@article{bullard_cheslock_gadila_maggi_breitschwerdt_saied_embers_2024, title={A comparison of <i>Bartonella henselae</i> infection in immunocompetent and immunocompromised mice}, volume={19}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0297280}, abstractNote={Bartonellosis refers to disease caused by the Bartonella genus of bacteria. The breadth of disease manifestations associated with Bartonella is currently expanding and includes regional lymphadenopathy, rheumatic, ocular, and neurological disorders. The dearth of knowledge regarding diagnosis, treatment and pathogenesis of this disease can be partially attributed to the lack of a reliable small animal model for the disease. For this study, Bartonella henselae, the most common species associated with human disease, was injected into Swiss Webster (SW) mice. When the outcome indicated that productive infection did not occur, SCID/Beige (immune compromised) mice were inoculated. While SW mice may potentially harbor an acute infection, less than 10 days in length, the SCID/Beige model provided a sustained infection lasting up to 30-days. These data indicate that SCID/Beige mice can provide a model to study Bartonella infection, therapeutics, and vector dynamics in the future.}, number={2}, journal={PLOS ONE}, author={Bullard, Rebekah L. and Cheslock, Mercedes and Gadila, Shiva Kumar Goud and Maggi, Ricardo G. and Breitschwerdt, Edward B. and Saied, Ahmad A. and Embers, Monica E.}, year={2024}, month={Feb} }
 @article{liedig_neupane_lashnits_breitschwerdt_maggi_2023, title={Blood Supplementation Enhances Bartonella henselae Growth and Molecular Detection of Bacterial DNA in Liquid Culture}, volume={5}, ISSN={["2165-0497"]}, url={https://doi.org/10.1128/spectrum.05126-22}, DOI={10.1128/spectrum.05126-22}, abstractNote={
            This study aims to improve diagnostic detection of
            Bartonella henselae
            . Patient samples are combined with enriched bacterial cultures aimed at growing
            Bartonella henselae
            for the best possible chance at detection. However, current
            Bartonella
            growth methods could be improved. The DNA extraction method used by most laboratories should also be optimized. Sheep blood was added to increase the growth of
            Bartonella henselae
            and multiple DNA extraction methods were to be compared to each other.
          }, journal={MICROBIOLOGY SPECTRUM}, author={Liedig, Chance and Neupane, Pradeep and Lashnits, Erin and Breitschwerdt, Edward B. and Maggi, Ricardo G.}, editor={Mostafa, Heba H.Editor}, year={2023}, month={May} }
 @article{wheatley_shamoun_maggi_breitschwerdt_sommer_cullen_stowe_2023, title={Eosinophilic pericardial effusion and pericarditis in a cat}, volume={9}, ISSN={["2055-1169"]}, DOI={10.1177/20551169231213498}, abstractNote={Case summary A 10-year-old domestic shorthair cat presented for lethargy, anorexia and labored breathing. Significant pleural and pericardial effusions prompted thoracocentesis and pericardiocentesis. Cytologic evaluation of the pericardial effusion revealed a highly cellular hemorrhagic, eosinophilic (12%) effusion, with many markedly atypical suspected mesothelial cells, interpreted as concerning for neoplasia. Thoracoscopic subtotal pericardiectomy and histology of the pericardium revealed predominantly eosinophilic inflammation with multifocal mesothelial hypertrophy and ulceration. A peripheral eosinophilia was not present on serial complete blood counts. Initial infectious disease testing was mostly negative. Toxoplasma gondii titers were most consistent with prior exposure, although reactivation could not be excluded. The owner’s medical history included a prior diagnosis of bartonellosis. Owing to the challenges of definitive Bartonella species exclusion, the cat was treated empirically with pradofloxacin and doxycycline, and a subtotal pericardectomy. There was improvement at first but pleural effusion recurred approximately 3 months after discharge. The cat was euthanized and a necropsy was not performed. Subsequent pericardial effusion Piroplasma/Bartonella/Borrelia droplet digital PCR detected DNA of Bartonella vinsonii subspecies berkhoffii, and peripheral blood culture and sequencing revealed a rare apicomplexan organism (90% homology with Colpodella species) of unknown clinical significance. Testing for filamentous bacteria and fungal pathogens was not performed. }, number={2}, journal={JOURNAL OF FELINE MEDICINE AND SURGERY OPEN REPORTS}, author={Wheatley, Meagan Alisa and Shamoun, John and Maggi, Ricardo and Breitschwerdt, Edward B. and Sommer, Samantha L. and Cullen, John M. and Stowe, Devorah Marks}, year={2023}, month={Jul} }
 @article{moore_breitschwerdt_kim_li_ferris_maggi_lashnits_2023, title={The association of host and vector characteristics with Ctenocephalides felis pathogen and endosymbiont infection}, volume={14}, ISSN={["1664-302X"]}, DOI={10.3389/fmicb.2023.1137059}, abstractNote={Surveillance of the fleas and flea-borne pathogens infecting cats is important for both human and animal health. Multiple zoonotic Bartonella and Rickettsia species are known to infect the most common flea infesting cats and dogs worldwide: Ctenocephalides felis, the cat flea. The ability of other flea species to transmit pathogens is relatively unexplored. We aimed to determine cat host and flea factors independently associated with flea Bartonella and Rickettsia infection. We also assessed flea and cat infection by flea-host pair and location. To accomplish these aims, we performed qPCR for the detection of Bartonella, hemotropic Mycoplasma, Rickettsia, and Wolbachia DNA using paired cat and flea samples obtained from free-roaming cats presenting for spay or neuter across four locations in the United States. A logistic regression model was employed to identify the effect of cat (sex, body weight, geographic location, and Bartonella, hemotropic Mycoplasma, and Rickettsia spp., infection) and flea (clade and Rickettsia and Wolbachia infection) factors on C. felis Bartonella clarridgeiae infection. From 189 free roaming cats, we collected 84 fleas: Ctenocephalides felis (78/84), Cediopsylla simplex (4/84), Orchopeas howardi (1/84), and Nosopsyllus fasciatus (1/84). Ctenocephalides felis were phylogenetically assigned to Clades 1, 4, and 6 by cox1 gene amplification. Rickettsia asembonensis (52/84) and B. clarridgeiae (16/84) were the most common pathogenic bacteria detected in fleas. Our model identified host cat sex and weight as independently associated with B. clarridgeiae infection in fleas. Rickettsia asembonensis (52/84), Rickettsia felis (7/84) and Bartonella henselae (7/84) were detected in specific clades: R. felis was detected only in Clades 1 and 6 while B. henselae and R. asembonensis were detected only in Clade 4. Wolbachia spp., also displayed clade specificity with strains other than Wolbachia wCfeT only infecting fleas from Clade 6. There was poor flea and host agreement for Bartonella spp., infection; however, there was agreement in the Bartonella species detected in cats and fleas by geographic location. These findings reinforce the importance of considering reservoir host attributes and vector phylogenetic diversity in epidemiological studies of flea-borne pathogens. Widespread sampling is necessary to identify the factors driving flea-borne pathogen presence and transmission.}, journal={FRONTIERS IN MICROBIOLOGY}, author={Moore, Charlotte and Breitschwerdt, Edward B. B. and Kim, Lisa and Li, Yiyao and Ferris, Kelli and Maggi, Ricardo and Lashnits, Erin}, year={2023}, month={Mar} }
 @article{bush_maggi_breitschwerdt_2023, title={Viability and Desiccation Resistance of Bartonella henselae in Biological and Non-Biological Fluids: Evidence for Pathogen Environmental Stability}, volume={12}, ISSN={["2076-0817"]}, url={https://doi.org/10.3390/pathogens12070950}, DOI={10.3390/pathogens12070950}, abstractNote={Pathogen environmental stability is an often-neglected research priority for pathogens that are known to be vector-transmitted. Bartonella henselae, the etiologic agent of Cat Scratch Disease, has become a “pathogen of interest” in several serious human illnesses, which include neoplastic, cardiovascular, neurocognitive, and rheumatologic conditions. Survival in the flea gut and feces as well as the association with a biofilm in culture-negative endocarditis provides insight into this organism’s ability to adjust to environmental extremes. The detection of B. henselae DNA in blood and tissues from marine mammals also raises questions about environmental stability and modes of pathogen transmission. We investigated the ability of B. henselae to survive in fluid matrices chosen to mimic potential environmental sources of infective materials. Feline whole blood, serum and urine, bovine milk, and physiologic saline inoculated with a laboratory strain of B. henselae San Antonio 2 were subsequently evaluated by culture and qPCR at specified time intervals. Bacterial viability was also assessed following desiccation and reconstitution of each inoculated fluid matrix. Bartonella henselae SA2 was cultured from feline urine up to 24 hours after inoculation, and from blood, serum, cow’s milk, and physiologic saline for up to 7 days after inoculation. Of potential medical importance, bacteria were cultured following air-desiccation of all fluid inoculates. The viability and stability of Bartonella within biological and non-biological fluids in the environment may represent a previously unrecognized source of infection for animals and human beings.}, number={7}, journal={PATHOGENS}, author={Bush, Janice C. C. and Maggi, Ricardo G. G. and Breitschwerdt, Edward B. B.}, year={2023}, month={Jul} }
 @article{neupane_maggi_basnet_lashnits_andrews_breitschwerdt_2022, title={Bartonella henselae Recombinant Pap31 for the Diagnosis of Canine and Human Bartonelloses}, volume={11}, ISSN={["2076-0817"]}, url={https://doi.org/10.3390/pathogens11020182}, DOI={10.3390/pathogens11020182}, abstractNote={Bartonella spp. comprise a genus of Gram-negative alphaproteobacteria that are slow growing, fastidious, and facultative intracellular pathogens with zoonotic potential. Immunofluorescent antibody assays (IFAs), Western blot (WB), and enzyme-linked immunosorbent assays (ELISAs), the frequently used modalities for the serological diagnosis of canine and human Bartonelloses, generate numerous false negative results. Therefore, the development of a reliable serodiagnostic assay for Bartonelloses is of clinical and epidemiological importance. Pap31, a heme binding surface protein of B. henselae, is associated with bacterial adhesion and related to bacterial colonization. To our knowledge, B. henselae Pap31 and its fragments (N-terminal (NTD), middle (MD), and C-terminal (CTD) domains) have not been investigated for the serodiagnosis of canine and human Bartonelloses. In this study, we evaluate the diagnostic utility of B. henselae recombinant whole Pap31 (rPap31) and Pap31 fragments by ELISA using sera from 70 dogs (36 Bartonella spp. IFA-positive (naturally infected), and 34 Bartonella spp. IFA- and PCR-negative (control dogs)) and 36 humans (18 Bartonella spp. IFA-positive (naturally infected) and 18 controls)). In the dogs, the area under the curve (AUC) score of recombinant whole Pap31 was 0.714 with a sensitivity of 42% and specificity of 94% at an OD cutoff value of 0.8955. Among the evaluated recombinant Pap31 proteins for the diagnosis of canine Bartonelloses, rPap31-NTD yielded the highest AUC score of 0.792 (95% CI 0.688–0.895) with a sensitivity of 44% and specificity of 100% at a cutoff value of 1.198. In concordance with this finding, rPap31-NTD also had the highest AUC score of 0.747 (95% CI 0.581–0.913) among the Pap31 recombinant proteins for the diagnosis of human Bartonelloses, with 39% sensitivity and 94% specificity at a cutoff value of 1.366. Recombinant whole Pap31 (rPap31) resulted in 72% sensitivity and 61% specificity at a cutoff value of 0.215 for human Bartonelloses. Due to either low sensitivity or questionable specificity, our findings indicate that recombinant Pap31 and the selected fragments may not be appropriate diagnostic targets in detecting anti-Bartonella antibodies in Bartonella-infected dogs and humans. The findings from this study can be used to further assess the antigenicity and immunogenicity of B. henselae Pap31 as a diagnostic target.}, number={2}, journal={PATHOGENS}, publisher={MDPI AG}, author={Neupane, Pradeep and Maggi, Ricardo G. and Basnet, Manoj and Lashnits, Erin and Andrews, Gerard P. and Breitschwerdt, Edward B.}, year={2022}, month={Feb} }
 @article{manvell_berman_callahan_breitschwerdt_swain_ferris_maggi_lashnits_2022, title={Identification of microbial taxa present in Ctenocephalides felis (cat flea) reveals widespread co-infection and associations with vector phylogeny}, volume={15}, ISSN={["1756-3305"]}, DOI={10.1186/s13071-022-05487-1}, abstractNote={Abstract}, number={1}, journal={PARASITES & VECTORS}, author={Manvell, Charlotte and Berman, Hanna and Callahan, Benjamin and Breitschwerdt, Edward and Swain, William and Ferris, Kelli and Maggi, Ricardo and Lashnits, Erin}, year={2022}, month={Oct} }
 @article{alvarez-fernandez_maggi_eduard martin-valls_baxarias_bealmear breitschwerdt_solano-gallego_2022, title={Prospective serological and molecular cross-sectional study focusing on Bartonella and other blood-borne organisms in cats from Catalonia (Spain)}, volume={15}, ISSN={["1756-3305"]}, DOI={10.1186/s13071-021-05105-6}, abstractNote={Abstract}, number={1}, journal={PARASITES & VECTORS}, author={Alvarez-Fernandez, Alejandra and Maggi, Ricardo and Eduard Martin-Valls, Gerard and Baxarias, Marta and Bealmear Breitschwerdt, Edward and Solano-Gallego, Laia}, year={2022}, month={Jan} }
 @article{andre_neupane_lappin_herrin_smith_williams_collins_bai_jorge_balbuena_et al._2022, title={Using Proteomic Approaches to Unravel the Response of Ctenocephalides felis felis to Blood Feeding and Infection With Bartonella henselae}, volume={12}, ISSN={["2235-2988"]}, url={http://dx.doi.org/10.3389/fcimb.2022.828082}, DOI={10.3389/fcimb.2022.828082}, abstractNote={Among the Ctenocephalides felis felis-borne pathogens, Bartonella henselae, the main aetiological agent of cat scratch disease (CSD), is of increasing comparative biomedical importance. Despite the importance of B. henselae as an emergent pathogen, prevention of the diseases caused by this agent in cats, dogs and humans mostly relies on the use of ectoparasiticides. A vaccine targeting both flea fitness and pathogen competence is an attractive choice requiring the identification of flea proteins/metabolites with a dual effect. Even though recent developments in vector and pathogen -omics have advanced the understanding of the genetic factors and molecular pathways involved at the tick-pathogen interface, leading to discovery of candidate protective antigens, only a few studies have focused on the interaction between fleas and flea-borne pathogens. Taking into account the period of time needed for B. henselae replication in flea digestive tract, the present study investigated flea-differentially abundant proteins (FDAP) in unfed fleas, fleas fed on uninfected cats, and fleas fed on B. henselae-infected cats at 24 hours and 9 days after the beginning of blood feeding. Proteomics approaches were designed and implemented to interrogate differentially expressed proteins, so as to gain a better understanding of proteomic changes associated with the initial B. henselae transmission period (24 hour timepoint) and a subsequent time point 9 days after blood ingestion and flea infection. As a result, serine proteases, ribosomal proteins, proteasome subunit α-type, juvenile hormone epoxide hydrolase 1, vitellogenin C, allantoinase, phosphoenolpyruvate carboxykinase, succinic semialdehyde dehydrogenase, glycinamide ribotide transformylase, secreted salivary acid phosphatase had high abundance in response of C. felis blood feeding and/or infection by B. henselae. In contrast, high abundance of serpin-1, arginine kinase, ribosomal proteins, peritrophin-like protein, and FS-H/FSI antigen family member 3 was strongly associated with unfed cat fleas. Findings from this study provide insights into proteomic response of cat fleas to B. henselae infected and uninfected blood meal, as well as C. felis response to invading B. henselae over an infection time course, thus helping understand the complex interactions between cat fleas and B. henselae at protein levels.}, journal={FRONTIERS IN CELLULAR AND INFECTION MICROBIOLOGY}, publisher={Frontiers Media SA}, author={Andre, Marcos Rogerio and Neupane, Pradeep and Lappin, Michael and Herrin, Brian and Smith, Vicki and Williams, Taufika Islam and Collins, Leonard and Bai, Hongxia and Jorge, Gabriel Lemes and Balbuena, Tiago Santana and et al.}, year={2022}, month={Jan} }
 @misc{maggi_halls_kramer_lappin_pennisi_peregrine_roura_schunack_scorza_tasker_et al._2022, title={Vector-borne and other pathogens of potential relevance disseminated by relocated cats}, volume={15}, ISSN={["1756-3305"]}, DOI={10.1186/s13071-022-05553-8}, abstractNote={Abstract}, number={1}, journal={PARASITES & VECTORS}, author={Maggi, Ricardo Guillermo and Halls, Vicky and Kramer, Friederike and Lappin, Michael and Pennisi, Maria Grazia and Peregrine, Andrew S. and Roura, Xavier and Schunack, Bettina and Scorza, Valeria and Tasker, Severine and et al.}, year={2022}, month={Nov} }
 @article{ericson_breitschwerdt_reicherter_maxwell_maggi_melvin_maluki_bradley_miller_simmons_et al._2021, title={Bartonella henselae Detected in Malignant Melanoma, a Preliminary Study}, volume={10}, ISSN={["2076-0817"]}, url={https://doi.org/10.3390/pathogens10030326}, DOI={10.3390/pathogens10030326}, abstractNote={Bartonella bacilliformis (B. bacilliformis), Bartonella henselae (B. henselae), and Bartonella quintana (B. quintana) are bacteria known to cause verruga peruana or bacillary angiomatosis, vascular endothelial growth factor (VEGF)-dependent cutaneous lesions in humans. Given the bacteria’s association with the dermal niche and clinical suspicion of occult infection by a dermatologist, we determined if patients with melanoma had evidence of Bartonella spp. infection. Within a one-month period, eight patients previously diagnosed with melanoma volunteered to be tested for evidence of Bartonella spp. exposure/infection. Subsequently, confocal immunohistochemistry and PCR for Bartonella spp. were used to study melanoma tissues from two patients. Blood from seven of the eight patients was either seroreactive, PCR positive, or positive by both modalities for Bartonella spp. exposure. Subsequently, Bartonella organisms that co-localized with VEGFC immunoreactivity were visualized using multi-immunostaining confocal microscopy of thick skin sections from two patients. Using a co-culture model, B. henselae was observed to enter melanoma cell cytoplasm and resulted in increased vascular endothelial growth factor C (VEGFC) and interleukin 8 (IL-8) production. Findings from this small number of patients support the need for future investigations to determine the extent to which Bartonella spp. are a component of the melanoma pathobiome.}, number={3}, journal={PATHOGENS}, publisher={MDPI AG}, author={Ericson, Marna E. and Breitschwerdt, Edward B. and Reicherter, Paul and Maxwell, Cole and Maggi, Ricardo G. and Melvin, Richard G. and Maluki, Azar H. and Bradley, Julie M. and Miller, Jennifer C. and Simmons, Glenn E., Jr. and et al.}, year={2021}, month={Mar} }
