenfelde KH Beach D A p16INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma.Science. 1995; 269: 1281-1284Crossref PubMed Scopus (1013) Google Scholar and it has recently been reported that cdk4 knockin mice harboring this point mutation (R24C) are highly susceptible to melanoma development after chemical treatment.19Sotillo R Garcia J Ortega S Martin J Dubus P Barbacid M Malumbres M Invasive melanoma in Cdk4-targeted mice.Proc Natl Acad Sci. 2001; 98: 13312-13317Crossref PubMed Scopus (148) Google Scholar In a previous report, we have shown that cyclin D1-null mice developed a reduced number of skin tumors.20Robles A Rodriguez-Puebla M Glick A Trempus C Hansen L Sicinski P Tennant R Weinberg R Yuspa S Conti C Reduced skin tumor development in cyclin D1 deficient mice highlights the oncogenic ras pathway in vivo.Genes Dev. 1998; 12: 2469-2474Crossref PubMed Scopus (205) Google Scholar To investigate the contribution of cdk4 to tumor development, we have studied the effect of lack of cdk4 in mouse skin carcinogenesis and in normal keratinocyte proliferation. Here, we reported that in vivo proliferation after TPA treatment or wounding on the back of cdk4-knockout mice results in a normal proliferative response. Mechanistic studies in cdk4-deficient epidermis showed an increase in the activity of cdk6. On the other hand, after a specific carcinogenic treatment, tumor development was greatly reduced in cdk4-null and heterozygous mice, which showed a 98% and 36% reduction, respectively, in the number of squamous tumors compared with normal siblings. Thus, these results provide evidence that the putative mechanisms that compensated for the absence of cdk4 in normal skin does not allow tumor development. Thus, inhibition of cdk4 activity could provide a therapeutic target for ras-dependent tumor development. cdk4-Null mice were developed by gene targeting disruption in C57BL/6 background by Tsutsui et al11Tsutsui T Hesabi B Moons DS Pandolfi P Hansel K Koff A Kiyokawa H Targeted disruption of CDK4 delays cell cycle entry with enhanced p27Kip1 activity.Mol Cell Biol. 1999; 19: 7011-7019Crossref PubMed Scopus (360) Google Scholar cdk4 +/− mice were backcrossed into the SSIN (inbred SENCAR) background. Genomic DNA was extracted from mouse-tail clips and used for PCR genotyping as was described previously.11Tsutsui T Hesabi B Moons DS Pandolfi P Hansel K Koff A Kiyokawa H Targeted disruption of CDK4 delays cell cycle entry with enhanced p27Kip1 activity.Mol Cell Biol. 1999; 19: 7011-7019Crossref PubMed Scopus (360) Google Scholar Seven-week-old genetically matched cdk4−/−, cdk4+/− and cdk4+/+ mice were initiated with a single dose of 200 nmol of 7,12-dimethylbenz[a]anthracene (DMBA) (Sigma Chemical Co., St. Louis, MO) on shaved dorsal skin. Two weeks later, tumor growth was promoted by treating with 2 μg of 12-O-tetradecanoylphorbol-13-acetate (TPA) (Sigma Chemical Co.) twice a week for 20 weeks. Mice were observed twice weekly. Papillomas appeared after 6 to 7 weeks of continuous TPA treatment and were counted weekly for 20 weeks. To induce epidermal hyperplasia, shaved dorsal skins were treated twice a week with 2 μg of TPA for 3 weeks. Mice were sacrificed 24 hours after the last application and injected with BrdU as described below. Mouse dorsal skins were treated with a depilatory agent for 1 minute and then washed. After the mice were sacrificed, the dorsal skin was removed, and the epidermal tissue was scraped off with a razor blade, placed into NP40 lysis buffer (50 mmol/L Tris, pH 7.5; 150 mmol/L NaCl; 50 mmol/L NaF; 0.5% NP40; 1 mmol/L Na3VO4; 1 mmol/L DTT; 1 mmol/L PMSF). The homogenate was incubated on ice for 15 minutes, homogenization was achieved with a manual homogenizer and centrifuged twice at 10,000 × g for 10 minutes at 4°C to collect the supernatant, which was used directly for the kinase assays. The protein concentration in each skin lysate was measured with the Bio-Rad protein assay system (Bio-Rad Laboratories, Richmond, CA). Three hundred micrograms of protein lysate was immunoprecipitated with antibodies against cdk4, cdk6, or cdk2. 40 μl of precoated antibody beads (Life Technologies Inc., Rockville, MD) were incubated with the lysate for 2 hours at 4°C. The beads were washed twice with NP40 lysis buffer and twice with kinase buffer (50 mmol/L HEPES, pH 7; 10 mmol/L MgCl2; 5 mmol/L MnCl2, 1 mmol/L DTT, 200 μmol/L ATP). After the last wash, 25 μl of kinase buffer and 5 μl of kinase mixture [1 μg of pRb substrate (Santa Cruz Biotechnology, Inc. Santa Cruz, CA); 10 μCi γ-32P ATP (6000 Ci/mmol) (NEN, Boston, MA); 2.5 μl kinase assay buffer] was added to each tube. The tubes were incubated for 30 minutes at 30°C in a water bath. The reaction was stopped by adding 30 μl of sodium dodecyl sulfate sample buffer (Sigma Chemical Co.) to each sample, followed by boiling for 5 minutes and electrophoresed through 10% acrylamide gel. The following antibodies were used: polyclonal antibodies cdk4 (C22), cdk6 (C21), and cdk2 (M2) (Santa Cruz Biotechnology, Inc.). Bio-image analysis was used to quantitate the expression levels of those proteins and for the kinase assay. Ha-ras mutation was determined by restriction fragment length polymorphism (RFLP) analysis as we previously described.21Rodriguez-Puebla M LaCava M Bolontrade M Rusell J Conti C Increased expression of mutated Ha-ras during premalignant progression in SENCAR mouse skin.Mol Carcinog. 1999; 26: 150-156Crossref PubMed Scopus (19) Google Scholar Briefly, the Ha-ras sequence leading codon 61 was amplified by reverse transcription polymerase chain reaction and the amplification product digested with XbaI restriction enzyme (Promega Corp., Madison, WI). The mutated but not the wild-type Ha-ras allele generated two fragments when subjected to XbaI RFLP. Epithelial cell proliferation was measured by intraperitoneal injection of BrdU (60 mg/g body weight) 30 minutes before the mice were sacrificed. BrdU incorporation was detected by immunohistochemical staining of paraffin-embedded sections with mouse anti-BrdU monoclonal antibody (Becton Dickinson Immunocytometry System; Becton Dickinson, San Jose, CA). The reaction was visualized with a biotin-conjugated anti-mouse antibody (Vector Laboratories, Inc., Burlingame, CA) and an avidin-biotin-peroxidase kit (Vectastain Elite, Vector Laboratories, Inc.) with diaminobenzidine as chromogen. The number of BrdU-positive cells and total cells were determined per 200 μm of interfollicular epithelia in each section. Ten to 14 sections of 200 μm were counted per group. Mice were anesthetized following institutionally approved protocols. The backs of the mice were shaved and sterilized with alcohol, followed by 1% iodine solution. A circular full thickness wound, approximately 8 mm in diameter, was made using a dermal biopsy punch, down to, but not through, the muscle fascia. Three mice of each genotype (cdk4−/− and cdk4+/+) were sacrificed at 3 days after wounding. The healing process was analyzed in paraffin-embedded sections, which were stained with hematoxylin and eosin (H&E) to examine general tissue. Unless otherwise stated, biochemical experiments were performed three times. Results are representative of at least three experiments giving similar results. Other laboratories and our own have shown that lack of cyclin D1 results in reduced tumor development.20Robles A Rodriguez-Puebla M Glick A Trempus C Hansen L Sicinski P Tennant R Weinberg R Yuspa S Conti C Reduced skin tumor development in cyclin D1 deficient mice highlights the oncogenic ras pathway in vivo.Genes Dev. 1998; 12: 2469-2474Crossref PubMed Scopus (205) Google Scholar, 22Yu Q Geng Y Sicinski P Specific protection against breast cancers by cyclin D1 ablation.Nature. 