 @article{lashnits_neupane_bradley_richardson_maggi_breitschwerdt_2021, title={Comparison of Serological and Molecular Assays for Bartonella Species in Dogs with Hemangiosarcoma}, volume={10}, ISSN={["2076-0817"]}, url={https://doi.org/10.3390/pathogens10070794}, DOI={10.3390/pathogens10070794}, abstractNote={Currently, a gold standard diagnostic test for Bartonella infection in dogs is lacking. This represents a critical limitation for the development and evaluation of new diagnostic tests, as well as for the diagnosis of, and research on, bartonellosis in dogs. This retrospective observational study aims to compare the results of commonly performed and newly-reported Bartonella spp. diagnostic tests in banked clinical specimens from 90 dogs with hemangiosarcoma (HSA) using composite reference standard (CRS) and random effects latent class analysis (RE-LCA) techniques. Samples from each dog were tested using six serological or molecular diagnostic assays, including indirect fluorescent antibody (IFA) and Western blot (WB) for the detection of antibodies in serum, and qPCR and droplet digital PCR (ddPCR) in blood and fresh frozen tissue biopsy samples (mainly splenic HSA tumors and histopathologically normal spleen or skin/adipose tissue). Bartonella infection prevalence was estimated to be 78% based on the CRS (parallel testing with all six assays), and 64% based on the RE-LCA model. The assay with the highest diagnostic accuracy was qPCR performed on fresh frozen tissue biopsy samples (sensitivity: 94% by RE-LCA and 80% by CRS; specificity: 100%). When comparing newly-reported to traditional Bartonella diagnostic assays, ddPCR was more sensitive for the detection of Bartonella DNA than qPCR when testing blood samples (36% vs. 0%, p < 0.0001). Dogs that were positive on serological assays alone with negative molecular assays were highly unlikely (<3%) to be classified as infected by the RE-LCA model. These data indicate that Bartonella spp. DNA can be PCR amplified from fresh frozen tissues from a majority of dogs with HSA using both qPCR and ddPCR, supporting the use of these methods for future controlled studies comparing the prevalence of Bartonella spp. DNA in the tissue of dogs with HSA to that of unaffected controls.}, number={7}, journal={PATHOGENS}, publisher={MDPI AG}, author={Lashnits, Erin and Neupane, Pradeep and Bradley, Julie M. and Richardson, Toni and Maggi, Ricardo G. and Breitschwerdt, Edward B.}, year={2021}, month={Jul} }
 @article{maggi_breitschwerdt_qurollo_miller_2021, title={Development of a Multiplex Droplet Digital PCR Assay for the Detection of Babesia, Bartonella, and Borrelia Species}, volume={10}, ISSN={["2076-0817"]}, url={https://doi.org/10.3390/pathogens10111462}, DOI={10.3390/pathogens10111462}, abstractNote={We describe the development, optimization, and validation of a multiplex droplet digital PCR (ddPCR) assay for the simultaneous detection of Babesia, Bartonella, and Borrelia spp. DNA from several sample matrices, including clinical blood samples from animals and humans, vectors, in-vitro infected human and animal cell lines, and tissues obtained from animal models (infected with Bartonella and/or B. burgdorferi). The multiplex ddPCR assay was able to detect 31 Bartonella, 13 Borrelia, and 24 Babesia species, including Theileria equi, T. cervi, and Cytauxzoon felis. No amplification of Treponema or Leptospira spp. was observed. Sensitivity of 0.2–5 genome equivalent DNA copies per microliter was achieved for different members of the Bartonella and Borrelia genus, depending on the species or matrix type (water or spiked blood DNA) tested. The ddPCR assay facilitated the simultaneous detection of co-infections with two and three vector-borne pathogens comprising four different genera (Babesia, Bartonella, Borrelia, and Theileria) from clinical and other sample sources.}, number={11}, journal={PATHOGENS}, author={Maggi, Ricardo and Breitschwerdt, Edward B. and Qurollo, Barbara and Miller, Jennifer C.}, year={2021}, month={Nov} }
 @article{manvell_ferris_maggi_breitschwerdt_lashnits_2021, title={Prevalence of Vector-Borne Pathogens in Reproductive and Non-Reproductive Tissue Samples from Free-Roaming Domestic Cats in the South Atlantic USA}, volume={10}, ISSN={["2076-0817"]}, url={https://doi.org/10.3390/pathogens10091221}, DOI={10.3390/pathogens10091221}, abstractNote={Reservoir to multiple species of zoonotic pathogens, free-roaming cats (FRCs) interact with domestic and wild animals, vectors, and humans. To assess the potential for feline vector-borne pathogens to be vertically transmitted, this study surveyed ear tip and reproductive tissues of FRCs from two locations in the South Atlantic United States for Anaplasma, Bartonella, Ehrlichia, hemotropic Mycoplasma, and Rickettsia species. We collected ovary (n = 72), uterus (n = 54), testicle (n = 74), and ear tip (n = 73) tissue from 73 cats, and fetal (n = 20) and placental (n = 19) tissue from 11 queens. Pathogen DNA was amplified utilizing qPCR, confirmed by sequencing. Cats were more frequently Bartonella henselae positive on reproductive tissues (19%, 14/73) than ear tip (5%, 4/73; p = 0.02). B. henselae was amplified from fetus (20%, 4/20) and placenta samples (11%, 2/19). Bartonella spp. infection was more common in cats from North Carolina (76%, 26/34) than Virginia (13%, 5/39; p < 0.0001). Fourteen percent (10/73) of both ear tip and reproductive tissues were positive for hemotropic Mycoplasma spp. Anaplasma, Ehrlichia, and Rickettsia spp. DNA was not amplified from any cat/tissue. These findings suggest that B. henselae preferentially infected cats’ reproductive tissue and reinforces the importance of investigating the potential for B. henselae vertical transmission or induction of reproductive failure.}, number={9}, journal={PATHOGENS}, publisher={MDPI AG}, author={Manvell, Charlotte and Ferris, Kelli and Maggi, Ricardo and Breitschwerdt, Edward B. and Lashnits, Erin}, year={2021}, month={Sep} }
 @misc{bobe_jutras_horn_embers_bailey_moritz_zhang_soloski_ostfeld_marconi_et al._2021, title={Recent Progress in Lyme Disease and Remaining Challenges}, volume={8}, ISSN={["2296-858X"]}, DOI={10.3389/fmed.2021.666554}, abstractNote={Lyme disease (also known as Lyme borreliosis) is the most common vector-borne disease in the United States with an estimated 476,000 cases per year. While historically, the long-term impact of Lyme disease on patients has been controversial, mounting evidence supports the idea that a substantial number of patients experience persistent symptoms following treatment. The research community has largely lacked the necessary funding to properly advance the scientific and clinical understanding of the disease, or to develop and evaluate innovative approaches for prevention, diagnosis, and treatment. Given the many outstanding questions raised into the diagnosis, clinical presentation and treatment of Lyme disease, and the underlying molecular mechanisms that trigger persistent disease, there is an urgent need for more support. This review article summarizes progress over the past 5 years in our understanding of Lyme and tick-borne diseases in the United States and highlights remaining challenges.}, journal={FRONTIERS IN MEDICINE}, author={Bobe, Jason R. and Jutras, Brandon L. and Horn, Elizabeth J. and Embers, Monica E. and Bailey, Allison and Moritz, Robert L. and Zhang, Ying and Soloski, Mark J. and Ostfeld, Richard S. and Marconi, Richard T. and et al.}, year={2021}, month={Aug} }
 @article{lashnits_maggi_jarskog_bradley_breitschwerdt_frohlich_2021, title={Schizophrenia and Bartonella spp. Infection: A Pilot Case-Control Study}, volume={21}, ISSN={["1557-7759"]}, DOI={10.1089/vbz.2020.2729}, abstractNote={Recently, infections with emerging zoonotic bacteria of the genus Bartonella have been reported in association with a range of central nervous system (CNS) symptoms. Currently, it remains unknown if Bartonella spp. infection is associated with symptoms of schizophrenia/schizoaffective disorder (SCZ/SAD). The objective of this study was to determine if there is an association between Bartonella species infection and SCZ/SAD. A secondary objective was to determine if SCZ/SAD symptoms were more severe among participants with documented Bartonella spp. infection. Using a case-control study design, 17 cases and 13 controls were evaluated with a series of clinical and cognitive assessments. Blood samples were collected and tested for Bartonella spp. infection using serological, microbiological, and molecular techniques. People with SCZ/SAD were more likely than healthy volunteers to have Bartonella spp. DNA in their bloodstream, with 11 of 17 cases (65%) positive by Bartonella spp. droplet digital PCR (ddPCR). In comparison, only one healthy volunteer was Bartonella spp. ddPCR positive (8%, p = 0.0024). Based on serology, Bartonella spp. exposure was common among people with SCZ/SAD (12 of 17) as well as among healthy volunteers (12 of 13), with no significant difference between the groups (p = 0.196). Within the case group of people with SCZ/SAD, there was no significant difference in SCZ/SAD severity scores between people with and without ddPCR evidence of Bartonella spp. infection. This pilot study provides preliminary evidence in support of future investigations that should examine a potential contribution of Bartonella spp. infection to SCZ/SAD.}, number={6}, journal={VECTOR-BORNE AND ZOONOTIC DISEASES}, author={Lashnits, Erin and Maggi, Ricardo and Jarskog, Fredrik and Bradley, Julie and Breitschwerdt, Edward and Frohlich, Flavio}, year={2021}, month={Jun}, pages={413–421} }
 @article{breitschwerdt_bradley_maggi_lashnits_reicherter_2020, title={Bartonella Associated Cutaneous Lesions (BACL) in People with Neuropsychiatric Symptoms}, volume={9}, url={https://doi.org/10.3390/pathogens9121023}, DOI={10.3390/pathogens9121023}, abstractNote={Bartonella species are globally important emerging pathogens that were not known to infect animals or humans in North America prior to the human immunodeficiency virus (HIV) epidemic. Ongoing improvements in diagnostic testing modalities have allowed for the discovery of Bartonella species (spp.) DNA in blood; cerebrospinal fluid; and the skin of patients with cutaneous lesions, fatigue, myalgia, and neurological symptoms. We describe Bartonella spp. test results for participants reporting neuropsychiatric symptoms, the majority of whom reported the concurrent development of cutaneous lesions. Study participants completed a medical history, a risk factor questionnaire, and provided cutaneous lesion photographs. Bartonella spp. serology and Bartonella alpha proteobacteria enrichment blood culture/PCR were assessed. Within a 14-month period, 33 participants enrolled; 29/33 had serological and/or PCR evidence supporting Bartonella spp. infection, of whom 24 reported concurrent cutaneous lesions since neuropsychiatric symptom onset. We conclude that cutaneous lesions were common among people reporting neuropsychiatric symptoms and Bartonella spp. infection or exposure. Additional studies, using sensitive microbiological and imaging techniques, are needed to determine if, or to what extent, Bartonella spp. might contribute to cutaneous lesions and neuropsychiatric symptoms in patients.}, number={12}, journal={Pathogens}, publisher={MDPI AG}, author={Breitschwerdt, Edward B. and Bradley, Julie M. and Maggi, Ricardo G. and Lashnits, Erin and Reicherter, Paul}, year={2020}, month={Dec}, pages={1023} }
 @article{lashnits_neupane_maggi_linder_bradley_balakrishnan_southern_mckeon_chandrashekar_breitschwerdt_2020, title={Detection of Bartonella spp. in dogs after infection with Rickettsia rickettsii}, volume={34}, url={https://doi.org/10.1111/jvim.15675}, DOI={10.1111/jvim.15675}, abstractNote={Abstract}, number={1}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Lashnits, Erin and Neupane, Pradeep and Maggi, Ricardo G. and Linder, Keith E. and Bradley, Julie M. and Balakrishnan, Nandhakumar and Southern, Brittany L. and McKeon, Gabriel P. and Chandrashekar, Ramaswamy and Breitschwerdt, Edward B.}, year={2020}, month={Jan}, pages={145–159} }
 @article{maggi_richardson_breitschwerdt_miller_2020, title={Development and validation of a droplet digital PCR assay for the detection and quantification of Bartonella species within human clinical samples}, volume={176}, ISSN={["1872-8359"]}, DOI={10.1016/j.mimet.2020.106022}, abstractNote={This report describes the development, optimization, and validation of a ddPCR assay for the detection of Bartonella spp. DNA within several sample matrices, including clinical blood samples from patients with or without documented Bartonella spp. bacteremia. The Bartonella spp. ddPCR assay was developed based upon previously published TaqMan-based qPCR assays that can amplify DNA of over 25 Bartonella spp. Host DNA (housekeeping gene) amplification serves as a reference target to facilitate quantification. The efficiency, sensitivity, and specificity of the Bartonella spp. ddPCR assay was assessed by direct comparison with the current qPCR methods used by the Intracellular Pathogens Research Laboratory (North Carolina State University, North Carolina, USA), and Galaxy Diagnostics (Research Triangle Park, North Carolina, USA). Bartonella spp. ddPCR assay parameters were successfully optimized to detect Bartonella concentrations equivalent to 0.5 bacterial genome copies per microliter of blood (0.001 pg/ul of bacterial DNA). The number of droplets detected (resolution) for each concentration was consistent across each of four assessed time points. The Bartonella spp. ddPCR assay detected 16 species/strains including B. henselae; B. quintana; B. vinsonii subsp. berkhoffii (genotypes I, II, III and IV); B. vinsonii subsp. vinsonii; B. melophagi; B. volans; B. monaki; B. alsatica; B. bovis; B. elizabethae; B. clarridgeiae; and B. koehlerae. Bartonella DNA was detected in only one previously negative patient sample (119/120 negative; 99% specificity). The ddPCR sensitivity (53/112) was significantly better than qPCR (6/112) when testing patient blood and enrichment blood culture samples. The development of commercial ddPCR systems with integrated technologies has significantly streamlined the DNA detection process, making it more efficient and standardized for clinical diagnostic testing. The assay described in this work is the first step toward the development of a multiplex ddPCR assay (i.e., using the QX One from Bio-Rad) for the simultaneous detection and absolute quantification of multiple vector-borne pathogens (such as Babesia, Bartonella and Borrelia) within clinical samples.}, journal={JOURNAL OF MICROBIOLOGICAL METHODS}, author={Maggi, Ricardo G. and Richardson, Toni and Breitschwerdt, Edward B. and Miller, Jennifer C.}, year={2020}, month={Sep} }
 @article{buhler_maggi_gailius_galloway_chilton_alisauskas_samelius_bouchard_jenkins_2020, title={Hopping species and borders: detection of Bartonella spp. in avian nest fleas and arctic foxes from Nunavut, Canada}, volume={13}, ISSN={["1756-3305"]}, DOI={10.1186/s13071-020-04344-3}, abstractNote={Abstract}, number={1}, journal={PARASITES & VECTORS}, author={Buhler, Kayla J. and Maggi, Ricardo G. and Gailius, Julie and Galloway, Terry D. and Chilton, Neil B. and Alisauskas, Ray T. and Samelius, Gustaf and Bouchard, Emilie and Jenkins, Emily J.}, year={2020}, month={Sep} }
 @article{breitschwerdt_maggi_2020, title={My Mother's Story: Tick Borne Ehrlichiosis and a Life Well-Lived}, volume={20}, ISSN={["1557-7759"]}, DOI={10.1089/vbz.2019.2570}, abstractNote={Vector-Borne and Zoonotic DiseasesVol. 20, No. 5 Original ArticlesMy Mother's Story: Tick Borne Ehrlichiosis and a Life Well-LivedEdward B. Breitschwerdt and Ricardo G. MaggiEdward B. BreitschwerdtAddress correspondence to: Edward B. Breitschwerdt, Intracellular Pathogens Research Laboratory, Comparative Medicine Institute, College of Veterinary Medicine, North Carolina State University, 1060 William Moore Drive, Raleigh, NC 27606, USA E-mail Address: ebbreits@ncsu.eduIntracellular Pathogens Research Laboratory, Comparative Medicine Institute, College of Veterinary Medicine, North Carolina State University, Raleigh, North Carolina, USA.Search for more papers by this author and Ricardo G. MaggiIntracellular Pathogens Research Laboratory, Comparative Medicine Institute, College of Veterinary Medicine, North Carolina State University, Raleigh, North Carolina, USA.Search for more papers by this authorPublished Online:28 Apr 2020https://doi.org/10.1089/vbz.2019.2570AboutSectionsView articleView Full TextPDF/EPUB Permissions & CitationsPermissionsDownload CitationsTrack CitationsAdd to favorites Back To Publication ShareShare onFacebookTwitterLinked InRedditEmail View articleFiguresReferencesRelatedDetails Volume 20Issue 5May 2020 InformationCopyright 2020, Mary Ann Liebert, Inc., publishersTo cite this article:Edward B. Breitschwerdt and Ricardo G. Maggi.My Mother's Story: Tick Borne Ehrlichiosis and a Life Well-Lived.Vector-Borne and Zoonotic Diseases.May 2020.319-324.http://doi.org/10.1089/vbz.2019.2570Published in Volume: 20 Issue 5: April 28, 2020Online Ahead of Print:December 16, 2019KeywordsEhrlichiaBartonelladementiaone healthnon-Hodgkin's lymphomaPDF download}, number={5}, journal={VECTOR-BORNE AND ZOONOTIC DISEASES}, author={Breitschwerdt, Edward B. and Maggi, Ricardo G.}, year={2020}, month={May}, pages={319–324} }
 @article{neupane_sevala_balakrishnan_marr_wilson_maggi_birkenheuer_lappin_chomel_breitschwerdt_2020, title={Validation of Bartonella henselae Western Immunoblotting for Serodiagnosis of Bartonelloses in Dogs}, volume={58}, ISSN={["1098-660X"]}, DOI={10.1128/JCM.01335-19}, abstractNote={
            Bartonella
            spp. are etiological agents of life-threatening zoonotic diseases in dogs worldwide. Due to the poor sensitivity of immunofluorescent-antibody assays (IFAs), a reliable serodiagnostic test for canine bartonelloses is of clinical importance. The utility of Western blotting (WB) for the serodiagnosis of canine bartonelloses has not been critically investigated. The objective of this study was to characterize WB immunodominant proteins that could be used to confirm a serodiagnosis of bartonelloses.
          }, number={4}, journal={JOURNAL OF CLINICAL MICROBIOLOGY}, author={Neupane, Pradeep and Sevala, Sindhura and Balakrishnan, Nandhakumar and Marr, Henry and Wilson, James and Maggi, Ricardo and Birkenheuer, Adam and Lappin, Michael and Chomel, Bruno and Breitschwerdt, Edward B.}, year={2020}, month={Apr} }
 @article{maggi_krämer_2019, title={A review on the occurrence of companion vector-borne diseases in pet animals in Latin America}, volume={12}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/s13071-019-3407-x}, DOI={10.1186/s13071-019-3407-x}, abstractNote={Companion vector-borne diseases (CVBDs) are an important threat for pet life, but may also have an impact on human health, due to their often zoonotic character. The importance and awareness of CVBDs continuously increased during the last years. However, information on their occurrence is often limited in several parts of the world, which are often especially affected. Latin America (LATAM), a region with large biodiversity, is one of these regions, where information on CVBDs for pet owners, veterinarians, medical doctors and health workers is often obsolete, limited or non-existent. In the present review, a comprehensive literature search for CVBDs in companion animals (dogs and cats) was performed for several countries in Central America (Belize, Caribbean Islands, Costa Rica, Cuba, Dominican Republic, El Salvador, Guatemala, Honduras, Mexico, Nicaragua, Panama, Puerto Rico) as well as in South America (Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, French Guiana, Guyana (British Guyana), Paraguay, Peru, Suriname, Uruguay, Venezuela) regarding the occurrence of the following parasitic and bacterial diseases: babesiosis, heartworm disease, subcutaneous dirofilariosis, hepatozoonosis, leishmaniosis, trypanosomosis, anaplasmosis, bartonellosis, borreliosis, ehrlichiosis, mycoplasmosis and rickettsiosis. An overview on the specific diseases, followed by a short summary on their occurrence per country is given. Additionally, a tabular listing on positive or non-reported occurrence is presented. None of the countries is completely free from CVBDs. The data presented in the review confirm a wide distribution of the CVBDs in focus in LATAM. This wide occurrence and the fact that most of the CVBDs can have a quite severe clinical outcome and their diagnostic as well as therapeutic options in the region are often difficult to access and to afford, demands a strong call for the prevention of pathogen transmission by the use of ectoparasiticidal and anti-feeding products as well as by performing behavioural changes.}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Maggi, Ricardo G. and Krämer, Friederike}, year={2019}, month={Mar} }
 @article{breitschwerdt_greenberg_maggi_mozayeni_lewis_bradley_2019, title={Bartonella henselae Bloodstream Infection in a Boy With Pediatric Acute-Onset Neuropsychiatric Syndrome}, volume={11}, ISSN={1179-5735 1179-5735}, url={http://dx.doi.org/10.1177/1179573519832014}, DOI={10.1177/1179573519832014}, abstractNote={Background: With the advent of more sensitive culture and molecular diagnostic testing modalities, Bartonella spp. infections have been documented in blood and/or cerebrospinal fluid specimens from patients with diverse neurological symptoms. Pediatric acute-onset neuropsychiatric syndrome (PANS) is characterized by an unusually abrupt onset of cognitive, behavioral, or neurological symptoms. Between October 2015 and January 2017, a 14-year-old boy underwent evaluation by multiple specialists for sudden-onset psychotic behavior (hallucinations, delusions, suicidal and homicidal ideation). }, journal={Journal of Central Nervous System Disease}, publisher={SAGE Publications}, author={Breitschwerdt, Edward B and Greenberg, Rosalie and Maggi, Ricardo G and Mozayeni, B Robert and Lewis, Allen and Bradley, Julie M}, year={2019}, month={Jan}, pages={117957351983201} }
 @article{breitschwerdt_maggi_quach_bradley_2019, title={Bartonella spp. Bloodstream Infection in a Canadian Family}, volume={19}, ISSN={1530-3667 1557-7759}, url={http://dx.doi.org/10.1089/vbz.2018.2353}, DOI={10.1089/vbz.2018.2353}, abstractNote={Historically, Bartonella spp. have been associated with febrile illness (Oroya fever, trench fever, and cat scratch disease), endocarditis (numerous Bartonella spp.), and vasoproliferative lesions (Bartonella bacilliformis, Bartonella quintana, Bartonella henselae, and Bartonella vinsonii subsp. berkhoffii), occurring most often but not exclusively in immunocompromised patients. Recently, bloodstream infections with various Bartonella spp. have been documented in nonimmunocompromised individuals in association with a spectrum of cardiovascular, neurologic, and rheumatologic symptoms. As documented in this family, symptoms for which the medical implications remain unclear can occur in multiple family members infected with one or more Bartonella spp. Serial serologic and molecular microbiological findings supported exposure to or infection with Bartonella spp. in all seven family members. Either antibiotics failed to eliminate bacteremic infection, resulted in partial resolution of symptoms, or potentially reinfection occurred during the 19-month study period. There is a substantial need for clinical research to clarify the extent to which Bartonella spp. bacteremia induces nonspecific cardiovascular, neurologic, or rheumatologic symptoms, for ongoing improvement in the sensitivity and specificity of diagnostic testing, and clarification as to if, when, and how to treat patients with documented Bartonella spp. bacteremia.}, number={4}, journal={Vector-Borne and Zoonotic Diseases}, publisher={Mary Ann Liebert Inc}, author={Breitschwerdt, Edward B. and Maggi, Ricardo G. and Quach, Caroline and Bradley, Julie M.}, year={2019}, month={Apr}, pages={234–241} }
 @article{westmoreland_stoskopf_sheppard_deperno_gould_olfenbuttel_maggi_2019, title={Detection and Prevalence of Babesia spp. in American Black Bears (Ursus americanus) from Eastern and Western North Carolina, USA}, volume={55}, ISSN={0090-3558}, url={http://dx.doi.org/10.7589/2018-06-164}, DOI={10.7589/2018-06-164}, abstractNote={Blood samples collected from American black bears ( Ursus americanus) in eastern and western North Carolina, US, were analyzed for piroplasms. Piroplasmids were detected in 17% (23/132) of the animals surveyed. We detected a Babesia spp. previously identified in North American raccoons ( Procyon lotor) and a maned wolf ( Chrysocyon brachyurus); prevalence was 22% (14/64) and 13% (9/68) in the mountain and coastal black bear populations, respectively. The presence of the same Babesia species in black bears, raccoons, and a maned wolf suggests piroplasms may not be host specific.}, number={3}, journal={Journal of Wildlife Diseases}, publisher={Wildlife Disease Association}, author={Westmoreland, Lori S. H. and Stoskopf, Michael K. and Sheppard, Erica and DePerno, Christopher S. and Gould, Nicholas P. and Olfenbuttel, Colleen and Maggi, Ricardo G.}, year={2019}, month={Jul}, pages={678} }
 @article{maggi_toliver_richardson_mather_breitschwerdt_2019, title={Regional prevalences of Borrelia burgdorferi, Borrelia bissettiae, and Bartonella henselae in Ixodes affinis, Ixodes pacificus and Ixodes scapularis in the USA}, volume={10}, ISSN={1877-959X}, url={http://dx.doi.org/10.1016/j.ttbdis.2018.11.015}, DOI={10.1016/j.ttbdis.2018.11.015}, abstractNote={The objective of this work was to determine the prevalence of Borrelia and Bartonella species in Ixodes spp. ticks collected from 16 USA states. Genus PCR amplification and sequence analysis of Bartonella and Borrelia 16SsRNA-23SsRNA intergenic regions were performed on DNA extracted from 929 questing adult ticks (671 Ixodes scapularis, 155 Ixodes affinis, and 103 Ixodes pacificus). Overall, 129/929 (13.9%) Ixodes ticks were PCR positive for Borrelia burgdorferi sensu stricto, 48/929 for B. bissettiae whereas 23/929 (2.5%) were PCR positive for a Bartonella henselae. Borrelia bissettiae or B. burgdorferi s.s. and B. henselae co-infections were found in I. affinis from North Carolina at a rate of 4.5%; in a single I. scapularis from Minnesota, but not in I. pacificus. For both bacterial genera, PCR positive rates were highly variable depending on geographic location and tick species, with Ixodes affinis (n = 155) collected from North Carolina, being the tick species with the highest prevalence’s for both Borrelia spp. (63.2%) and B. henselae (10.3%). Based on the results of this and other published studies, improved understanding of the enzootic cycle, transmission dynamics, and vector competence of Ixodes species (especially I. affinis) for transmission of Borrelia spp. and B. henselae should be a public health research priority.}, number={2}, journal={Ticks and Tick-borne Diseases}, publisher={Elsevier BV}, author={Maggi, Ricardo G. and Toliver, Marcée and Richardson, Toni and Mather, Thomas and Breitschwerdt, Edward B.}, year={2019}, month={Feb}, pages={360–364} }
 @article{jaffe_chomel_kasten_breitschwerdt_maggi_mcleish_zieger_2018, title={Bartonella henselae in small Indian mongooses ( Herpestes auropunctatus ) from Grenada, West Indies}, volume={216}, ISSN={0378-1135}, url={http://dx.doi.org/10.1016/j.vetmic.2018.02.009}, DOI={10.1016/j.vetmic.2018.02.009}, abstractNote={Many mammals are established hosts for the vector borne bacterial genus, Bartonella. Small Indian mongooses (Herpestes auropunctatus) have only been reported as a possible host for Bartonella henselae in southern Japan. Confirming Bartonella presence in mongooses from other regions in the world may support their role as potential reservoirs of this human pathogen. Specifically, documenting Bartonella in Caribbean mongooses would identify a potential source of zoonotic risk with mongoose-human contact in the New World. Using serological and molecular techniques, we investigated B. henselae DNA and specific antibody prevalence in 171 mongooses from all six parishes in Grenada, West Indies. Almost a third (32.3%, 54/167) of the tested mongooses were B. henselae seropositive and extracted DNA from 18/51 (35.3%) blood pellets were PCR positive for the citrate synthase (gltA) and/or the β subunit of RNA polymerase (rpoB) genes. All sequences were identical to B. henselae genotype I, as previously reported from Japan. This study confirms the role of small Indian mongooses as a natural reservoir of B. henselae in the New World.}, journal={Veterinary Microbiology}, publisher={Elsevier BV}, author={Jaffe, David A. and Chomel, Bruno B. and Kasten, Rickie W. and Breitschwerdt, Edward B. and Maggi, Ricardo G. and McLeish, Ashleigh and Zieger, Ulrike}, year={2018}, month={Mar}, pages={119–122} }
 @article{breitschwerdt_maggi_2018, title={Bartonella quintana and Bartonella vinsonii subsp. vinsonii bloodstream co-infection in a girl from North Carolina, USA}, volume={208}, ISSN={0300-8584 1432-1831}, url={http://dx.doi.org/10.1007/s00430-018-0563-0}, DOI={10.1007/s00430-018-0563-0}, abstractNote={The genus Bartonella consists of globally distributed and highly diverse alpha-proteobacteria that infect a wide-range of mammals. Medically, Bartonella spp. constitute emerging, vector-borne, zoonotic, intravascular organisms that induce long-lasting bacteremia in reservoir-adapted (passive carrier of a microorganism) hosts. At times, these bacteria are accidentally transmitted by animal scratches, bites, needles sticks or vectors to animal or human hosts. We report the first documented human case of blood stream infection with Bartonella vinsonii subsp. vinsonii in a girl from North Carolina, USA, who was co-infected with Bartonella quintana. Limitations of Bartonella spp. serology and the challenges of microbiological culture and molecular diagnostic confirmation of co-infection with more than one Bartonella spp. are discussed. When and where these infections were acquired is unknown; however, exposure to rodents, fleas and cats in the peri-equestrian environment was a suspected source for transmission of both organisms.}, number={1}, journal={Medical Microbiology and Immunology}, publisher={Springer Science and Business Media LLC}, author={Breitschwerdt, Edward B. and Maggi, Ricardo G.}, year={2018}, month={Sep}, pages={101–107} }
 @article{neupane_hegarty_marr_maggi_birkenheuer_breitschwerdt_2018, title={Evaluation of cell culture-grown Bartonella
 antigens in immunofluorescent antibody assays for the serological diagnosis of bartonellosis in dogs}, volume={32}, ISSN={0891-6640}, url={http://dx.doi.org/10.1111/jvim.15301}, DOI={10.1111/jvim.15301}, abstractNote={BackgroundBecause of poor sensitivity and questionable specificity of immunofluorescent antibody assays (IFAs), serological diagnosis of Bartonella species infections in dogs remains challenging. Despite limitations, IFA testing is the historical “gold standard” for Bartonella serodiagnosis in animals and humans. Because most diagnostic laboratories test against only 1 or 2 Bartonella spp., testing against a broader panel of Bartonella antigens may enhance diagnostic sensitivity and specificity.}, number={6}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Neupane, Pradeep and Hegarty, Barbara C. and Marr, Henry S. and Maggi, Ricardo G. and Birkenheuer, Adam J. and Breitschwerdt, Edward B.}, year={2018}, month={Oct}, pages={1958–1964} }
 @article{jarred_lewbart_stover_thomas_maggi_breitschwerdt_2018, title={Identification of Hemotropic Mycoplasmas in an Eastern Box Turtle (Terrapene carolina carolina) and a Yellow-bellied Slider (Trachemys scripta scripta) from North Carolina, USA}, volume={54}, ISSN={0090-3558}, url={http://dx.doi.org/10.7589/2017-07-153}, DOI={10.7589/2017-07-153}, abstractNote={Abstract:  Mycoplasma spp. are known from several chelonian and other reptilian species. We determined if turtles obtained by the Turtle Rescue Team at North Carolina State University are carriers of hemotropic Mycoplasma or Bartonella spp. Spleen samples were collected at necropsy during May through July, 2014 from 53 turtles of seven species. All turtles were dead or were euthanized upon arrival due to severe traumatic injuries, or they died shortly after beginning treatment. We used PCR amplification for both bacterial genera; Bartonella spp. DNA was not amplified. Based upon sequencing of the 16S rRNA subunit, one eastern box turtle (Terrapene carolina carolina) and one yellow-bellied slider (Trachemys scripta scripta) were infected with Mycoplasma spp. that have genetic similarities to strains that infect other animals.}, number={2}, journal={Journal of Wildlife Diseases}, publisher={Wildlife Disease Association}, author={Jarred, Jo and Lewbart, Gregory A. and Stover, Kelsey and Thomas, Brittany and Maggi, Ricardo and Breitschwerdt, Edward B.}, year={2018}, month={Apr}, pages={371–374} }
 @article{mozayeni_maggi_bradley_breitschwerdt_2018, title={Rheumatological presentation of Bartonella koehlerae and Bartonella henselae bacteremias}, volume={97}, ISSN={0025-7974}, url={http://dx.doi.org/10.1097/MD.0000000000010465}, DOI={10.1097/md.0000000000010465}, abstractNote={Introduction: Systemic Bartonella spp. infections are being increasingly reported in association with complex medical presentations. Individuals with frequent arthropod exposures or animal contact appear to be at risk for acquiring long standing infections with Bartonella spp. Case report: This case report describes infections with Bartonella koehlerae and Bartonella henselae in a female veterinarian whose symptoms were predominantly rheumatologic in nature. Infection was confirmed by serology, polymerase chain reaction (PCR), enrichment blood culture, and DNA sequencing of amplified B koehlerae and B henselae DNA. Long-term medical management with antibiotics was required to achieve elimination of these infections and was accompanied by resolution of the patient's symptoms. Interestingly, the patient experienced substantial improvement in the acquired joint hypermobility mimicking Ehlers–Danlos Syndrome (EDS) type III. Conclusion: To facilitate early and directed medical interventions, systemic bartonellosis should potentially be considered as a differential diagnosis in patients with incalcitrant rheumatological symptoms and frequent arthropod exposures or extensive animal contact.}, number={17}, journal={Medicine}, publisher={Ovid Technologies (Wolters Kluwer Health)}, author={Mozayeni, Bobak Robert and Maggi, Ricardo Guillermo and Bradley, Julie Meredith and Breitschwerdt, Edward Bealmear}, year={2018}, month={Apr}, pages={e0465} }
 @article{westmoreland_stoskopf_maggi_2017, title={Detection and prevalence of four different hemotropic Mycoplasma spp. in Eastern North Carolina American black bears (Ursus americanus)}, volume={50}, ISSN={0147-9571}, url={http://dx.doi.org/10.1016/j.cimid.2016.12.002}, DOI={10.1016/j.cimid.2016.12.002}, abstractNote={Hemotropic Mycoplasma spp. are globally emerging, obligate parasitic, epierythrocytic bacteria that infect many vertebrates, including humans. Hemoplasma infection can cause acute life-threatening symptoms or lead to a chronic sub-clinical carrier state. Hemotropic Mycoplasma spp. transmission, prevalence, and host specificity are uncertain. The purpose of this study was to determine the molecular prevalence of Mycoplasma species in blood from 68 free-ranging black bears from the eastern coast of North Carolina. DNA amplification of Mycoplasma 16S rRNA gene identified four distinct species infecting 34/68 (50%) of the black bear blood samples, including Candidatus M. haematoparvum. The high prevalence of hemotropic Mycoplasma infection in this wildlife species highlights the importance of understanding intra and inter species transmission. Black bears may play a role in the transmission of hemotropic Mycoplasma spp. between animals, arthropod vectors, and humans. Further studies are needed to elucidate black bears as a potential reservoir for hemotropic Mycoplasma infections.}, journal={Comparative Immunology, Microbiology and Infectious Diseases}, publisher={Elsevier BV}, author={Westmoreland, Lori S.H. and Stoskopf, Michael K. and Maggi, Ricardo G.}, year={2017}, month={Feb}, pages={106–109} }
 @article{tabar_altet_maggi_altimira_roura_2017, title={First description of Bartonella koehlerae infection in a Spanish dog with infective endocarditis}, volume={10}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/s13071-017-2188-3}, DOI={10.1186/s13071-017-2188-3}, abstractNote={Bartonella koehlerae has been recently described as a new cat- and cat fleas-associated agent of culture-negative human endocarditis. It has been also encountered in one dog from Israel and six dogs from the USA, but other clinically relevant reports involving this bacterium are lacking. A 7-year-old intact male mixed dog presented with clinico-pathological signs consistent with mitral endocarditis and cutaneous hemangiosarcoma. Molecular studies revealed the presence of Bartonella koehlerae DNA in samples from blood and mitral valve tissue. This is the first description of B. koehlerae in Spain, corroborating that it can also be detected in dogs. Bartonella koehlerae infection should also be considered in Spain in humans and dogs presenting with clinical disease suggestive of it, such as culture-negative endocarditis.}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Tabar, María-Dolores and Altet, Laura and Maggi, Ricardo G. and Altimira, Jaume and Roura, Xavier}, year={2017}, month={May} }
 @article{oteo_maggi_portillo_bradley_garcía-álvarez_san-martín_roura_breitschwerdt_2017, title={Prevalence of Bartonella spp. by culture, PCR and serology, in veterinary personnel from Spain}, volume={10}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/s13071-017-2483-z}, DOI={10.1186/s13071-017-2483-z}, abstractNote={The genus Bartonella includes fastidious, facultative intracellular bacteria mainly transmitted by arthropods and distributed among mammalian reservoirs. Bartonella spp. implicated as etiological agents of zoonoses are increasing. Apart from the classical Bartonella henselae, B. bacilliformis or B. quintana, other species (B. elizabethae, B. rochalimae, B. vinsonii arupensis and B. v. berkhoffii, B. tamiae or B. koehlerae, among others) have also been associated with human and/or animal diseases. Laboratory techniques for diagnosis (culture, PCR assays and serology) usually show lack of sensitivity. Since 2005, a method based on a liquid enrichment Bartonella alphaproteobacteria growth medium (BAPGM) followed by PCRs for the amplification of Bartonella spp. has been developed. We aimed to assess culture, molecular and serological prevalence of Bartonella infections in companion animal veterinary personnel from Spain. Each of 89 participants completed a questionnaire. Immunofluorescence assays (IFA) using B. vinsonii berkhoffii (genotypes I, II and III), B. henselae, B. quintana and B. koehlerae as antigens were performed. A cut-off of 1:64 was selected as a seroreactivity titer. Blood samples were inoculated into BAPGM and subcultured onto blood agar plates. Bartonella spp. was detected using conventional and quantitative real-time PCR assays and DNA sequencing. Among antigens corresponding to six Bartonella spp. or genotypes, the lowest seroreactivity was found against B. quintana (11.2%) and the highest, against B. v. berkhoffii genotype III (56%). A total of 27% of 89 individuals were not seroreactive to any test antigen. Bartonella spp. IFA seroreactivity was not associated with any clinical sign or symptom. DNA from Bartonella spp., including B. henselae (n = 2), B. v. berkhoffii genotypes I (n = 1) and III (n = 2), and B. quintana (n = 2) was detected in 7/89 veterinary personnel. PCR and DNA sequencing findings were not associated with clinical signs or symptoms. No co-infections were observed. One of the two B. henselae PCR-positive individuals was IFA seronegative to all tested antigens whereas the other one was not B. henselae seroreactive. The remaining PCR-positive individuals were seroreactive to multiple Bartonella spp. antigens. High serological and molecular prevalences of exposure to, or infection with, Bartonella spp. were found in companion animal veterinary personnel from Spain. More studies using BAPGM enrichment blood culture and PCR are needed to clarify the finding of Bartonella PCR-positive individuals lacking clinical symptoms.}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Oteo, José A. and Maggi, Ricardo and Portillo, Aránzazu and Bradley, Julie and García-Álvarez, Lara and San-Martín, Montserrat and Roura, Xavier and Breitschwerdt, Edward}, year={2017}, month={Nov} }
 @article{messinger_gurzau_breitschwerdt_tomuleasa_trufan_flonta_maggi_berindan-neagoe_rabinowitz_2017, title={Seroprevalence of Bartonella
 species, Coxiella burnetii
 and Toxoplasma gondii
 among patients with hematological malignancies: A pilot study in Romania}, volume={64}, ISSN={1863-1959}, url={http://dx.doi.org/10.1111/zph.12353}, DOI={10.1111/zph.12353}, abstractNote={Summary}, number={6}, journal={Zoonoses and Public Health}, publisher={Wiley}, author={Messinger, C. J. and Gurzau, E. S. and Breitschwerdt, E. B. and Tomuleasa, C. I. and Trufan, S. J. and Flonta, M. M. and Maggi, R. G. and Berindan-Neagoe, I. and Rabinowitz, P. M.}, year={2017}, month={Mar}, pages={485–490} }