2001; 411: 1017-1021Crossref PubMed Scopus (834) Google Scholar However, in mouse skin loss of cyclin D1 expression results in the development of a few papillomas that still harbor Ha-ras mutation. Thus, we hypothesized that complexes others than cyclin D1/cdk4,6 participated in skin tumor development. To determine whether deficiency of cdk4 can result in a reduced number or complete elimination of papilloma development, we used the two-stage carcinogenic protocol. cdk4−/−, cdk4+/−, and cdk4+/+ mice were topically treated with a subcarcinogenic dose of genotoxic DMBA followed by topical application of the tumor promoter TPA. This treatment resulted in papilloma development, which are exophytic, hyperplastic, and benign lesions originating from a single initiated cell. Tumor appearance on the backs of cdk4+/+ mice begun at 7 weeks of promotion whereas it was delayed by 1 week in cdk4−/− and cdk4+/− (appear at 8 weeks) compared with wild-type sibling mice (Figure 1A). The percentage of mice with papillomas (incidence) at the end of the experiment (20 weeks) was 92% (13/14) in cdk4+/+, 85% (23/27) in cdk4+/− (15% reduction) and 23% (3/13) in cdk4-null mice (77% reduction). The average number of papillomas per mouse (multiplicity) in cdk4-deficient mice was 2% of cdk4 +/+ mice and 4% of cdk4+/− mice. In addition, a gene dosage dependent effect was observed between cdk4+/− and cdk4+/+, where cdk4+/− mice showed a reduced number of tumors (64%) compared with cdk4+/+ mice (normal sibling) (Figure 1A). Only three cdk4-deficient mice developed skin tumors (one papilloma each). The size of the tumors was checked at 15 weeks of promotion and the papillomas of cdk4 null mice showed a reduced size (1 mm3) compared with wild-type mice (5 mm3). cdk4-Deficient papillomas are well-differentiated tumors without foci of dysplasia presenting a histopathology indistinguishable from that of the cdk4+/− and cdk4+/+ (Figure 1B). Initiation by the carcinogen DMBA induces a specific point mutation at codon 61 of the Ha-ras gene.23Balmain A Pragnell I Mouse skin carcinomas induced in vivo by chemical carcinogens have a transforming Harvey-ras oncogene.Nature. 1983; 303: 72-74Crossref PubMed Scopus (335) Google Scholar, 24Bizub D Wood A Skalka A Mutagenesis of the Ha-ras oncogene in mouse skin tumors induced by polycyclic aromatic hydrocarbons.Proc Natl Acad Sci USA. 1986; 83: 6048-6052Crossref PubMed Scopus (219) Google Scholar, 25Roop D Lowy D Tambourin P Strickland J Harper J Balaschak M Spangler E Yuspa S An activated Harvey ras oncogene produces benign tumours on mouse epidermal tissue.Nature. 1986; 323: 822-824Crossref PubMed Scopus (210) Google Scholar, 26Quintanilla M Brown K Ramsden M Balmain A Carcinogen-specific mutation and amplification of Ha-ras during mouse skin carcinogenesis.Nature. 1986; 322: 78-80Crossref PubMed Scopus (760) Google Scholar To analyze whether the development of cdk4 knockout papillomas also depends on Ha-ras mutations, genomic DNA of cdk4 null, heterozygous and wild-type papillomas was subjected to PCR amplification and restriction fragment length polymorphism analysis. All of the cdk4 wild-type and heterozygous papillomas carried specific mutations in the Ha-ras gene. On the other hand, analysis of two papillomas of cdk4-deficient mice showed no Ha-ras mutations at codon 61. These data suggest that lack of cdk4 abrogate ras-dependent skin tumor development, although analysis of a bigger number of cdk4−/− papillomas is necessary to confirm this hypothesis. The reduced number of skin tumors in cdk4-null mice led us to hypothesize that cdk4 deficiency could result in defective keratinocyte proliferation. It is known that papillomas from the classic DMBA-TPA carcinogenesis protocol originate from clonal expansion of a cell harboring a Ha-ras mutation.26Quintanilla M Brown K Ramsden M Balmain A Carcinogen-specific mutation and amplification of Ha-ras during mouse skin carcinogenesis.Nature. 1986; 322: 78-80Crossref PubMed Scopus (760) Google Scholar Thus, defective proliferation of mouse keratinocytes could result in impaired clonal expansion and further abrogation of papilloma development. To determine whether the absence of the cdk4 gene influenced the rate of proliferation and/or the architecture of mouse skin, we analyzed the interfollicular epidermis of cdk4-null and normal sibling mice. Histochemical staining in paraffin-embedded sections showed that both cdk4-null and wild-type skin are normal with no apparent differences in the structure of follicular or interfollicular epidermis (Figure 2, A and B). Epidermal proliferation was analyzed by BrdU incorporation as a marker of DNA synthesis. The labeling index (BrdU positive basal cells/total basal cells) of the interfollicular epidermis of both cdk4 knockout and wild-type animals did not show significant differences (wild-type, 0.052 ± 0.003, n = 14; KO, 0.060 ± 0.019, n = 10; t-test, P < 0.05). In addition, statistical analysis did not show significant differences in the number of nucleated cells between cdk4-null and wild-type sibling mice (t-test, P < 0.05). After multiple applications of TPA on the back, both cdk4 KO and normal sibling mice developed epidermal hyperplasia with a high rate of keratinocyte proliferation in the basal cell layer (Figure 2, C and D). A mild elevation in the rate of epidermal proliferation induced by TPA was observed in cdk4 KO epidermis compared with wild-type sibling mice (Figure 2, E and F) (labeling index, KO = 0.61 ± 0.03, n = 10, wild-type = 0.51 ± 0.02, n = 14; t-test P < 0.05), although the number of nucleated cells in interfollicular epidermis was similar (KO = 93.08 ± 9.93 nucleated cells/field; wt = 96.20 ± 0.80 nucleated cells/field; t-test P < 0.05) (Figure 2, C and D). A second approach was also used to determine whether keratinocytes from cdk4 knockout mice proliferate normally under a different stimulus. In this case, proliferation was induced by creating a wound on the dorsal skin of cdk4−/− and cdk4+/+ mice. The healing process involves reepithelialization, and granulation tissue formation.27Martin P Wound healing: aiming for perfect skin regeneration.Science. 1997; 276: 75-81Crossref PubMed Scopus (3812) Google Scholar Reepithelialization in turn involve proliferation and migration of cells from the wound edge to fill the wound site.27Martin P Wound healing: aiming for perfect skin regeneration.Science. 1997; 276: 75-81Crossref PubMed Scopus (3812) Google Scholar Three days after wounding, the mice were killed and the healing process was analyzed in paraffin embedded H&E-stained sections. Wound tissues showed that at day 3 wounding epidermis at wound edges had grown thicker in both wild-type and cdk4-null mice, indicating that proliferation of keratinocyte was normal (Figure 3,A and B). The epithelial tongue (leading edges of the migrating epithelium) and epithelial thickness had formed in both cdk4 knockout and wild-type sibling mice (Figure 3, A and B).27Martin P Wound healing: aiming for perfect skin regeneration.Science. 