 @article{mascarelli_tartara_pereyra_maggi_2016, title={Detection of Mycoplasma haemocanis, Mycoplasma haematoparvum, Mycoplasma suis and other vector-borne pathogens in dogs from Córdoba and Santa Fé, Argentina}, volume={9}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/s13071-016-1920-8}, DOI={10.1186/s13071-016-1920-8}, abstractNote={In Argentina, only very few reports are available for canine tick-borne diseases where most are related to parasitic diseases. The objective of this survey was to investigate the prevalence of tick-borne pathogens in 70 dogs from Santa Fé and Córdoba, Argentina. Microscopic blood smear examination as well as polymerase chain reaction (PCR) amplification using species-specific markers of Anaplasma, Babesia, Bartonella, Borrelia, Ehrlichia, Francisella, Mycoplasma (hemotropic group) and Rickettsia, followed by DNA sequencing were used to establish the prevalence of each infecting pathogen. Blood smear analysis showed 81% (57/70) prevalence of structures morphologically compatible with hemotropic mycoplasmas. No structures resembling either piroplasms or Anaplasma/Ehrlichia were detected. Hemotropic mycoplasma species (Mycoplasma haematoparvum, Mycoplasma haemocanis and Mycoplasma suis) were the most prevalent pathogens detected with an overall prevalence of 77.1%. Anaplasma platys was detected and identified in 11 of the 70 dogs (15.7%), meanwhile two Bartonella spp. (B. clarridgeiae and an uncharacterized Bartonella sp.) and Babesia vogeli were detected at 3 and 7% prevalence, respectively. The work presented here describes a high molecular prevalence for hemotropic mycoplasma species in each of the five locations selected. Three Mycoplasma spp., including Mycoplasma suis, reported for the first time in dogs have been identified by DNA amplification and sequencing. This study highlights the risk that these bacterial pathogens represent for companion animals and, due to their potential zoonotic nature, also for people.}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Mascarelli, Patricia E. and Tartara, Gustavo P. and Pereyra, Norma B. and Maggi, Ricardo G.}, year={2016}, month={Dec} }
 @article{huang_ge_eseryel_2016, title={Metaconceptually-enhanced simulation-based inquiry: effects on eighth grade students’ conceptual change and science epistemic beliefs}, volume={65}, ISSN={1042-1629 1556-6501}, url={http://dx.doi.org/10.1007/S11423-016-9462-5}, DOI={10.1007/s11423-016-9462-5}, number={1}, journal={Educational Technology Research and Development}, publisher={Springer Science and Business Media LLC}, author={Huang, Kun and Ge, Xun and Eseryel, Deniz}, year={2016}, month={Jul}, pages={75–100} }
 @article{sultana_patel_toliver_maggi_neelakanta_2016, title={Molecular identification and bioinformatics analysis of a potential anti-vector vaccine candidate, 15-kDa salivary gland protein (Salp15), from Ixodes affinis ticks}, volume={7}, ISSN={1877-959X}, url={http://dx.doi.org/10.1016/j.ttbdis.2015.08.003}, DOI={10.1016/j.ttbdis.2015.08.003}, abstractNote={Salp15, a 15-kDa salivary gland protein plays an important role in tick blood-feeding and transmission of Borrelia burgdorferi, the causative agent of Lyme borreliosis. The comparative studies reveal that Salp15 is a genetically conserved protein across various Ixodes species. In this study, we have identified a Salp15 homolog, designated as Iaff15, from Ixodes affinis ticks that are the principal enzootic vectors of B. burgdorferi sensu stricto in the southeastern part of the United States. Comparison of the annotated amino acid sequences showed that Iaff15 share 81% homology with I. sinensis Salp15 homolog and 64% homology with I. scapularis Salp15. Phylogenetic analysis revealed that Iaff15 come within the same clade with I. sinensis, I. scapularis, and I. pacificus Salp15 homologs. The bioinformatics analysis of the posttranslational modifications prediction revealed that all the Salp15 family members contain glycosylation sites. In addition, Iaff15 carried a higher number of Casein Kinase II phosphorylation sites in comparison to the other Salp15 family members. Collectively, high sequence conservation distributed over the entire amino acids sequence not only suggests an important role for Iaff15 in I. affinis blood feeding and vector-pathogen interactions but may also lead to the development of an anti-vector vaccine against this group of ticks.}, number={1}, journal={Ticks and Tick-borne Diseases}, publisher={Elsevier BV}, author={Sultana, Hameeda and Patel, Unnati and Toliver, Marcée and Maggi, Ricardo G. and Neelakanta, Girish}, year={2016}, month={Feb}, pages={46–53} }
 @article{westmoreland_stoskopf_maggi_2016, title={Prevalence of Anaplasma phagocytophilum in North Carolina Eastern Black Bears (Ursus americanus)}, volume={52}, ISSN={0090-3558}, url={http://dx.doi.org/10.7589/2016-02-036}, DOI={10.7589/2016-02-036}, abstractNote={Abstract We detected Anaplasma phagocytophilum by DNA amplification in whole blood from free-ranging, hunter-killed American black bears (Ursus americanus) from the east coast of North Carolina, US. Molecular prevalence for Anaplasma phagocytophilum was 3% from 68 black bears. No DNA of other Anaplasma or Ehrlichia spp. was identified.}, number={4}, journal={Journal of Wildlife Diseases}, publisher={Wildlife Disease Association}, author={Westmoreland, Lori S. H. and Stoskopf, Michael K. and Maggi, Ricardo G.}, year={2016}, month={Oct}, pages={968–970} }
 @article{balakrishnan_ericson_maggi_breitschwerdt_2016, title={Vasculitis, cerebral infarction and persistent Bartonella henselae infection in a child}, volume={9}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/s13071-016-1547-9}, DOI={10.1186/s13071-016-1547-9}, abstractNote={The genus Bartonella is comprised of a rapidly increasing number of pathogenic species that induce a seemingly diverse spectrum of neurological symptoms. During the 12 year period that followed the initial onset of neurological and gastrointestinal symptoms, an 11 year-old girl experienced a spectrum of neurological complaints including frequent headaches, visual and auditory hallucinations, anxiety, vision loss involving the lower left quadrant of both eyes, episodic bouts of generalized paralysis, facial palsy, chronic insomnia, seizures, dizziness, cognitive dysfunction, and memory loss. PCR assays targeting Bartonella spp. were used to test formalin-fixed, paraffin embedded brain tissue, patient blood specimens and Bartonella alpha Proteobacteria growth medium (BAPGM) enrichment blood cultures. PCR positive amplicons were sequenced directly and compared to GenBank sequences. Bartonella spp. serology was performed by indirect fluorescent antibody testing and confocal laser scanning microscopy was used to visualize B. henselae organisms in resected brain. Bartonella henselae DNA was independently PCR amplified and sequenced from the girl’s right parietal lobe, surgically resected in 2000 and from a blood specimen collected in 2012. Although causation cannot be established by a case report, prior diagnostic testing resulted in findings that were either inconclusive or within normal reference ranges and no etiological diagnosis had been obtained to explain the patient’s initial or progressive neurological symptoms. As intravascular, intra-erythrocytic and endotheliotropic bacteria, it is possible that B. henselae initially induced a vasculitis, resulting in secondary cerebral infarction, tissue necrosis and surgical resection. Bartonella bacteremia, potentially spanning a 12-year time frame, in conjunction with the therapeutic administration of immunosuppressive drugs may have resulted in a progression and potentiation of the neurological disease that was partially reversible following antibiotic administration.}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Balakrishnan, Nandhakumar and Ericson, Marna and Maggi, Ricardo and Breitschwerdt, Edward B.}, year={2016}, month={May} }
 @article{carrasco_chomel_gill_kasten_maggi_breitschwerdt_byrne_burek-huntington_miller_goldstein_et al._2015, title={Erratum to ‘Novel Bartonella infection in northern and southern sea otters (Enhydra lutris kenyoni and Enhydra lutris nereis)’}, volume={181}, ISSN={0378-1135}, url={http://dx.doi.org/10.1016/j.vetmic.2015.11.006}, DOI={10.1016/j.vetmic.2015.11.006}, number={3-4}, journal={Veterinary Microbiology}, publisher={Elsevier BV}, author={Carrasco, Sebastian E. and Chomel, Bruno B. and Gill, Verena A. and Kasten, Rickie W. and Maggi, Ricardo G. and Breitschwerdt, Edward B. and Byrne, Barbara A. and Burek-Huntington, Kathleen A. and Miller, Melissa A. and Goldstein, Tracey and et al.}, year={2015}, month={Dec}, pages={336} }
 @article{maggi_balakrishnan_bradley_breitschwerdt_2015, title={Infection with Bartonella henselae in a Danish Family}, volume={53}, ISSN={0095-1137 1098-660X}, url={http://dx.doi.org/10.1128/JCM.02974-14}, DOI={10.1128/jcm.02974-14}, abstractNote={ABSTRACT}, number={5}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Maggi, Ricardo G. and Balakrishnan, Nandhakumar and Bradley, Julie M. and Breitschwerdt, Edward B.}, editor={Fenwick, B. W.Editor}, year={2015}, month={Mar}, pages={1556–1561} }
 @article{o’nion_montilla_qurollo_maggi_hegarty_tornquist_breitschwerdt_2015, title={Potentially Novel Ehrlichia Species in Horses, Nicaragua}, volume={21}, ISSN={1080-6040 1080-6059}, url={http://dx.doi.org/10.3201/eid2102.140290}, DOI={10.3201/eid2102.140290}, abstractNote={Ehrlichia sp. DNA was amplified from 4 Ehrlichia-seroreactive horses from Mérida, Nicaragua. Sequencing of 16S rDNA, sodB, and groEL genes indicated that the bacterium is most likely a novel Ehrlichia species. The tick vector and the potential for canine and human infection remain unknown.}, number={2}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={O’Nion, Victoria L. and Montilla, Hernan J. and Qurollo, Barbara A. and Maggi, Ricardo G. and Hegarty, Barbara C. and Tornquist, Susan J. and Breitschwerdt, Edward B.}, year={2015}, month={Feb}, pages={335–338} }
 @article{pultorak_linder_maggi_balakrishnan_breitschwerdt_2015, title={Prevalence of Bartonella spp. in Canine Cutaneous Histiocytoma}, volume={153}, ISSN={0021-9975}, url={http://dx.doi.org/10.1016/j.jcpa.2015.04.001}, DOI={10.1016/j.jcpa.2015.04.001}, abstractNote={Canine cutaneous histiocytoma (CCH) is a common, benign neoplastic proliferation of histiocytes of Langerhans cell origin that often ulcerate, become secondarily infected and regress spontaneously. Bartonella is a fastidious genus of facultative intracellular pathogens that can be transmitted through arthropod bites and epidermal animal scratches and has been identified previously in the cytoplasm of histiocytes within granulomatous lesions and in skin biopsy samples of inflammatory pustules and papules. Based on the established inflammatory and oncogenic properties of Bartonella, we hypothesized that Bartonella spp. DNA could be amplified from CCH more often than from non-lesional skin and bacteria could be localized within skin tumours using indirect immunofluorescence (IIF). Paraffin wax-embedded surgical biopsy samples from dogs with CCH and non-neoplastic skin adjacent to osteosarcomas (control group selected due to wide surgical margins) were retrieved from the archive of the pathology service of North Carolina State University College of Veterinary Medicine. DNA was extracted and regions of the 16S–23S rRNA intergenic transcribed spacer (ITS) region and the pap31 and gltA genes were amplified by polymerase chain reaction (PCR) using Bartonella-specific primers. IIF was performed using a primary Bartonella henselae monoclonal antibody to localize B. henselae in tissues of PCR-positive dogs. Bartonella vinsonii subsp. berkhoffii was amplified from 1/17 (5.8%) control tissues and B. henselae was amplified from 4/29 (13.8%) CCH tissues. The prevalence of B. vinsonii subsp. berkhoffii (P = 0.37) or B. henselae (P = 0.28) did not vary statistically between study groups. B. henselae could be visualized in 2/4 (50.0%) CCH tissues using IIF. Based on this study, Bartonella spp. are unlikely to cause CCH.}, number={1}, journal={Journal of Comparative Pathology}, publisher={Elsevier BV}, author={Pultorak, E.L. and Linder, K. and Maggi, R.G. and Balakrishnan, N. and Breitschwerdt, E.B.}, year={2015}, month={Jul}, pages={14–21} }
 @article{tham_linder_tucker_maggi_bizikova_2015, title={Protozoal nodular dermatitis and panniculitis in a Rottweiler puppy caused by Caryospora bigenetica}, volume={27}, ISSN={0959-4493}, url={http://dx.doi.org/10.1111/vde.12271}, DOI={10.1111/vde.12271}, abstractNote={BackgroundCaryospora bigenetica is an intracellular protozoan parasite in snakes and raptors (primary hosts) and rodents (secondary host). Experimental infection has been documented in mice, pigs and goats; natural infection in dogs is rare.}, number={1}, journal={Veterinary Dermatology}, publisher={Wiley}, author={Tham, Heng L. and Linder, Keith E. and Tucker, Alison and Maggi, Ricardo and Bizikova, Petra}, year={2015}, month={Nov}, pages={44–e12} }
 @article{mascarelli_elmore_jenkins_alisauskas_walsh_breitschwerdt_maggi_2015, title={Vector-borne pathogens in arctic foxes, Vulpes lagopus, from Canada}, volume={99}, ISSN={0034-5288}, url={http://dx.doi.org/10.1016/j.rvsc.2014.12.011}, DOI={10.1016/j.rvsc.2014.12.011}, abstractNote={Because of the relatively low biodiversity within arctic ecosystems, arctic foxes, Vulpes lagopus, could serve as sentinels for the study of changes in the ecology of vector-borne zoonotic pathogens. The objective of this study was to determine the molecular prevalence of 5 different genera of vector borne pathogens (Anaplasma, Babesia, Bartonella, Ehrlichia, and Hemotropic Mycoplasma spp.) using blood collected from 28 live-trapped arctic foxes from the region of Karrak Lake, Nunavut, Canada. Bartonella henselae (n = 3), Mycoplasma haemocanis (n = 1), Ehrlichia canis (n = 1), and an Anaplasma sp. (n = 1) DNA were PCR amplified and subsequently identified by sequencing. This study provides preliminary evidence that vector borne pathogens, not typically associated with the arctic ecosystem, exist at low levels in this arctic fox population, and that vector exposure, pathogen transmission dynamics, and changes in the geographic distribution of pathogens over time should be investigated in future studies.}, journal={Research in Veterinary Science}, publisher={Elsevier BV}, author={Mascarelli, Patricia E. and Elmore, Stacey A. and Jenkins, Emily J. and Alisauskas, Ray T. and Walsh, Mary and Breitschwerdt, Edward B. and Maggi, Ricardo G.}, year={2015}, month={Apr}, pages={58–59} }
 @article{bradley_mascarelli_trull_maggi_breitschwerdt_2014, title={Bartonella henselae Infections In An Owner and Two Papillon Dogs Exposed to Tropical Rat Mites (Ornithonyssus bacoti)}, volume={14}, ISSN={1530-3667 1557-7759}, url={http://dx.doi.org/10.1089/vbz.2013.1492}, DOI={10.1089/vbz.2013.1492}, abstractNote={After raccoons were trapped and removed from under a house in New York, the owner and her two Papillon dogs became infested with numerous rat mites (Ornithonyssus bacoti). Two weeks later, both dogs developed pruritus, progressively severe vesicular lesions, focal areas of skin exfoliation, swelling of the vulva or prepuce, abdominal pain, and behavioral changes. Two months after the mite infestation, the owner was hospitalized because of lethargy, fatigue, uncontrollable panic attacks, depression, headaches, chills, swollen neck lymph nodes, and vesicular lesions at the mite bite sites. Due to ongoing illness, 3 months after the mite infestation, alcohol-stored mites and blood and serum from both dogs and the owner were submitted for Bartonella serology and Bartonella alpha Proteobacteria growth medium (BAPGM) enrichment blood culture/PCR. Bartonella henselae DNA was amplified and sequenced from blood or culture specimens derived from both dogs, the owner, and pooled rat mites. Following repeated treatments with doxycycline, both dogs eventually became B. henselae seronegative and blood culture negative and clinical signs resolved. In contrast, the woman was never B. henselae seroreactive, but was again PCR positive for B. henselae 20 months after the mite infestation, despite prior treatment with doxycycline. Clinicians and vector biologists should consider the possibility that rat mites may play a role in Bartonella spp. transmission.}, number={10}, journal={Vector-Borne and Zoonotic Diseases}, publisher={Mary Ann Liebert Inc}, author={Bradley, Julie M. and Mascarelli, Patricia E. and Trull, Chelsea L. and Maggi, Ricardo G. and Breitschwerdt, Edward B.}, year={2014}, month={Oct}, pages={703–709} }
 @article{tucker_sellon_tucker_wills_simonsen_maggi_breitschwerdt_2014, title={Bilateral mandibular pyogranulomatous lymphadenitis and pulmonary nodules in a dog with Bartonella henselae bacteremia}, volume={55}, number={10}, journal={Canadian Veterinary Journal}, author={Tucker, M. D. and Sellon, R. K. and Tucker, R. L. and Wills, T. B. and Simonsen, A. and Maggi, R. G. and Breitschwerdt, E. B.}, year={2014}, pages={970–974} }
 @article{qurollo_balakrishnan_cannon_maggi_breitschwerdt_2014, title={Co-infection with Anaplasma platys, Bartonella henselae, Bartonella koehlerae and ‘Candidatus Mycoplasma haemominutum’ in a cat diagnosed with splenic plasmacytosis and multiple myeloma}, volume={16}, ISSN={1098-612X 1532-2750}, url={http://dx.doi.org/10.1177/1098612X13519632}, DOI={10.1177/1098612x13519632}, abstractNote={Anaplasma platys ( Apl), ‘ Candidatus Mycoplasma haemominutum’ ( CMh), Bartonella henselae ( Bh) and Bartonella koehlerae ( Bk) were confirmed by polymerase chain reaction (PCR) amplification and DNA sequencing in a cat diagnosed with multiple myeloma. Other inconsistently documented hematologic abnormalities included anemia, thrombocytopenia, eosinophilia and hypoglycemia. Persistent Apl infection was confirmed for the first time in a North American cat by sequencing three bacterial genes ( 16S rRNA, p44 and GroEL) in peripheral blood samples collected 100 days apart. Following doxycycline treatment for Apl, multiple myeloma was diagnosed based upon a monoclonal gammopathy and splenic plasmacytosis, and the cat was treated with melphalan, chlorambucil and prednisolone. Apl DNA was not amplified from post-treatment blood samples and the hyperglobulinemia resolved temporarily following chemotherapy. Retrospective PCR analysis of stored DNA extracts identified CMh, Bk and Bh infections. Retrospective PCR for antigen receptor rearrangements (PARR) of splenic aspirates did not confirm B- or T-cell clonality. Co-infection with multiple vector-borne pathogens should be a diagnostic consideration in cats with chronic hypergammaglobulinemia, monoclonal gammopathy and splenic plasmacytosis.}, number={8}, journal={Journal of Feline Medicine and Surgery}, publisher={SAGE Publications}, author={Qurollo, Barbara A and Balakrishnan, Nandhakumar and Cannon, Coralie Zegre and Maggi, Ricardo G and Breitschwerdt, Edward B}, year={2014}, month={Jan}, pages={713–720} }
 @article{maggi_birkenheuer_hegarty_bradley_levy_breitschwerdt_2014, title={Comparison of serological and molecular panels for diagnosis of vector-borne diseases in dogs}, volume={7}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/1756-3305-7-127}, DOI={10.1186/1756-3305-7-127}, abstractNote={Canine vector-borne diseases (CVBD) are caused by a diverse array of pathogens with varying biological behaviors that result in a wide spectrum of clinical presentations and laboratory abnormalities. For many reasons, the diagnosis of canine vector-borne infectious diseases can be challenging for clinicians. The aim of the present study was to compare CVBD serological and molecular testing as the two most common methodologies used for screening healthy dogs or diagnosing sick dogs in which a vector-borne disease is suspected.We used serological (Anaplasma species, Babesia canis, Bartonella henselae, Bartonella vinsonii subspecies berkhoffii, Borrelia burgdorferi, Ehrlichia canis, and SFG Rickettsia) and molecular assays to assess for exposure to, or infection with, 10 genera of organisms that cause CVBDs (Anaplasma, Babesia, Bartonella, Borrelia, Ehrlichia, Francisella, hemotropic Mycoplasma, Neorickettsia, Rickettsia, and Dirofilaria). Paired serum and EDTA blood samples from 30 clinically healthy dogs (Group I) and from 69 sick dogs suspected of having one or more canine vector-borne diseases (Groups II-IV), were tested in parallel to establish exposure to or infection with the specific CVBDs targeted in this study.Among all dogs tested (Groups I-IV), the molecular prevalences for individual CVBD pathogens ranged between 23.3 and 39.1%. Similarly, pathogen-specific seroprevalences ranged from 43.3% to 59.4% among healthy and sick dogs (Groups I-IV). Among these representative sample groupings, a panel combining serological and molecular assays run in parallel resulted in a 4-58% increase in the recognition of exposure to or infection with CVBD.We conclude that serological and PCR assays should be used in parallel to maximize CVBD diagnosis.}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Maggi, Ricardo G and Birkenheuer, Adam J and Hegarty, Barbara C and Bradley, Julie M and Levy, Michael G and Breitschwerdt, Edward B}, year={2014}, pages={127} }
 @article{lantos_maggi_ferguson_varkey_park_breitschwerdt_woods_2014, title={Detection of Bartonella Species in the Blood of Veterinarians and Veterinary Technicians: A Newly Recognized Occupational Hazard?}, volume={14}, ISSN={1530-3667 1557-7759}, url={http://dx.doi.org/10.1089/vbz.2013.1512}, DOI={10.1089/vbz.2013.1512}, abstractNote={BACKGROUND
Bartonella species are important emerging pathogens in human and veterinary medicine. In the context of their daily activities, veterinary professionals have frequent animal contact and arthropod exposures. Detection of Bartonella spp. using traditional culture methods has been limited by poor sensitivity, making it difficult to determine the prevalence of infection in this population. We have developed a detection method combining enrichment culture and molecular amplification, which increases testing sensitivity.


METHODS
We performed a cross-sectional study to determine the prevalence of detectable Bartonella spp. in the blood of veterinary personnel and nonveterinary control subjects. Bartonella was detected by enrichment blood culture with conventional PCR followed by DNA sequencing. RESULTS were correlated with epidemiological variables and symptoms.


RESULTS
We detected DNA from at least one Bartonella species in 32 (28%) of the 114 veterinary subjects. After DNA sequencing, the Bartonella species could be determined for 27 of the 32 infected subjects, including B. henselae in 15 (56%), B. vinsonii subsp. berkhoffii in seven (26%), B. koehlerae in six (22%), and a B. volans-like sequence in one (4%). Seventy percent of Bartonella-positive subjects described headache compared with 40% of uninfected veterinarians (p=0.009). Irritability was also reported more commonly by infected subjects (68% vs. 43%, p=0.04).


CONCLUSIONS
Our study supports an emerging body of evidence that cryptic Bartonella bloodstream infection may be more frequent in humans than previously recognized and may induce symptoms. Longitudinal studies are needed to determine the natural course and clinical features of Bartonella infection.}, number={8}, journal={Vector-Borne and Zoonotic Diseases}, publisher={Mary Ann Liebert Inc}, author={Lantos, Paul M. and Maggi, Ricardo G. and Ferguson, Brandy and Varkey, Jay and Park, Lawrence P. and Breitschwerdt, Edward B. and Woods, Christopher W.}, year={2014}, month={Aug}, pages={563–570} }
 @article{chomel_kasten_stuckey_breitschwerdt_maggi_henn_koehler_chang_2014, title={Experimental infection of cats with Afipia felis and various Bartonella species or subspecies}, volume={172}, ISSN={0378-1135}, url={http://dx.doi.org/10.1016/j.vetmic.2014.05.033}, DOI={10.1016/j.vetmic.2014.05.033}, abstractNote={Based upon prior studies, domestic cats have been shown to be the natural reservoir for Bartonella henselae, Bartonella clarridgeiae and Bartonella koehlerae. However, other Bartonella species, such as Bartonella vinsonii subsp. berkhoffii, Bartonella quintana or Bartonella bovis (ex weissii) have been either isolated from or Bartonella DNA sequences PCR amplified and sequenced. In the late 1980s, before B. henselae was confirmed as the etiological agent of cat scratch disease, Afipia felis had been proposed as the causative agent. In order to determine the feline susceptibility to A. felis, B. vinsonii subsp. berkhoffii, Bartonella rochalimae, B. quintana or B. bovis, we sought to detect the presence of bacteremia and seroconversion in experimentally-inoculated cats. Most of the cats seroconverted, but only the cats inoculated with B. rochalimae became bacteremic, indicating that cats are not natural hosts of A. felis or the other Bartonella species or subspecies tested in this study.}, number={3-4}, journal={Veterinary Microbiology}, publisher={Elsevier BV}, author={Chomel, Bruno B. and Kasten, Rickie W. and Stuckey, Matthew J. and Breitschwerdt, Edward B. and Maggi, Ricardo G. and Henn, Jennifer B. and Koehler, Jane E. and Chang, Chao-chin}, year={2014}, month={Aug}, pages={505–510} }
 @article{mascarelli_keel_yabsley_last_breitschwerdt_maggi_2014, title={Hemotropic mycoplasmas in little brown bats (Myotis lucifugus)}, volume={7}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/1756-3305-7-117}, DOI={10.1186/1756-3305-7-117}, abstractNote={Hemotropic mycoplasmas are epicellular erythrocytic bacteria that can cause infectious anemia in some mammalian species. Worldwide, hemotropic mycoplasmas are emerging or re-emerging zoonotic pathogens potentially causing serious and significant health problems in wildlife. The objective of this study was to determine the molecular prevalence of hemotropic Mycoplasma species in little brown bats (Myotis lucifugus) with and without Pseudogymnoascus (Geomyces) destrucans, the causative agent of white nose syndrome (WNS) that causes significant mortality events in bats.In order to establish the prevalence of hemotropic Mycoplasma species in a population of 68 little brown bats (Myotis lucifugus) with (n = 53) and without (n = 15) white-nose syndrome (WNS), PCR was performed targeting the 16S rRNA gene.The overall prevalence of hemotropic Mycoplasmas in bats was 47%, with similar (p = 0.5725) prevalence between bats with WNS (49%) and without WNS (40%). 16S rDNA sequence analysis (~1,200 bp) supports the presence of a novel hemotropic Mycoplasma species with 91.75% sequence homology with Mycoplasma haemomuris. No differences were found in gene sequences generated from WNS and non-WNS animals.Gene sequences generated from WNS and non-WNS animals suggest that little brown bats could serve as a natural reservoir for this potentially novel Mycoplasma species. Currently, there is minimal information about the prevalence, host-specificity, or the route of transmission of hemotropic Mycoplasma spp. among bats. Finally, the potential role of hemotropic Mycoplasma spp. as co-factors in the development of disease manifestations in bats, including WNS in Myotis lucifugus, remains to be elucidated.}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Mascarelli, Patricia E and Keel, Michael K and Yabsley, Michael and Last, Lisa A and Breitschwerdt, Edward B and Maggi, Ricardo G}, year={2014}, pages={117} }
 @article{wolf_cherry_maggi_breitschwerdt_2014, title={In Pursuit of a Stealth Pathogen: Laboratory Diagnosis of Bartonellosis}, volume={36}, ISSN={0196-4399}, url={http://dx.doi.org/10.1016/J.CLINMICNEWS.2014.02.001}, DOI={10.1016/J.CLINMICNEWS.2014.02.001}, abstractNote={Members of the genus Bartonella cause illnesses in humans and animals. Bartonella spp. are gram-negative, fastidious, facultative, intracellular pathogens transmitted by the bites of certain arthropods or by bites and scratches from infected animals. While some of the illnesses are acute and self-limiting, others are chronic, debilitating, and difficult to diagnose. Bartonella spp. are able to invade host cells and modulate the host immune response, contributing to their success as stealth pathogens. This article provides an overview of diseases caused by members of the genus Bartonella and the mechanisms of pathogenesis. The laboratory diagnosis of bartonellosis relies on three primary methods. This article examines the evolution of culture techniques, serology, and nucleic acid amplification tests used to detect Bartonella spp. in clinical specimens and suggests areas for future research to improve laboratory diagnostics. In this way, a better understanding of the epidemiology of bartonellosis can be achieved.}, number={5}, journal={Clinical Microbiology Newsletter}, publisher={Elsevier BV}, author={Wolf, Leslie A. and Cherry, Natalie A. and Maggi, Ricardo G. and Breitschwerdt, Edward B.}, year={2014}, month={Mar}, pages={33–39} }
 @article{breitschwerdt_hegarty_qurollo_saito_maggi_blanton_bouyer_2014, title={Intravascular persistence of Anaplasma platys, Ehrlichia chaffeensis, and Ehrlichia ewingii DNA in the blood of a dog and two family members}, volume={7}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/1756-3305-7-298}, DOI={10.1186/1756-3305-7-298}, abstractNote={Anaplasmosis, caused by Anaplasma phagocytophilum and Anaplasma platys, and ehrlichiosis, caused by Ehrlichia chaffeensis, Ehrlichia ewingii, the "Panola Mountain Ehrlichia" and Ehrlichia muris-like pathogens have been identified as emerging tick borne infectious diseases in dogs and human patients. Persistent intravascular infection with these bacteria is well documented in dogs, but is less well documented in human beings.Serology and PCR targeting multiple microbial genes, followed by DNA sequencing, was used to test sequential blood samples. Tissue culture isolation was attempted in two laboratories.A. platys, E. chaffeensis, and E. ewingii DNA was amplified from two Anaplasma and Ehrlichia seronegative family members and their dog, all lacking typical symptoms of anaplasmosis or ehrlichiosis. Following treatment with doxycycline, the dog and mother were Anaplasma and Ehrlichia spp. PCR negative.Sequential PCR testing provided molecular evidence supporting intravascular persistence of A. platys and Ehrlichia spp. in two humans and their dog. Diagnosticians and clinicians should consider the potential for co-infections due to these tick borne organisms.}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Breitschwerdt, Edward B and Hegarty, Barbara C and Qurollo, Barbara A and Saito, Tais B and Maggi, Ricardo G and Blanton, Lucas S and Bouyer, Donald H}, year={2014}, pages={298} }
 @article{carrasco_chomel_gill_kasten_maggi_breitschwerdt_byrne_burek-huntington_miller_goldstein_et al._2014, title={Novel Bartonella infection in northern and southern sea otters (Enhydra lutris kenyoni and Enhydra lutris nereis)}, volume={170}, ISSN={0378-1135}, url={http://dx.doi.org/10.1016/j.vetmic.2014.02.021}, DOI={10.1016/j.vetmic.2014.02.021}, abstractNote={Since 2002, vegetative valvular endocarditis (VVE), septicemia and meningoencephalitis have contributed to an Unusual Mortality Event (UME) of northern sea otters in southcentral Alaska. Streptococcal organisms were commonly isolated from vegetative lesions and organs from these sea otters. Bartonella infection has also been associated with bacteremia and VVE in terrestrial mammals, but little is known regarding its pathogenic significance in marine mammals. Our study evaluated whether Streptococcus bovis/equinus (SB/E) and Bartonella infections were associated with UME-related disease characterized by VVE and septicemia in Alaskan sea otter carcasses recovered 2004–2008. These bacteria were also evaluated in southern sea otters in California. Streptococcus bovis/equinus were cultured from 45% (23/51) of northern sea otter heart valves, and biochemical testing and sequencing identified these isolates as Streptococcus infantarius subsp. coli. One-third of sea otter hearts were co-infected with Bartonella spp. Our analysis demonstrated that SB/E was strongly associated with UME-related disease in northern sea otters (P < 0.001). While Bartonella infection was also detected in 45% (23/51) and 10% (3/30) of heart valves of northern and southern sea otters examined, respectively, it was not associated with disease. Phylogenetic analysis of the Bartonella ITS region allowed detection of two Bartonella species, one novel species closely related to Bartonella spp. JM-1, B. washoensis and Candidatus B. volans and another molecularly identical to B. henselae. Our findings help to elucidate the role of pathogens in northern sea otter mortalities during this UME and suggested that Bartonella spp. is common in sea otters from Alaska and California.}, number={3-4}, journal={Veterinary Microbiology}, publisher={Elsevier BV}, author={Carrasco, Sebastian E. and Chomel, Bruno B. and Gill, Verena A. and Kasten, Rickie W. and Maggi, Ricardo G. and Breitschwerdt, Edward B. and Byrne, Barbara A. and Burek-Huntington, Kathleen A. and Miller, Melissa A. and Goldstein, Tracey and et al.}, year={2014}, month={Jun}, pages={325–334} }
 @article{maggi_mascarelli_balakrishnan_rohde_kelly_ramaiah_leach_breitschwerdt_2013, title={"Candidatus Mycoplasma haemomacaque" and Bartonella quintana Bacteremia in Cynomolgus Monkeys}, volume={51}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.03019-12}, DOI={10.1128/jcm.03019-12}, abstractNote={ABSTRACT}, number={5}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Maggi, R. G. and Mascarelli, P. E. and Balakrishnan, N. and Rohde, C. M. and Kelly, C. M. and Ramaiah, L. and Leach, M. W. and Breitschwerdt, E. B.}, year={2013}, month={Feb}, pages={1408–1411} }
 @article{maggi_birkenheuer_hegarty_bradley_levy_breitschwerdt_2013, title={Advantages and limitations of serological and molecular panels for the diagnosis of vector-borne infectious diseases in dogs}, volume={27}, number={3}, journal={Journal of Veterinary Internal Medicine}, author={Maggi, R.G. and Birkenheuer, A.J. and Hegarty, B.C. and Bradley, J.M. and Levy, M.G. and Breitschwerdt, E.B.}, year={2013}, pages={720} }
 @article{pérez vera_diniz_pultorak_maggi_breitschwerdt_2013, title={An unmatched case controlled study of clinicopathologic abnormalities in dogs with Bartonella infection}, volume={36}, ISSN={0147-9571}, url={http://dx.doi.org/10.1016/j.cimid.2013.04.001}, DOI={10.1016/j.cimid.2013.04.001}, abstractNote={We compared clinicopathologic findings in dogs with Bartonella infection to Bartonella spp. negative dogs suspected of a vector-borne disease. Cases (n = 47) and controls (n = 93) were selected on the basis of positive or negative enrichment culture PCR results, respectively. Signalment, clinicopathologic findings and treatments were extracted from medical records. DNA sequencing identified Bartonella henselae (n = 28, 59.6%), Bartonella vinsonii subsp. berkhoffii (n = 20, 42.6%), Bartonella koehlerae (n = 3, 6.4%), Bartonella volans-like (n = 3, 6.4%) and Bartonella bovis (n = 1, 2.1%). There were no significant differences in age, breed, size, sex or neuter status between cases and controls. Dogs infected with Bartonella sp. often had a history of weight loss [OR = 2.82; 95% CI: 1.08–7.56] and were hypoglobulinemic [OR = 4.26; 95% CI: 1.31–14.41]. With the exception of weight loss and hypoglobulinemia, clinicopathologic abnormalities in Bartonella-infected dogs in this study were similar to dogs suspected of other vector-borne infections.}, number={5}, journal={Comparative Immunology, Microbiology and Infectious Diseases}, publisher={Elsevier BV}, author={Pérez Vera, Cristina and Diniz, Pedro Paulo V.P. and Pultorak, Elizabeth L. and Maggi, Ricardo G. and Breitschwerdt, Edward B.}, year={2013}, month={Sep}, pages={481–487} }
 @article{maggi_ericson_mascarelli_bradley_breitschwerdt_2013, title={Bartonella henselae bacteremia in a mother and son potentially associated with tick exposure}, volume={6}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/1756-3305-6-101}, DOI={10.1186/1756-3305-6-101}, abstractNote={Bartonella henselae is a zoonotic, alpha Proteobacterium, historically associated with cat scratch disease (CSD), but more recently associated with persistent bacteremia, fever of unknown origin, arthritic and neurological disorders, and bacillary angiomatosis, and peliosis hepatis in immunocompromised patients. A family from the Netherlands contacted our laboratory requesting to be included in a research study (NCSU-IRB#1960), designed to characterize Bartonella spp. bacteremia in people with extensive arthropod or animal exposure. All four family members had been exposed to tick bites in Zeeland, southwestern Netherlands. The mother and son were exhibiting symptoms including fatigue, headaches, memory loss, disorientation, peripheral neuropathic pain, striae (son only), and loss of coordination, whereas the father and daughter were healthy.Each family member was tested for serological evidence of Bartonella exposure using B. vinsonii subsp. berkhoffii genotypes I-III, B. henselae and B. koehlerae indirect fluorescent antibody assays and for bacteremia using the BAPGM enrichment blood culture platform.The mother was seroreactive to multiple Bartonella spp. antigens and bacteremia was confirmed by PCR amplification of B. henselae DNA from blood, and from a BAPGM blood agar plate subculture isolate. The son was not seroreactive to any Bartonella sp. antigen, but B. henselae DNA was amplified from several blood and serum samples, from BAPGM enrichment blood culture, and from a cutaneous striae biopsy. The father and daughter were seronegative to all Bartonella spp. antigens, and negative for Bartonella DNA amplification.Historically, persistent B. henselae bacteremia was not thought to occur in immunocompetent humans. To our knowledge, this study provides preliminary evidence supporting the possibility of persistent B. henselae bacteremia in immunocompetent persons from Europe. Cat or flea contact was considered an unlikely source of transmission and the mother, a physician, reported that clinical symptoms developed following tick exposure. To our knowledge, this is the first time that a B. henselae organism has been visualized in and amplified from a striae lesion. As the tick bites occurred three years prior to documentation of B. henselae bacteremia, the mode of transmission could not be determined.}, number={1}, journal={Parasites & Vectors}, publisher={Springer Science and Business Media LLC}, author={Maggi, Ricardo G and Ericson, Marna and Mascarelli, Patricia E and Bradley, Julie M and Breitschwerdt, Edward B}, year={2013}, month={Apr} }
 @article{mascarelli_maggi_hopkins_mozayeni_trull_bradley_hegarty_breitschwerdt_2013, title={Bartonella henselae infection in a family experiencing neurological and neurocognitive abnormalities after woodlouse hunter spider bites}, volume={6}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/1756-3305-6-98}, DOI={10.1186/1756-3305-6-98}, abstractNote={Abstract}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Mascarelli, Patricia E and Maggi, Ricardo G and Hopkins, Sarah and Mozayeni, B Robert and Trull, Chelsea L and Bradley, Julie M and Hegarty, Barbara C and Breitschwerdt, Edward B}, year={2013}, pages={98} }
 @article{chitwood_maggi_kennedy-stoskopf_toliver_deperno_2013, title={Bartonella vinsonii subsp. berkhoffii in Free-Ranging White-Tailed Deer (Odocoileus virginianus)}, volume={49}, ISSN={0090-3558}, url={http://dx.doi.org/10.7589/2012-11-286}, DOI={10.7589/2012-11-286}, abstractNote={Bartonella vinsonii subsp. berkhoffii has not been detected previously in white-tailed deer (Odocoileus virginianus). We tested whole blood from 60 white-tailed deer for Bartonella spp. DNA; three (5%) were positive for Bartonella vinsonii subsp. berkhoffii. This is the first detection of Bartonella vinsonii subsp. berkhoffii in white-tailed deer.}, number={2}, journal={Journal of Wildlife Diseases}, publisher={Wildlife Disease Association}, author={Chitwood, M. Colter and Maggi, Ricardo G. and Kennedy-Stoskopf, Suzanne and Toliver, Marcée and DePerno, and Christopher S.}, year={2013}, month={Apr}, pages={468–470} }
 @article{maggi_mascarelli_havenga_naidoo_breitschwerdt_2013, title={Co-infection with Anaplasma platys, Bartonella henselae and Candidatus Mycoplasma haematoparvum in a veterinarian}, volume={6}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/1756-3305-6-103}, DOI={10.1186/1756-3305-6-103}, abstractNote={Abstract}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Maggi, Ricardo G and Mascarelli, Patricia E and Havenga, Lauren N and Naidoo, Vinny and Breitschwerdt, Edward B}, year={2013}, pages={103} }
 @article{balakrishnan_cherry_linder_pierce_sontakke_hegarty_bradley_maggi_breitschwerdt_2013, title={Experimental infection of dogs with Bartonella henselae and Bartonella vinsonii subsp. berkhoffii}, volume={156}, ISSN={0165-2427}, url={http://dx.doi.org/10.1016/j.vetimm.2013.09.007}, DOI={10.1016/j.vetimm.2013.09.007}, abstractNote={The lack of a suitable infection model remains an important obstacle for the pathophysiological understanding of Bartonella spp. The following pilot study was designed to determine whether cell culture-grown Bartonella henselae SA2 and Bartonella vinsonii subsp. berkhoffii genotype III would cause persistent bacteremia in dogs. Pre-inoculation screening established that two laboratory-raised Golden retrievers were naturally-infected with Bartonella koehlerae. Despite prior infection, one dog each was inoculated subcutaneously with 5 × 10(4)B. henselae (SA2 strain) or 3 × 10(4)B. vinsonii subsp. berkhoffii genotype III. Dogs were bled weekly for serological testing and culture using Bartonella alpha proteobacteria growth medium (BAPGM) diagnostic platform. Dog 1 seroconverted to B. henselae and Dog 2 seroconverted to B. vinsonii subsp. berkhoffii genotype III. Throughout the study period, Bartonella spp. DNA was neither amplified nor isolated in ante-mortem BAPGM enrichment blood cultures. B. henselae SA2 was isolated from a postmortem bone marrow from Dog 1 and B. koehlerae DNA was amplified from postmortem lung from Dog 2 following BAPGM enrichment culture. Limitations include lack of uninfected controls, a potentially suboptimal B. vinsonii subsp. berkhoffii inoculum and a relatively short duration of study. We conclude that following intradermal infection, sequestration of Bartonella spp. in tissues may limit diagnostic detection of these bacteria in dog blood samples.}, number={1-2}, journal={Veterinary Immunology and Immunopathology}, publisher={Elsevier BV}, author={Balakrishnan, Nandhakumar and Cherry, Natalie A. and Linder, Keith E. and Pierce, Eric and Sontakke, Neal and Hegarty, Barbara C. and Bradley, Julie M. and Maggi, Ricardo G. and Breitschwerdt, Edward B.}, year={2013}, month={Nov}, pages={153–158} }
 @article{maggi_compton_trull_mascarelli_mozayeni_breitschwerdt_2013, title={Infection with Hemotropic Mycoplasma Species in Patients with or without Extensive Arthropod or Animal Contact}, volume={51}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.01125-13}, DOI={10.1128/jcm.01125-13}, abstractNote={ABSTRACT}, number={10}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Maggi, R. G. and Compton, S. M. and Trull, C. L. and Mascarelli, P. E. and Mozayeni, B. R. and Breitschwerdt, E. B.}, year={2013}, month={Jul}, pages={3237–3241} }