1997; 276: 75-81Crossref PubMed Scopus (3812) Google Scholar, 28Clark R Wound repair: overview and general considerations.in: Clark R The Molecular and Cellular Biology of Wound Repair. Plenum Press, New York1996: 3-50Google Scholar Analysis of keratinocyte proliferation also showed identical number of BrdU positive cells for both groups (data not shown). After incision, wound areas were measured every other day for 11 days and expressed as percent wound remaining. Again, the rate of wound healing did not show significant differences between cdk4 knockout and normal sibling mice (data not shown). These results showed that cdk4 deficiency did not affect normal keratinocyte proliferation nor TPA or wound induced proliferation, supporting a model in which cdk4 inhibition has a strong influence on neoplastic growth with minimal or no effect on normal tissue. Cdk4 and cdk6 activities take part in G1 phase checkpoint in mammalian cells. Thus, we investigated whether other cdk family members in mouse epidermis could compensate for the lack of cdk4. An obvious candidate was cdk6, which also binds to D-type cyclins in G1 phase. In addition, sequential phosphorylation of pRb by cdk4,6 and cdk2 led us to also analyze the kinase activity of cdk2 as a possible compensatory mechanism for the lack of cdk4. Epidermis of wild-type and cdk4-deficient mice was isolated and protein lysates were subjected to immunoprecipitation with cdk specific antibodies. As expected, no activity of cdk4 was observed in cdk4 knockout mice (Figure 2G). cdk6 activity increased twofold, whereas a mild increase in cdk2 activity (1.2-fold) was observed with cdk4-null lysate compared with wild-type sibling mice (Figure 2G). In fact, immunohistochemical analysis of normal and hyperproliferative skin from cdk4-deficient and wild-type mice with pRb site-specific phospho- residue antibodies (Ser-780 for cdk4 and cdk6; Thr-356 for cdk2) showed the same pattern of pRb phosphorylation in basal and suprabasal cell layers (data not shown). Western blot analysis of cdk6, cdk2, D-type cyclins, and p27Kip1 protein levels also revealed no significant difference between knockout and wild-type animals (data not shown). These results suggest that other cdks may compensate for the absence of cdk4 or, alternatively, phosphorylation of pRb by cdk6 is sufficient for normal epidermal proliferation. In fact, analysis of cdk complex formation showed increased binding of D-type cyclins to cdk6 and cdk2 (data not shown). Thus, it is possible that in the absence of cdk4 the available D-type cyclins bind to cdk6 and cdk2 resulting in phosphorylation of pRb protein. Other laboratories have described complex formation between D-type cyclins and cdk2, although the levels of activation of those complexes appear to be cell type specific.29Sweeney K Sarcevic B Sutherland R Musgrove E Cyclin D2 activates Cdk2 in preference to Cdk4 in human breast epithelial cells.Oncogene. 1997; 14: 1329-1340Crossref PubMed Scopus (47) Google Scholar, 30Dulic V Drullinger L Lees E Reed S Stein G Altered regulation of G1 cyclins in senescent human diploid fibroblasts: accumulation of inactive cyclin E-Cdk2 and cyclin D1-Cdk2 complexes.Proc Natl Acad Sci USA. 1993; 90: 11034-11038Crossref PubMed Scopus (287) Google Scholar, 31Higashi H Suzuki-Takahashi I Saitoh S Segawa K Taya Y Okuyama A Nishimura S Kitagawa M Cyclin-dependent kinase-2 (Cdk2) forms an inactive complex with cyclin D1 since Cdk2 associated with cyclin D1 is not phosphorylated by Cdk7-cyclin-H.Eur J Biochem. 1996; 237: 460-467Crossref PubMed Scopus (32) Google Scholar Numerous studies have implicated cdk4,6/cyclin D complexes as key regulators of the cell cycle.32Lukas J Bartkova J Rohde M Strauss M Bartek J Cyclin D1 is dispensable for G1 control in retinoblastoma gene-deficient cells independently of cdk4 activity.Mol Cell Biol. 1995; 15: 2600-2611Crossref PubMed Scopus (343) Google Scholar, 33Lukas J Parry D Aagard L Mann DJ Bartkova J Strauss M Peters G Bartek J Retinoblastoma protein-dependent cell-cycle inhibition by the tumor suppressor p16.Nature. 1995; 375: 503-506Crossref PubMed Scopus (877) Google Scholar The regulatory subunits of cdk4 and cdk2, D-type cyclins, and}, number={2}, journal={AMERICAN JOURNAL OF PATHOLOGY}, author={Rodriguez-Puebla, ML and Marval, PLM and LaCava, M and Moons, DS and Kiyokawa, H and Conti, CJ}, year={2002}, month={Aug}, pages={405–411} }