 @article{breitschwerdt_linder_day_maggi_chomel_kempf_2013, title={Koch's Postulates and the Pathogenesis of Comparative Infectious Disease Causation Associated with Bartonella species}, volume={148}, ISSN={0021-9975}, url={http://dx.doi.org/10.1016/j.jcpa.2012.12.003}, DOI={10.1016/j.jcpa.2012.12.003}, abstractNote={In his homage to Lucretius (‘Georgica’), Vergil is credited with stating: ‘Felix qui potuit rerum cognoscere causas’ (‘Fortunate is he who knows the causes of things’). Based on numerous commentaries and publications it is obvious that clinicians, diagnosticians and biomedical research scientists continue to struggle with disease causation, particularly in the assessment of the pathogenic role of ‘stealth pathogens’ that produce persistent infections in the host. Bartonella species, because of their evolutionary ability to induce persistent intravascular infections, present substantial challenges for researchers attempting to clarify the ability of these stealth bacteria to cause disease. By studying the comparative biological and pathological behaviour of microbes across mammalian genera, researchers might be able more rapidly to advance medical science and, subsequently, patient care by undertaking focused research efforts involving a single mammalian species or by attempting to recapitulate a complex disease in an rodent model. Therefore, in an effort to further assist in the establishment of disease causation by stealth pathogens, we use recent research observations involving the genus Bartonella to propose an additional postulate of comparative infectious disease causation to Koch's postulates.}, number={2-3}, journal={Journal of Comparative Pathology}, publisher={Elsevier BV}, author={Breitschwerdt, E.B. and Linder, K.L. and Day, M.J. and Maggi, R.G. and Chomel, B.B. and Kempf, V.A.J.}, year={2013}, month={Feb}, pages={115–125} }
 @article{maggi_chitwood_kennedy-stoskopf_deperno_2013, title={Novel hemotropic Mycoplasma species in white-tailed deer (Odocoileus virginianus)}, volume={36}, ISSN={0147-9571}, url={http://dx.doi.org/10.1016/j.cimid.2013.08.001}, DOI={10.1016/j.cimid.2013.08.001}, abstractNote={Globally, hemotropic Mycoplasma spp. are emerging or re-emerging zoonotic pathogens that affect livestock, wildlife, companion animals, and humans, potentially causing serious and economically important disease problems. Little is known about hemotropic Mycoplasma spp. prevalence, host-specificity, or route of transmission in most species, including wildlife. DNA amplification by PCR targeting the 16SrRNA and the RNaseP genes was used to establish the presence and prevalence of hemotropic Mycoplasma spp. in a white-tailed deer (O. virginianus) population in eastern North Carolina. Sixty-five deer (89%) tested positive for hemotropic Mycoplasma spp. where sequence analysis of the 16SsRNA and the RNaseP genes indicated the presence of at least three distinct species. This study represents the first detection of three distinct hemotropic Mycoplasma species in white-tailed deer and the first report of two novel hemotropic Mycoplasma species.}, number={6}, journal={Comparative Immunology, Microbiology and Infectious Diseases}, publisher={Elsevier BV}, author={Maggi, Ricardo G. and Chitwood, M. Colter and Kennedy-Stoskopf, Suzanne and DePerno, Christopher S.}, year={2013}, month={Dec}, pages={607–611} }
 @article{davenport_mascarelli_maggi_breitschwerdt_2013, title={Phylogenetic Diversity of Bacteria Isolated from Sick Dogs Using the BAPGM Enrichment Culture Platform}, volume={27}, ISSN={0891-6640}, url={http://dx.doi.org/10.1111/jvim.12094}, DOI={10.1111/jvim.12094}, abstractNote={BackgroundBartonella alpha‐Proteobacteria growth medium (BAPGM) enrichment culture has proven useful for documenting Bartonella species infection and has facilitated growth of other fastidious bacteria from human samples.}, number={4}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Davenport, A.C. and Mascarelli, P.E. and Maggi, R.G. and Breitschwerdt, E.B.}, year={2013}, month={May}, pages={854–861} }
 @article{pultorak_maggi_mascarelli_breitschwerdt_2013, title={Serial Testing from a 3-Day Collection Period by Use of the Bartonella Alphaproteobacteria Growth Medium Platform May Enhance the Sensitivity of Bartonella Species Detection in Bacteremic Human Patients}, volume={51}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.00123-13}, DOI={10.1128/jcm.00123-13}, abstractNote={ABSTRACT}, number={6}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Pultorak, E. L. and Maggi, R. G. and Mascarelli, P. E. and Breitschwerdt, E. B.}, year={2013}, month={Mar}, pages={1673–1677} }
 @article{vera_maggi_woods_mascarelli_breitschwerdt_2013, title={Spontaneous onset of complex regional pain syndrome Type I in a woman infected with Bartonella koehlerae}, volume={203}, ISSN={0300-8584 1432-1831}, url={http://dx.doi.org/10.1007/s00430-013-0320-3}, DOI={10.1007/s00430-013-0320-3}, abstractNote={After a short-term fever, complex regional pain syndrome, characterized by hyperalgesia, intermittent swelling, erythema and cyanosis of both feet, was diagnosed in a female veterinarian. The woman was infected with Bartonella koehlerae and she was also Bartonella vinsonii subsp. berkhoffii seroreactive. Having failed other treatments, symptoms resolved following initiation of antibiotics.}, number={2}, journal={Medical Microbiology and Immunology}, publisher={Springer Science and Business Media LLC}, author={Vera, Cristina Pérez and Maggi, Ricardo G. and Woods, Christopher W. and Mascarelli, Patricia E. and Breitschwerdt, Edward B.}, year={2013}, month={Dec}, pages={101–107} }
 @article{saenz_maggi_breitschwerdt_kim_vargo_schal_2013, title={Survey of Bartonella spp. in U.S. Bed Bugs Detects Burkholderia multivorans but Not Bartonella}, volume={8}, ISSN={1932-6203}, url={http://dx.doi.org/10.1371/journal.pone.0073661}, DOI={10.1371/journal.pone.0073661}, abstractNote={Bed bugs (Cimex lectularius L.) have resurged in the United States and globally. Bed bugs are hematophagous ectoparasites of humans and other animals, including domestic pets, chickens, and bats, and their blood feeding habits contribute to their potential as disease vectors. Several species of Bartonella are re-emergent bacterial pathogens that also affect humans, domestic pets, bats and a number of other wildlife species. Because reports of both bed bugs and Bartonella have been increasing in the U.S., and because their host ranges can overlap, we investigated whether the resurgences of these medically important pathogens and their potential vector might be linked, by screening for Bartonella spp. in bed bugs collected from geographic areas where these pathogens are prevalent and from bed bugs that have been in culture in the laboratory for several years. We screened a total of 331 bed bugs: 316 bed bugs from 36 unique collections in 29 geographic locations in 13 states, 10 bed bugs from two colonies maintained in the laboratory for 3 yr, and 5 bed bugs from a colony that has been in culture since before the recent resurgence of bed bugs. Bartonella spp. DNA was screened using a polymerase chain reaction assay targeting the 16S–23S rRNA intergenic transcribed spacer region. Bartonella DNA was not amplified from any bed bug, but five bed bugs from four different apartments of an elderly housing building in North Carolina contained DNA sequences that corresponded to Burkholderia multivorans, an important pathogen in nosocomial infections that was not previously linked to an arthropod vector.}, number={9}, journal={PLoS ONE}, publisher={Public Library of Science (PLoS)}, author={Saenz, Virna L. and Maggi, Ricardo G. and Breitschwerdt, Edward B. and Kim, Jung and Vargo, Edward L. and Schal, Coby}, editor={Palli, Subba ReddyEditor}, year={2013}, month={Sep}, pages={e73661} }
 @article{fernandez_aburto_maggi_breitschwerdt_cristofanilli_2012, title={Abstract P3-10-03:Bartonella henselaeInfection Detected in Patients with Inflammatory Breast Cancer.}, volume={72}, url={http://dx.doi.org/10.1158/0008-5472.SABCS12-P3-10-03}, DOI={10.1158/0008-5472.SABCS12-P3-10-03}, abstractNote={Abstract}, number={24 Supplement}, journal={Cancer Research}, publisher={American Association for Cancer Research}, author={Fernandez, SV and Aburto, L and Maggi, R and Breitschwerdt, EB and Cristofanilli, M}, year={2012}, month={Dec}, pages={P3–10-03} }
 @article{maggi_mozayeni_pultorak_hegarty_bradley_correa_breitschwerdt_2012, title={Bartonella spp. Bacteremia and Rheumatic Symptoms in Patients from Lyme Disease–endemic Region}, volume={18}, ISSN={1080-6040 1080-6059}, url={http://dx.doi.org/10.3201/eid1811.121226}, DOI={10.3201/eid1811.121226}, abstractNote={Some scientists have tentatively proposed to name the virus bovine viral diarrhea 3, but others believe this nomenclature would be problematic from regulatory and scientifi c standpoints (J.Ridpath, pers.comm.).Molecular assays standardized for BVDV-1/2 might not be able to detect 'Hobi'-like strains because of the presence of mismatches in the oligonucleotide binding regions (7).Prophylactic measures should take into account the circulation of 'Hobi'-like pestiviruses in cattle herds.Whether commercial BVDV vaccines are effective against the emerging pestivirus is unknown, and requires future in vivo cross-protection studies.}, number={11}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Maggi, Ricardo G. and Mozayeni, B. Robert and Pultorak, Elizabeth L. and Hegarty, Barbara C. and Bradley, Julie M. and Correa, Maria and Breitschwerdt, Edward B.}, year={2012}, month={Nov}, pages={1919b–1921} }
 @article{beerlage_varanat_linder_maggi_cooley_kempf_breitschwerdt_2012, title={Bartonella vinsonii subsp. berkhoffii and Bartonella henselae as potential causes of proliferative vascular diseases in animals}, volume={201}, ISSN={0300-8584 1432-1831}, url={http://dx.doi.org/10.1007/s00430-012-0234-5}, DOI={10.1007/s00430-012-0234-5}, abstractNote={Bartonella species are highly fastidious, vector borne, zoonotic bacteria that cause persistent intraerythrocytic bacteremia and endotheliotropic infection in reservoir and incidental hosts. Based upon prior in vitro research, three Bartonella sp., B. bacilliformis, B. henselae, and B. quintana can induce proliferation of endothelial cells, and each species has been associated with in vivo formation of vasoproliferative tumors in human patients. In this study, we report the molecular detection of B. vinsonii subsp. berkhoffii, B. henselae, B. koehlerae, or DNA of two of these Bartonella species simultaneously in vasoproliferative hemangiopericytomas from a dog, a horse, and a red wolf and in systemic reactive angioendotheliomatosis lesions from cats and a steer. In addition, we provide documentation that B. vinsonii subsp. berkhoffii infections induce activation of hypoxia inducible factor-1 and production of vascular endothelial growth factor, thereby providing mechanistic evidence as to how these bacteria could contribute to the development of vasoproliferative lesions. Based upon these results, we suggest that a fourth species, B. vinsonii subsp. berkhoffii, should be added to the list of bartonellae that can induce vasoproliferative lesions and that infection with one or more Bartonella sp. may contribute to the pathogenesis of systemic reactive angioendotheliomatosis and hemangiopericytomas in animals.}, number={3}, journal={Medical Microbiology and Immunology}, publisher={Springer Science and Business Media LLC}, author={Beerlage, Christiane and Varanat, Mrudula and Linder, Keith and Maggi, Ricardo G. and Cooley, Jim and Kempf, Volkhard A. J. and Breitschwerdt, Edward B.}, year={2012}, month={Mar}, pages={319–326} }
 @article{cherry_jones_maggi_davis_breitschwerdt_2012, title={Bartonellaspp. Infection in Healthy and Sick Horses and Foals from the Southeastern United States}, volume={26}, ISSN={0891-6640}, url={http://dx.doi.org/10.1111/j.1939-1676.2012.00998.x}, DOI={10.1111/j.1939-1676.2012.00998.x}, abstractNote={BackgroundBartonella species bacteremia has been identified in numerous animal species. These bacteria cause, or have been associated with, a spectrum of clinical manifestations in dogs and human patients. The frequency of exposure to or infection with Bartonella spp. among healthy and sick horses has not been reported.}, number={6}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Cherry, N.A. and Jones, S.L. and Maggi, R.G. and Davis, J.L. and Breitschwerdt, E.B.}, year={2012}, month={Sep}, pages={1408–1412} }
 @article{compton_maggi_breitschwerdt_2012, title={Candidatus Mycoplasma haematoparvum and Mycoplasma haemocanis infections in dogs from the United States}, volume={35}, ISSN={0147-9571}, url={http://dx.doi.org/10.1016/j.cimid.2012.06.004}, DOI={10.1016/j.cimid.2012.06.004}, abstractNote={Mycoplasma haemocanis (Mhc) and Candidatus Mycoplasma haematoparvum (CMhp) have been described in dogs. Historically, microscopic visualization of hemotropic Mycoplasma spp. has occurred most often in immunocompromised or splenectomized dogs. The aim of this study was to determine the Mhc and CMhp prevalences among dogs from the United States. Novel 16S rRNA and RNAseP gene PCR assays were used to amplify hemotropic Mycoplasma species DNA for GenBank sequence alignment. Among the study population, hemoplasma prevalence was 1.3% (7 out of 506), with Mhc and CMhp prevalences of 0.6% and 0.8%, respectively. Two of six CMhp-infected dogs were co-infected with a Bartonella sp., and a third dog was seroreactive to Bartonella henselae antigens. The prevalence of Mhc and CMhp in this study was low; potential blood donors should be screened; and dogs and people can be co-infected with hemoplasma and Bartonella spp.}, number={6}, journal={Comparative Immunology, Microbiology and Infectious Diseases}, publisher={Elsevier BV}, author={Compton, S.M. and Maggi, R.G. and Breitschwerdt, E.B.}, year={2012}, month={Dec}, pages={557–562} }
 @article{hegarty_maggi_koskinen_beall_eberts_chandrashekar_breitschwerdt_2012, title={Ehrlichia muris Infection in a Dog from Minnesota}, volume={26}, ISSN={0891-6640}, url={http://dx.doi.org/10.1111/j.1939-1676.2012.00968.x}, DOI={10.1111/j.1939-1676.2012.00968.x}, abstractNote={A 6-year-old-male Labrador Retriever from northern Minnesota was examined by a veterinarian in June 2011 because of decreased activity, reluctance to climb stairs, and a history of having 2 attached ticks, approximately 2 months earlier. The dog was febrile (rectal temperature 103.5°F) and had a stiff gait, particularly noticeable in the front legs. On palpation, there was pain in both elbow joints. Because of the high prevalence of tick-borne arthropathies in the practice area, Lyme borreliosis or anaplasmosis was suspected. Because a commercially available in-house assay1 was strongly positive for Anaplasma species antibodies, canine anaplasmosis was diagnosed serologically and doxycycline was administered at a dosage of 6 mg/kg PO q12h for 21 days. Carprofen (2 mg/kg PO q24h–q12h) was dispensed for control of pain as needed and topical fipronil was dispensed for tick control. When re-examined 5 days later, overall activity was decreased, the dog frequently licked the paws and remained stiff, but the owner had not administered carprofen. Rectal temperature was 102.2°F. Amoxicillin (11 mg/kg PO q12h for 10 days) and Fortiflora were added to the treatment regimen. When re-examined in July, the dog had returned to normal activities and normal mobility. On September 7, 2011, a second veterinarian collaborating with the Intracellular Pathogens Research Laboratory (IPRL) examined the dog because of decreased appetite, lethargy, and recurrent bouts of vomiting. Rectal temperature was 103.3°F. SNAP 4Dx again indicated the presence of Anaplasma species antibodies. The dog was thrombocytopenic (platelet count, 132,000/μL; reference range, 160,000–525,000/μL), according to an in-house platelet count, but a CBC and serum biochemical profile performed by a commercial diagnostic laboratory2 on a blood sample drawn the same day identified no hematologic or serum biochemical abnormalities (platelet count, 243,000/μL; reference range, 140,000–540,000/μL). Initial treatment included 1 dose of oxytetracycline (1 mg/kg, IV). Doxycycline was dispensed with instructions to administer 8 mg/kg PO q12h for 30 days along with a digestive support supplement.3 Blood and serum samples collected on September 7, 2011 were sent to the IPRL for serological and PCR testing for Anaplasma and Ehrlichia spp. Anaplasma species antibodies were confirmed using SNAP 4Dx. PCR amplification was performed using previously described GEP 16S Ehrlichia genus primers and species-specific primers for Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia ewingii, Anaplasma phagocytophilum, and Anaplasma platys.1 An amplicon was obtained with the Ehrlichia genus primers, but amplification using the above-mentioned species-specific primers, including A. phagocytophilum, did not generate amplicons. Sequencing4 of the Ehrlichia genus amplicon resulted in the highest DNA similarity (100%) to Ehrlichia muris (361 of 361 base pairs when compared to GenBank Accession number NR_025962, a strain from a mouse in Japan). After designing a 16S rDNA, E. muris primer pair Emu58 (sense): 5′ ATAGCTACCCATAGCTTTTTTAGCTATAGGTT 3′ and SEP (anti-sense): 5′ CTTCTRTRGGTACCGTCATTATCTTCCCY 3′ (as forward and reverse primers respectively), a 395 base pair amplicon (expected amplicon size) was obtained from the September 7, 2011 blood sample. The dog was examined on September 23, 2011 because of vomiting and diarrhea that was temporally associated with administration of doxycycline. A fecal flotation was negative for parasite ova. Clostridium enteritis was diagnosed by the attending veterinarian using fecal smear examination. Doxycycline was discontinued and amoxicillin (20 mg/kg POq12h for 14 days), metronidazole (20 mg/kg PO q12h for 14 days), and metoclopramide (0.9 mg/kg PO q24 for 5 days) were dispensed. Within 3 days, the vomiting and diarrhea had resolved and the dog was acting normally. PCR amplification5 using Ehrlichia genus and E. muris-specific primers from a September 27, 2011 blood sample were negative, no additional doxycycline was dispensed. On October 29, 2011, the dog was somewhat less active, had bloody urine, and occasional blood clots were observed dripping from the prepuce. The prostate gland was slightly enlarged, nonpainful, and symmetrical. The packed cell volume was 48%, the platelet count was 450,000/μL (reference range, 166,000–575,000/μL), and hypoglobulinemia (2.1 g/dL; reference range, 2.5–4.5 g/dL) was present. Urine was alkaline (pH8.0) with 3+ proteinuria and specific gravity 1.040, and hematuria was present. Radiographs of the abdomen disclosed no abnormalties. Cephalexin (20 mg/kg PO q8h for 10 days) was dispensed for presumptive urinary tract infection. Despite treatment with cephalexin, hematuria persisted. On November 2, 2011, the platelet count was 118,500/μL and packed cell volume was 50%. Urine specific gravity was 1.040 and sediment examination identified too numerous to count erythrocytes and occasional leukocytes. Because of the thrombocytopenia and because the dog had not completed the 30-day course of doxycycline because of vomiting and diarrhea in September, doxycycline again was administered (5 mg/kg PO q12h for 30 days). In addition, the dog was referred for an abdominal ultrasound examination. No ultrasonographic structural abnormalities were found within the urinary tract. The hematuria resolved and the dog did not experience any additional medical problems. On November 16, 2011, post-treatment blood sample for PCR and convalescent serum for testing against a panel of vector-borne pathogens were submitted to the IPRL. Again, seroreactivity to the Anaplasma peptide was the only SNAP 4Dx finding. By IFA testing, there was no antibody reactivity at a titer of 1 : 16 (testing scale, 1 : 16–1 : 8,192) to Babesia canis, Bartonella henselae, Bartonella vinsonii subsp. berkhoffii, E. canis, and Rickettsia rickettsii antigens. Ehrlichia genus and E. muris-specific PCR were negative. In addition, PCR amplification was retrospectively performed for the 3 sample collection dates using previously described groEL Ehrlichia genus primers.2 A GroEL PCR amplicon was obtained from the blood sample collected on September 7, 2011, but not from blood samples collected on September 27, 2011 and November 16, 2011. Sequence analysis of the GroEL PCR amplicon showed 100% homology (547/547 bp) with E. muris (GenBank accession number AF210459, from the E. muris type strain AS145). The E. muris 16S and GroEL sequences derived from this dog have been deposited into the GenBank data base under the accession numbers JQ10629 and JQ10630, respectively. Sequence phylogeny analyses of the 16S and GroEL gene sequences conducted with Molecular Evolutionary Genetics Analysis software supported a close phylogenetic relationship with E. muris. (Fig 1). In collaboration with 2 veterinary clinicians (Drs Koskinen and Eberts) in Minnesota, who routinely examine dogs with acute, febrile illness, we were able to provide the first molecular diagnostic evidence to support a potential role for E. muris as a pathogen in dogs from the United States. In 2 previously published studies, seroreactivity to E. canis-derived peptides using SNAP 3DX or 4DX assays in dogs from the Minnesota was unexpectedly more prevalent than expected based on tick vectors found in this region.1, 3 Exposure to Rhipicephalus sangineus, the vector for E. canis, and Ambylomma americanum, the vector for E. chaffeensis and E. ewingii, occurs infrequently in colder regions of the United States, therefore infection with another bacterial pathogen, potentially transmitted by Ixodes scapularis, a tick that is plentiful throughout this region, was suspected. In addition, E. canis and E. chaffeensis are the only 2 recognized Ehrlichia species in North America that are known to induce seroreactivity to the E. canis peptides used in the SNAP 3Dx and 4Dx assays.4, 5 In a previous study, neither E. canis nor E. chaffeensis DNA was amplified from Minnesota dogs, whereas the B. burgdorferi and A. phagocytophilum seroprevalence was 55%, indicating frequent exposure to I. scapularis.1 Based upon serology, the dog in this study had been exposed to A. phagocytophilum, supporting exposure to I. scapularis. In 2011, after the publications by Bowman and Beall,1, 3 human infection with an E. muris-like agent was reported for the first time in the medical literature in patients from Wisconsin.6 In addition, Telford et al. retrospectively documented the presence of E. muris DNA in I. scapularis ticks collected in the 1990s from northern Wisconsin.7 Collectively, these observations suggested that pet dogs exposed to ticks in this region also might be infected with this novel pathogen within the genus Ehrlichia. Potentially, cross-reacting antibodies resulting from exposure to another genus of bacteria provided a plausible explanation for the high SNAP E. canis seroreactivity in dogs from this region, but it seemed more likely that an organism within the genus Ehrlichia might be responsible for the seemingly disparate seroepidemiological findings. Interestingly, the E. muris-infected dog in this study never seroconverted to the E. canis peptides using SNAP 4Dx or E. canis IFA assays. Thus, some E. muris-infected dogs may not seroconvert, particularly if antibiotic treatment is started very early in the course of infection, or alternatively, E. muris may not be responsible for the sero-epidemiologic observations in previous studies from Minnesota.1, 3 In the context of human illness, the 4 patients described to date, most of whom have been immunocompromised, presented with fever, headache, thrombocytopenia, lymphopenia, and increased liver enzyme activities.6 Experimentally, E. muris-infected mice developed splenomegaly and lymphadenopathy.8 Although the role of E. muris in the overall pathogenesis of disease manifestations reported in this dog between June and November 2011 is impossible to assess with the available clinical, serologic and microbiological data, fever and thrombocytopenia are features of illness in human patients. Moreover, the expected therapeutic response to doxycycline treatment in dogs infected with A. phagocytophilum is generally dramatic, with rapid resolution of disease manifestations occurring generally within 24–48 hours.9, 10 Given the fact that this dog remained stiff and inactive for at least 5 days after initially being treated with doxycycline in June, it is possible that the dog was co-infected with A. phagocytophilum and E. muris at the time of the initial evaluation and that the E. muris infection persisted until documented in September 2011. Alternatively, A. phagoctyophilum may have been solely responsible for the June presentation, with E. muris transmission occurring in early September, just before onset of the second documented febrile episode. Recently, to further complicate clinical interpretation of disease outcomes, chronic infection with A. phagocytophilum has been documented in experimentally infected dogs in which treatment with doxycycline did not eliminate the infection.11 Despite this research observation, to date, molecular evidence supporting chronic canine anaplasmosis in naturally infected dogs is lacking in the literature from North American and European regions, where A. phagocytophilum transmission is endemic, and efforts to PCR amplify A. phagocytophilum DNA from 3 blood samples from the dog of this study were not successful. Whether E. muris causes an acute, short duration infection in dogs or is capable of inducing chronic long-lasting (months to years) infection in dogs, as occurs with other Ehrlichia spp., such as E. canis and E. ewingii, remains unknown. Historically, because Ehlrichia spp. could only be cultured using cell culture systems in a research setting, the advent of diagnostic DNA testing has greatly facilitated enhanced understanding of the host range and the pathogenic potential of these obligate intracellular bacteria. Ehrlichia muris was first isolated from rodents in Japan in the early 1990s.12 An experimental infection study involving 2 dogs failed to demonstrate evidence of transmission and the dogs did not develop signs of disease.8 Subsequently, monocytic Ehrlichia sp. DNA with sequence homology to E. muris was PCR-amplified from Ixodes persulcatus and Ixodes ricinus ticks found in Eastern Europe.13, 14 Unlike the DNA sequences from human patients, which were reported as E. muris-like,6 the 16S rDNA and rpoB sequences obtained from the dog in this study were 100% homologous to the E. muris type strain from Japanese rodents, and differed from the sequences reported from human patients in Wisconsin. The routine diagnostic use of PCR amplification and DNA sequencing practices are likely to identify other as yet unknown Ehrlichia sp. and an expanded host range in which infection with various Ehrlichia sp. occurs.}, number={5}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Hegarty, B.C. and Maggi, R.G. and Koskinen, P. and Beall, M.J. and Eberts, M. and Chandrashekar, R. and Breitschwerdt, E.B.}, year={2012}, month={Jul}, pages={1217–1220} }
 @article{lappin_maggi_hawley_breitschwerdt_2012, title={Failure to amplify bartonella koehlerae dna from blood of cats and their fleas in the united states}, volume={26}, number={3}, journal={Journal of Veterinary Internal Medicine}, author={Lappin, M.R. and Maggi, R. and Hawley, J.R. and Breitschwerdt, E.B.}, year={2012}, pages={791–792} }
 @article{vanderheyden_yong_breitschwerdt_maggi_mihalik_parada_fimmel_2012, title={Granulomatous hepatitis due to Bartonella henselae infection in an immunocompetent patient}, volume={12}, ISSN={1471-2334}, url={http://dx.doi.org/10.1186/1471-2334-12-17}, DOI={10.1186/1471-2334-12-17}, abstractNote={Bartonella henselae (B. henselae) is considered a rare cause of granulomatous hepatitis. Due to the fastidious growth characteristics of the bacteria, the limited sensitivity of histopathological stains, and the non-specific histological findings on liver biopsy, the diagnosis of hepatic bartonellosis can be difficult to establish. Furthermore, the optimal treatment of established hepatic bartonellosis remains controversial.We present a case of hepatic bartonellosis in an immunocompetent woman who presented with right upper quadrant pain and a five cm right hepatic lobe mass on CT scan. The patient underwent a right hepatic lobectomy. Surgical pathology revealed florid necrotizing granulomatous hepatitis, favoring an infectious etiology. Despite extensive histological and serological evaluation a definitive diagnosis was not established initially. Thirteen months after initial presentation, hepatic bartonellosis was diagnosed by PCR studies from surgically excised liver tissue. Interestingly, the hepatic granulomas persisted and Bartonella henselae was isolated from the patient's enriched blood culture after several courses of antibiotic therapy.The diagnosis of hepatic bartonellosis is exceedingly difficult to establish and requires a high degree of clinical suspicion. Recently developed, PCR-based approaches may be required in select patients to make the diagnosis. The optimal antimicrobial therapy for hepatic bartonellosis has not been established, and close follow-up is needed to ensure successful eradication of the infection.}, number={1}, journal={BMC Infectious Diseases}, publisher={Springer Nature}, author={VanderHeyden, Thomas R and Yong, Sherri L and Breitschwerdt, Edward B and Maggi, Ricardo G and Mihalik, Amanda R and Parada, Jorge P and Fimmel, Claus J}, year={2012}, month={Jan}, pages={17} }
 @article{varanat_maggi_linder_breitschwerdt_2012, title={Infection of human brain vascular pericytes (HBVPs) by Bartonella henselae}, volume={202}, ISSN={0300-8584 1432-1831}, url={http://dx.doi.org/10.1007/s00430-012-0279-5}, DOI={10.1007/s00430-012-0279-5}, abstractNote={Angiogenesis is an important physiological and pathological process. Bartonella is the only genus of bacteria known to induce pathological angiogenesis in the mammalian host. Bartonella-induced angiogenesis leads to the formation of vascular tumors including verruga peruana and bacillary angiomatosis. The mechanism of Bartonella-induced angiogenesis is not completely understood. Pericytes, along with endothelial cells, play an important role in physiological angiogenesis, and their role in tumor angiogenesis has been extensively studied. Abnormal signaling between endothelial cells and pericytes contributes to tumor angiogenesis and metastasis; however, the role of pericytes in Bartonella-induced angiogenesis is not known. In this study, after infecting human brain vascular pericytes (HBVPs) with Bartonella henselae, we found that these bacteria were able to invade HBVPs and that bacterial infection resulted in decreased pericyte proliferation and increased pericyte production of vascular endothelial growth factor (VEGF) when compared to the uninfected control cells. In the context of pathological angiogenesis, reduced pericyte coverage, accompanied by increased VEGF production, may promote endothelial cell proliferation and the formation of new vessels.}, number={2}, journal={Medical Microbiology and Immunology}, publisher={Springer Science and Business Media LLC}, author={Varanat, Mrudula and Maggi, Ricardo G. and Linder, Keith E. and Breitschwerdt, Edward B.}, year={2012}, month={Nov}, pages={143–151} }
 @article{baneth_bourdeau_bourdoiseau_bowman_breitschwerdt_capelli_cardoso_dantas-torres_day_dedet_et al._2012, title={Vector-Borne Diseases - constant challenge for practicing veterinarians: recommendations from the CVBD World Forum}, volume={5}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/1756-3305-5-55}, DOI={10.1186/1756-3305-5-55}, abstractNote={Abstract}, number={1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Baneth, Gad and Bourdeau, Patrick and Bourdoiseau, Gilles and Bowman, Dwight and Breitschwerdt, Edward and Capelli, Gioia and Cardoso, Luis and Dantas-Torres, Filipe and Day, Michael and Dedet, Jean-Pierre and et al.}, year={2012}, pages={55} }
 @article{mascarelli_iredell_maggi_weinberg_breitschwerdt_2011, title={Bartonella Species Bacteremia in Two Patients with Epithelioid Hemangioendothelioma}, volume={49}, ISSN={0095-1137 1098-660X}, url={http://dx.doi.org/10.1128/JCM.05527-11}, DOI={10.1128/JCM.05527-11}, abstractNote={ABSTRACT}, number={11}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Mascarelli, Patricia E. and Iredell, Jonathan R. and Maggi, Ricardo G. and Weinberg, Guy and Breitschwerdt, Edward B.}, year={2011}, month={Sep}, pages={4006–4012} }
 @article{fenimore_varanat_maggi_schultheiss_breitschwerdt_lappin_2011, title={Bartonella spp. DNA in Cardiac Tissues from Dogs in Colorado and Wyoming}, volume={25}, ISSN={0891-6640}, url={http://dx.doi.org/10.1111/j.1939-1676.2011.0722.x}, DOI={10.1111/j.1939-1676.2011.0722.x}, abstractNote={Background:  Several Bartonella species (spp.) have been identified in dogs diagnosed with infectious endocarditis (IE) or myocarditis.}, number={3}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Fenimore, A. and Varanat, M. and Maggi, R. and Schultheiss, P. and Breitschwerdt, E. and Lappin, M. R.}, year={2011}, month={May}, pages={613–616} }
 @article{beard_maggi_kennedy-stoskopf_cherry_sandfoss_deperno_breitschwerdt_2011, title={Bartonella spp. in Feral Pigs, Southeastern United States}, volume={17}, ISSN={1080-6040 1080-6059}, url={http://dx.doi.org/10.3201/eid1705.100141}, DOI={10.3201/eid1705.100141}, abstractNote={In conjunction with efforts to assess pathogen exposure in feral pigs from the southeastern United States, we amplified Bartonella henselae, B. koehlerae, and B. vinsonii subsp. berkhoffii from blood samples. Feral pigs may represent a zoonotic risk for hunters or butchers and pose a potential threat to domesticated livestock.}, number={5}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Beard, Adam W. and Maggi, Ricardo G. and Kennedy-Stoskopf, Suzanne and Cherry, Natalie A. and Sandfoss, Mark R. and DePerno, Christopher S. and Breitschwerdt, Edward B.}, year={2011}, month={May}, pages={893–895} }
 @article{perez_diniz_maggi_breitschwerdt_2011, title={Canine bartonellosis mimics other tick-borne diseases}, volume={25}, number={3}, journal={Journal of Veterinary Internal Medicine}, author={Perez, C. and Diniz, P.P.V.P. and Maggi, R.G. and Breitschwerdt, E.B.}, year={2011}, pages={706–707} }
 @article{cherry_maggi_rossmeisl_hegarty_breitschwerdt_2011, title={Ecological Diversity ofBartonellaSpecies Infection Among Dogs and Their Owner in Virginia}, volume={11}, ISSN={1530-3667 1557-7759}, url={http://dx.doi.org/10.1089/vbz.2010.0201}, DOI={10.1089/vbz.2010.0201}, abstractNote={Bartonella species comprise a genus of gram-negative, fastidious, intracellular bacteria that have been implicated in association with an increasing spectrum of disease manifestations in dogs and human patients. In this study, chronic canine and human disease, for which causation was not diagnostically defined, were reported by the breeder of a kennel of Doberman pinschers. In addition to other diagnostic tests, serology, polymerase chain reaction, and enrichment blood culture were used to assess the prevalence of Bartonella sp. infection in the dogs and their owner. From five dogs, Bartonella vinsonii subsp. berkhoffii genotype I, multiple Bartonella henselae strains, and a species most similar to Candidatus B. volans, a rodent-associated Bartonella sp., were amplified and sequenced from biopsy tissues, cerebrospinal fluid, or blood enrichment cultures. The owner was bacteremic with B. vinsonii subsp. berkhoffii genotype I, the same subsp. and genotype detected in one of her dogs. These results further emphasize the ecological complexity of Bartonella sp. transmission in nature.}, number={11}, journal={Vector-Borne and Zoonotic Diseases}, publisher={Mary Ann Liebert Inc}, author={Cherry, Natalie A. and Maggi, Ricardo G. and Rossmeisl, John H. and Hegarty, Barbara C. and Breitschwerdt, Edward B.}, year={2011}, month={Nov}, pages={1425–1432} }
 @article{tabar_maggi_altet_vilafranca_francino_roura_2011, title={Gammopathy in a Spanish dog infected with Bartonella henselae}, volume={52}, ISSN={0022-4510}, url={http://dx.doi.org/10.1111/j.1748-5827.2011.01046.x}, DOI={10.1111/j.1748-5827.2011.01046.x}, abstractNote={Generalised pyogranulomatous disease and hyperviscosity syndrome associated with a presumed monoclonal gammopathy was diagnosed in a three‐year‐old intact female Pomeranian. TheBartonella henselaeantibody titer was 1:64 andBartonellaspecies DNA was amplified from the splenic tissue. Monoclonal gammopathies in dogs are typically associated with plasma cell and lymphoid dyscrasias and other inflammatory or infectious diseases such as ehrlichiosis and leishmaniosis. Based on this case report, infection withBartonellaspecies should also be added to the differential diagnoses for gammopathy in dogs. To the authors’ knowledge, this is the first report of molecular evidence ofBartonellaspecies infection in a sick dog in Spain.}, number={4}, journal={Journal of Small Animal Practice}, publisher={Wiley}, author={Tabar, M-D. and Maggi, R. G. and Altet, L. and Vilafranca, M. and Francino, O. and Roura, X.}, year={2011}, month={Mar}, pages={209–212} }
 @article{breitschwerdt_mascarelli_schweickert_maggi_hegarty_bradley_woods_2011, title={Hallucinations, Sensory Neuropathy, and Peripheral Visual Deficits in a Young Woman Infected with Bartonella koehlerae}, volume={49}, ISSN={0095-1137 1098-660X}, url={http://dx.doi.org/10.1128/JCM.00833-11}, DOI={10.1128/jcm.00833-11}, abstractNote={ABSTRACT}, number={9}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Breitschwerdt, Edward B. and Mascarelli, Patricia E. and Schweickert, Lori A. and Maggi, Ricardo G. and Hegarty, Barbara C. and Bradley, Julie M. and Woods, Christopher W.}, year={2011}, month={Aug}, pages={3415–3417} }
 @article{varanat_broadhurst_linder_maggi_breitschwerdt_2011, title={Identification of Bartonella henselae in 2 Cats With Pyogranulomatous Myocarditis and Diaphragmatic Myositis}, volume={49}, ISSN={0300-9858 1544-2217}, url={http://dx.doi.org/10.1177/0300985811404709}, DOI={10.1177/0300985811404709}, abstractNote={ Most cats infected with Bartonella henselae remain outwardly healthy carriers for years; however, self-limiting fever, transient anemia, neurologic dysfunction, lymphadenopathy, reproductive disorders, aortic valvular endocarditis, and neutrophilic myocarditis have been described in experimentally or naturally infected cats. Two cats in a North Carolina shelter died with pyogranulomatous myocarditis and diaphragmatic myositis. Bacteria were visualized in the lesions by Warthin-Starry silver impregnation and by B. henselae immunohistochemistry. B. henselae DNA was amplified and sequenced from the heart of 1 cat and from multiple tissue samples, including heart and diaphragm, from the second cat. This study supports a potential association between B. henselae and what has been historically described as “transmissible myocarditis and diaphragmitis” of undetermined cause in cats. }, number={4}, journal={Veterinary Pathology}, publisher={SAGE Publications}, author={Varanat, M. and Broadhurst, J. and Linder, K. E. and Maggi, R. G. and Breitschwerdt, E. B.}, year={2011}, month={Apr}, pages={608–611} }
 @article{pérez_maggi_diniz_breitschwerdt_2011, title={Molecular and Serological Diagnosis of Bartonella Infection in 61 Dogs from the United States}, volume={25}, ISSN={0891-6640}, url={http://dx.doi.org/10.1111/j.1939-1676.2011.0736.x}, DOI={10.1111/j.1939-1676.2011.0736.x}, abstractNote={Background:Molecular diagnosis of canine bartonellosis can be extremely challenging and often requires the use of an enrichment culture approach followed by PCR amplification of bacterial DNA.}, number={4}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Pérez, C. and Maggi, R.G. and Diniz, P.P.V.P. and Breitschwerdt, E.B.}, year={2011}, month={May}, pages={805–810} }
 @article{breitschwerdt_hegarty_maggi_lantos_aslett_bradley_2011, title={Rickettsia rickettsii transmission by a lone star tick, North Carolina}, volume={17}, number={5}, journal={Emerging Infectious Diseases}, author={Breitschwerdt, E. B. and Hegarty, B. C. and Maggi, R. G. and Lantos, P. M. and Aslett, D. M. and Bradley, J. M.}, year={2011}, pages={873–875} }
 @article{breitschwerdt_hegarty_maggi_lantos_aslett_bradley_2011, title={Rickettsia rickettsiiTransmission by a Lone Star Tick, North Carolina}, volume={17}, ISSN={1080-6040 1080-6059}, url={http://dx.doi.org/10.3201/eid1705.101530}, DOI={10.3201/eid1705.101530}, abstractNote={Only indirect or circumstantial evidence has been published to support transmission of Rickettsia rickettsii by Amblyomma americanum (lone star) ticks in North America. This study provides molecular evidence that A. americanum ticks can function, although most likely infrequently, as vectors of Rocky Mountain spotted fever for humans.}, number={5}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Breitschwerdt, Edward B. and Hegarty, Barbara C. and Maggi, Ricardo G. and Lantos, Paul M. and Aslett, Denise M. and Bradley, Julie M.}, year={2011}, month={May}, pages={873–875} }
 @article{yager_best_maggi_varanat_znajda_breitschwerdt_2010, title={Bacillary angiomatosis in an immunosuppressed dog}, volume={21}, ISSN={0959-4493 1365-3164}, url={http://dx.doi.org/10.1111/j.1365-3164.2010.00879.x}, DOI={10.1111/j.1365-3164.2010.00879.x}, abstractNote={Abstract}, number={4}, journal={Veterinary Dermatology}, publisher={Wiley}, author={Yager, Julie A. and Best, Susan J. and Maggi, Ricardo G. and Varanat, Mrudula and Znajda, Nadine and Breitschwerdt, Edward B.}, year={2010}, month={Mar}, pages={420–428} }
 @article{breitschwerdt_maggi_lantos_woods_hegarty_bradley_2010, title={Bartonella vinsonii subsp berkhoffii and Bartonella henselae bacteremia in a father and daughter with neurological disease}, volume={3}, journal={Parasites & Vectors}, author={Breitschwerdt, E. B. and Maggi, R. G. and Lantos, P. M. and Woods, C. W. and Hegarty, B. C. and Bradley, J. M.}, year={2010} }
 @article{breitschwerdt_maggi_chomel_lappin_2010, title={Bartonellosis: an emerging infectious disease of zoonotic importance to animals and human beings}, volume={20}, ISSN={1479-3261 1476-4431}, url={http://dx.doi.org/10.1111/j.1476-4431.2009.00496.x}, DOI={10.1111/j.1476-4431.2009.00496.x}, abstractNote={OBJECTIVE
To provide a review of clinically relevant observations related to Bartonella species as emerging pathogens in veterinary and human medicine.


DATA SOURCES
Literature as cited in PubMed and as generated by each of the authors who have contributed to various aspects of the clinical understanding of bartonellosis.


HUMAN DATA SYNTHESIS
Important historical and recent publications illustrating the evolving role of animal reservoirs as a source of human infection.


VETERINARY DATA SYNTHESIS
Comprehensive review of the veterinary literature.


CONCLUSIONS
In addition to inducing life-threatening illnesses, such as endocarditis, myocarditis, and meningoencephalitis and contributing to chronic debilitating disease, such as arthritis, osteomyelitis, and granulomatous inflammation in cats, dogs, and potentially other animal species; pets and wildlife species can serve as persistently infected reservoir hosts for the transmission of Bartonella spp. infection to veterinary professionals and others with direct animal contact.}, number={1}, journal={Journal of Veterinary Emergency and Critical Care}, publisher={Wiley}, author={Breitschwerdt, Edward B. and Maggi, Ricardo G. and Chomel, Bruno B. and Lappin, Michael R.}, year={2010}, month={Feb}, pages={8–30} }
 @article{maggi_reichelt_toliver_engber_2010, title={Borrelia species in Ixodes affinis and Ixodes scapularis ticks collected from the coastal plain of North Carolina}, volume={1}, ISSN={1877-959X}, url={http://dx.doi.org/10.1016/j.ttbdis.2010.08.003}, DOI={10.1016/j.ttbdis.2010.08.003}, abstractNote={Ixodes affinis and I. scapularis are tick species that are widely distributed in the coastal plain region of North Carolina. Both tick species are considered enzootic vectors for spirochetal bacteria of the genus Borrelia and specifically for B. burgdorferi s.s., the pathogen most often attributed as the cause of Lyme disease in the USA. Laboratory testing of individual I. affinis and I. scapularis ticks for the presence of Borrelia DNA was accomplished by PCR, targeting 2 regions of the 16S-23S intergenic spacer. In I. affinis, Borrelia DNA was detected in 63.2% of 155 individual ticks. B. burgdorferi s.s. and B. bissettii were identified by DNA sequencing in 33.5% and 27.9% I. affinis, respectively. Statistical differences were found for sex distribution of Borrelia DNA between I. affinis females (76.8%) and I. affinis males (55.6%) where B. burgdorferi s.s. was more prevalent in females (44.6%) than in males (27.3%). In I. scapularis, 298 individually tested ticks yielded no Borrelia PCR-positive results. This study found a higher incidence of Borrelia spp. in I. affinis collected in coastal North Carolina as compared to previous reports for this tick species in other Southern states, highlighting the potential importance of I. affinis in the maintenance of the enzootic transmission cycle of B. burgdorferi s.l. in North Carolina. The lack of Borrelia DNA in I. scapularis highlights the need for additional studies to better define the transmission cycle for B. burgdorferi s.s. in the southeastern USA and specifically in the state of North Carolina.}, number={4}, journal={Ticks and Tick-borne Diseases}, publisher={Elsevier BV}, author={Maggi, Ricardo G. and Reichelt, Sara and Toliver, Marcée and Engber, Barry}, year={2010}, month={Dec}, pages={168–171} }
 @article{perez_diniz_maggi_breitschwerdt_2010, title={Diversity of bartonella species in 62 dogs using the bapgm pre-enrichment culture method}, volume={24}, number={3}, journal={Journal of Veterinary Internal Medicine}, author={Perez, C. and Diniz, P.P.V.P. and Maggi, R.G. and Breitschwerdt, E.B.}, year={2010}, pages={759} }
 @article{sykes_lindsay_maggi_breitschwerdt_2010, title={Human Coinfection with Bartonella henselae and Two Hemotropic Mycoplasma Variants Resembling Mycoplasma ovis}, volume={48}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.01029-10}, DOI={10.1128/jcm.01029-10}, abstractNote={ABSTRACT}, number={10}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Sykes, J. E. and Lindsay, L. L. and Maggi, R. G. and Breitschwerdt, E. B.}, year={2010}, month={Aug}, pages={3782–3785} }
 @article{breitschwerdt_maggi_farmer_mascarelli_2010, title={Molecular Evidence of Perinatal Transmission of Bartonella vinsonii subsp. berkhoffii and Bartonella henselae to a Child}, volume={48}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.00326-10}, DOI={10.1128/jcm.00326-10}, abstractNote={ABSTRACT}, number={6}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Breitschwerdt, E. B. and Maggi, R. G. and Farmer, P. and Mascarelli, P. E.}, year={2010}, month={Apr}, pages={2289–2293} }
 @article{breitschwerdt_maggi_mozayeni_hegarty_bradley_mascarelli_2010, title={PCR amplification of Bartonella koehlerae from human blood and enrichment blood cultures}, volume={3}, journal={Parasites & Vectors}, author={Breitschwerdt, E. B. and Maggi, R. G. and Mozayeni, B. R. and Hegarty, B. C. and Bradley, J. M. and Mascarelli, P. E.}, year={2010} }
 @article{dietrich_schmidgen_maggi_richter_matuschka_vonthein_breitschwerdt_kempf_2010, title={Prevalence of Bartonella henselae and Borrelia burgdorferi Sensu Lato DNA in Ixodes ricinus Ticks in Europe}, volume={76}, ISSN={0099-2240}, url={http://dx.doi.org/10.1128/AEM.02788-09}, DOI={10.1128/aem.02788-09}, abstractNote={ABSTRACT}, number={5}, journal={Applied and Environmental Microbiology}, publisher={American Society for Microbiology}, author={Dietrich, F. and Schmidgen, T. and Maggi, R. G. and Richter, D. and Matuschka, F.-R. and Vonthein, R. and Breitschwerdt, E. B. and Kempf, V. A. J.}, year={2010}, month={Jan}, pages={1395–1398} }
 @article{chinnadurai_birkenheuer_blanton_maggi_belfiore_marr_breitschwerdt_stoskopf_2010, title={Prevalence of Selected Vector-borne Organisms and Identification of Bartonella Species DNA in North American River Otters (Lontra canadensis)}, volume={46}, ISSN={0090-3558}, url={http://dx.doi.org/10.7589/0090-3558-46.3.947}, DOI={10.7589/0090-3558-46.3.947}, abstractNote={Trapper-killed North American river otters (Lontra canadensis) in North Carolina, USA, were screened for multiple vector-borne bacteria known to be pathogenic to mammals. Blood was collected from 30 carcasses in 2006, from 35 in 2007, and from one live otter in 2008. Samples were screened using conventional polymerase chain reaction (PCR) tests for DNA from Bartonella spp., Ehrlichia spp., and spotted fever group Rickettsia spp. All samples were negative for Rickettsia spp. Twelve of 30 samples from 2006 produced amplicons using the assay designed to detect Ehrlichia spp., but sequencing revealed that the amplified DNA fragment was from a novel Wolbachia sp., thought to be an endosymbiote of a Dirofilaria sp. Between 2006 and 2007, DNA from a novel Bartonella sp. was detected in 19 of 65 animals (29%). Blood from one live otter captured in 2008 was found positive for this Bartonella sp. by both PCR and culture. The pathogenicity of this Bartonella species in river otters or other mammals is unknown.}, number={3}, journal={Journal of Wildlife Diseases}, publisher={Wildlife Disease Association}, author={Chinnadurai, Sathya K. and Birkenheuer, Adam J. and Blanton, Hunter L. and Maggi, Ricardo G. and Belfiore, Natalia and Marr, Henry S. and Breitschwerdt, Edward B. and Stoskopf, Michael K.}, year={2010}, month={Jul}, pages={947–950} }
 @article{otranto_de caprariis_lia_tarallo_lorusso_testini_dantas-torres_latrofa_diniz_mencke_et al._2010, title={Prevention of endemic canine vector-borne diseases using imidacloprid 10% and permethrin 50% in young dogs: A longitudinal field study}, volume={172}, ISSN={0304-4017}, url={http://dx.doi.org/10.1016/j.vetpar.2010.05.017}, DOI={10.1016/j.vetpar.2010.05.017}, abstractNote={Canine vector-borne diseases (CVBDs) are highly prevalent and increasing in distribution worldwide. A longitudinal study was conducted in southern Italy to determine the incidence of and protection against CVBD-causing pathogens in dogs treated with a combination of imidacloprid 10% and permethrin 50% (ImPer). One hundred eleven autochthonous young dogs were divided into group A (n = 63) and group B (n = 48), both groups containing dogs positive and negative for one or more CVBD-causing pathogens. Additionally, 10 naïve male beagles were introduced in each group in May 2008. Group A was treated with ImPer on day 0 and every 21 ± 2 days whereas group B was left untreated. Blood and skin samples were collected at baseline (March–April 2008) and at the first, second and third follow-up times (July and October 2008 and April 2009). Bone marrow was sampled at baseline and at the third follow-up. Serological, cytological and molecular tests were performed to detect Anaplasma platys, Babesia spp., Bartonella spp., Dirofilaria immitis, Ehrlichia canis, Hepatozoon canis and Leishmania infantum. Ectoparasites (fleas, ticks, and sand flies) were monitored throughout the study. The baseline prevalence of CVBDs was 39.6% with 44 dogs positive for at least one pathogen. A. platys (27.5%) and Babesia spp. (15.6%) were the most prevalent species and co-infections with up to two pathogens were detected in 16 (14.7%) individuals. At the end of the evaluation period, there was a 90.7% reduction in overall CVBD incidence density rate (IDR) in group A, as following: 100% reduction in L. infantum; 94.6% in E. canis; 94.4% in Babesia spp.; and 81.8% in A. platys. Initially positive treated dogs showed significantly lower pathogen prevalence at the third follow-up than untreated ones. At the end of the evaluation period, 8 of the 10 untreated beagles were infected with at least one pathogen whereas one of the treated beagles was A. platys positive at a single time point (second follow-up). Overall efficacy against ticks was 97.9%. In October 2009, samples were collected from the remaining 83 dogs (44 from group A and 39 from group B) to investigate the annual incidence of CVBDs in the same, at this time untreated, dog population. A high year incidence for tick-borne diseases (78.1%) and for L. infantum (13.6%) was detected in dogs from group A, seven months after the treatment had been withdrawn. The results demonstrate that ImPer preventive treatment against arthropods protects autochthonous and naïve beagle dogs against CVBD-causing pathogens.}, number={3-4}, journal={Veterinary Parasitology}, publisher={Elsevier BV}, author={Otranto, D. and de Caprariis, D. and Lia, R.P. and Tarallo, V. and Lorusso, V. and Testini, G. and Dantas-Torres, F. and Latrofa, S. and Diniz, P.P.V.P. and Mencke, N. and et al.}, year={2010}, month={Sep}, pages={323–332} }
 @article{perez_hummel_keene_maggi_diniz_breitschwerdt_2010, title={Successful treatment ofBartonella henselaeendocarditis in a cat}, volume={12}, ISSN={1098-612X 1532-2750}, url={http://dx.doi.org/10.1016/j.jfms.2009.12.018}, DOI={10.1016/j.jfms.2009.12.018}, abstractNote={This report describes the clinical presentation, diagnosis and treatment of a cat with vegetative valvular endocarditis temporally associated with natural infection with Bartonella henselae. Lethargy, abnormal gait and weakness were the main clinical signs that resulted in referral for diagnostic evaluation. Using a novel and sensitive culture approach, B henselae was isolated from the blood. Following antibiotic therapy there was total resolution of clinical signs, the heart murmur, the valvular lesion by echocardiography, and no Bartonella species was isolated or amplified from a post-treatment blood culture. In conjunction with previous case reports, infective endocarditis can be associated with natural B henselae infection in cats; however, early diagnosis and treatment may result in a better prognosis than previously reported.}, number={6}, journal={Journal of Feline Medicine and Surgery}, publisher={SAGE Publications}, author={Perez, Cristina and Hummel, James B. and Keene, Bruce W. and Maggi, Ricardo G. and Diniz, Pedro P.V.P. and Breitschwerdt, Edward B.}, year={2010}, month={Jun}, pages={483–486} }
 @article{oliveira_maggi_woods_breitschwerdt_2010, title={Suspected Needle Stick Transmission of Bartonella vinsonii subspecies berkhoffii to a Veterinarian}, volume={24}, ISSN={0891-6640}, url={http://dx.doi.org/10.1111/j.1939-1676.2010.0563.x}, DOI={10.1111/j.1939-1676.2010.0563.x}, abstractNote={A 7-year-old male Newfoundland dog was referred to the North Carolina State University Veterinary Teaching Hospital (NCSU-VTH) for evaluation of multiple, diffuse cutaneous masses. Fine-needle aspiration yielded a population of round cells consistent with a histiocytic, lymphocytic, or highly undifferentiated epithelial neoplasm. Because of the poor prognosis associated with cutaneous disseminated cancers, the owner declined additional diagnostic evaluation and after discharge from the NCSU-VTH elected euthanasia. The dog was very fractious during aspiration of the cutaneous mass, and the veterinarian experienced a needle stick to the right index finger with the 22 G needle used for aspiration. Because ehrlichiosis was diagnosed serologically in the dog 5 months earlier, the Intracellular Pathogens Research Laboratory (IPRL) was consulted relative to the zoonotic risk of needle stick transmission of an Ehrlichia spp. Ehrlichia canis seroreactive dogs residing in the southeastern United States often are concurrently seroreactive to Bartonella vinsonii subsp. berkhoffii antigens and can be coinfected with both organisms,1 therefore the potential transmission of both of these alpha Proteobacteria was investigated. Bartonella and Ehrlichia spp. antibodies were determined by previously described immunofluorescence antibody assays (IFA), with titers ≥1 : 64 considered seroreactive.2 Using the Bartonella alpha Proteobacteria growth medium (BAPGM) diagnostic platform,3,4 polymerase chain reaction (PCR) was performed after direct extraction from blood and serum, after enrichment culture for at least 14 days (typically at 7 and at 14 days) and from subculture colonies, if visualized. Methods used for DNA extraction, conventional PCR targeting of the Bartonella 16S–23S intergenic spacer region, cloning, and sequencing have been described previously.5–8 Sequences were aligned and compared with GenBank sequences with AlignX software.a,5–8 Historically, the veterinarian had always been healthy. During the 1-year period before, and at the time of the needle stick (day 0), the veterinarian reported no headaches, fatigue, or other medical problems. On postinoculation day (PID) 5, when the 1st blood sample was obtained, there was no serological or molecular evidence to support Ehrlichia or Bartonella spp. exposure or infection. Specifically, B. vinsonii subsp. berkhoffii genotypes I, II, and III, Bartonella henselae, and E. canis antibodies were not detected, Ehrlichia spp. DNA was not amplified from the extracted blood sample and Bartonella spp. DNA was not amplified from any of the samples generated as a component of the BAPGM diagnostic platform (Table 1). By PID 34, the veterinarian reported frequent headaches (near daily for the previous week), fatigue, and intermittent paresthesias in the left arm in focal, nondermatomal areas. B. vinsonii subsp. berkhoffii genotype I was amplified and sequenced after direct extraction of DNA from both PID 34 acid-citrate-dextrose and ethylenediaminetetraacetic acid-anticoagulated blood tubes, but PCR from both BAPGM enrichment cultures and subcultures was negative and the patient had not seroconverted to any Bartonella sp. antigen. Repeated blood culture on PID 81 resulted in amplification and sequencing of B. vinsonii subsp. berkhoffii genotype I from the BAPGM enrichment culture and there was an indication that the patient was generating an antibody response to B. vinsonii subsp. berkhoffii genotypes I and III. Subsequent serological testing confirmed seroconversion to B. vinsonii subsp. berkhoffii genotypes I and III (≥4-fold rise in antibody titer). For serum samples obtained on PIDs 97 and 123, antibody titers remained unchanged, but all BAPGM platform PCR results were negative. Because of continued headaches and fatigue, the patient was evaluated by an infectious disease physician. Serum biochemical profile results were within reference ranges and neither B. henselae or Bartonella quintana IgM or IgG antibodies were detected. On PID 138, treatment with doxycycline (100 mg PO q12h) and rifampin (300 mg PO q12h) for 6 weeks was instituted by the attending physician. During the first 2 weeks after starting antibiotics, the patient reported a substantial increase in the severity and frequency of fatigue and headaches, which were accompanied by occasional episodes of dizziness and a single episode of epistaxis. After completion of the antibiotic treatment, all clinical signs resolved and the patient has remained healthy during a 1-year follow-up period. BAPGM platform PCR results obtained on PIDs 144, 180, 206, and 234 were negative, and antibodies to B. vinsonii subsp. berkhoffii genotypes I decreased to the screening dilution of 1 : 16 and genotype III antibodies were no longer detectable (ie, there was no organism fluorescence at the standard screening dilution of 1 : 16) in the patient's serum samples. The patient did not seroconvert to E. canis antigens and Ehrlichia sp. DNA was not amplified from any blood sample. A single tumor aspiration cytology slide represented the only diagnostic sample obtained from the dog at the time of examination. Therefore, cells were retrospectively scraped with a scalpel blade from the Wright-Giemsa stained microscope slide into a sterile vial, DNA was extracted and B. vinsonii subsp. berkhoffii genotype III was amplified and sequenced. Despite multiple cloning attempts, B. vinsonii subsp. berkhoffii genotype I (the genotype detected in the patient's blood on 2 independent occasions) was not sequenced from the extracted cytological specimen. We cannot rule out the possibility that amplification of B. vinsonii subsp. berkhoffii genotype III DNA from the cytology slide represents DNA carryover during slide processing in the laboratory rather than the presence of this bacteria in the dog at the time of cytological sampling.9 B. vinsonii subsp. berkhoffii initially was isolated from a dog with endocarditis in 1993, after which 4 B. vinsonii subsp. berkhoffii 16S–23S intergenic spacer region genotypes were described in dogs, coyotes, foxes, and humans.10 All 4 genotypes have been reported in dogs in association with endocarditis and a spectrum of other clinical manifestations.11 Dogs are the primary reservoir hosts for B. vinsonii subsp. berkhoffii, which is an important emerging zoonotic pathogen.5–7,12,13 The veterinarian in this study experienced a needle stick while obtaining a fine-needle aspiration sample, after which clinical signs, including headaches, fatigue, and intermittent paresthesias, developed. As the veterinarian had not experienced any of these clinical signs previously and because the clinical signs resolved after antibiotic treatment, it seems possible that infection with B. vinsonii subsp. berkhoffii caused or contributed to the illness. The patient seroconverted to B. vinsonii subsp. berkhoffii genotypes I and III and antibody titers to these 2 genotypes persisted between PIDs 97 through 180. As reported previously for B. vinsonii subsp. berkhoffii infection in dogs, this patient became nonseroreactive after being treated with antibiotics.14 As this individual did not produce detectable antibodies to B. vinsonii subsp. berkhoffii genotype II or to B. henselae antigens, there appeared to be a substantial degree of specificity in the serological response after the needle stick; however, serological cross reactivity between genotypes I and III cannot be ruled out. Previous studies from our laboratory indicate that approximately half of human patients infected with a Bartonella sp. do not have detectable IFA antibodies, whereas other patients are broadly reactive against a panel of Bartonella spp. antigens.5,6 As B. vinsonii subsp. berkhoffii genotype IV has not been successfully isolated, serology could not be performed against this genotype.11 In this veterinarian, active infection with B. vinsonii subsp. berkhoffii genotype I was confirmed by amplification and sequencing of DNA directly from 2 blood samples obtained on PID 34 and subsequently from a BAPGM enrichment blood culture on PID 81, which would reflect growth of the bacteria in the liquid culture medium. B. vinsonii subsp. berkhoffii genotype I most often infects dogs and coyotes,1 but has been reported in 2 human patients from the United States.3 Based upon the cumulative testing experience with animal or human patient samples in the IPRL, genotype II has been most frequently amplified and sequenced from blood samples derived from cats, dogs, and people 5–8,12,13 whereas genotypes I or III are only rarely found. Genotype III was first described in a human patient with endocarditis from France 15 and was subsequently isolated from a military working dog that originated from Germany and was subsequently diagnosed with endocarditis while stationed in Texas.16 Genotype III also has been sequenced from gray foxes from California,17 from dogs in Greece and Italy,18 from dogs in China,19 and from feral swine and foxes in the southeastern United States (A. Beard, R. Maggi, and E. Breitschwerdt, unpublished data). Presumably because of technical limitations, we were only able to confirm infection with genotype III in the small quantity of DNA that was obtained from the dog's cytology specimen. Alternatively, genotype III DNA may have been because of carryover in the laboratory.9 Based upon the patient's pattern of seroconversion, it is possible that 2 genotypes were transmitted to the veterinarian by needle inoculation. Alternatively, we cannot rule out the possibility of a switch from genotype III in the dog to genotype I in the patient, perhaps induced by immune pressure on the bacteria. However, the 16S–23S intergenic spacer region does not code for proteins, and in previous studies from our laboratory sequential passage of B. vinsonii subsp. berkhoffii genotype I in BAPGM did not result in a change in genotype.10 In addition, differences in the amino acid sequence-based alignments of the phage-associated protein 31 of B. vinsonii subsp. berkhoffii genotypes I and III 10 also suggest that a switch of genotype is unlikely. Simultaneous infection with more than 1 Bartonella sp. or genotype has been reported in dogs, rodents, and human beings.5,6,11,20 However, molecular documentation of a single Bartonella sp. in diagnostic samples from dogs and human patients remains technically challenging, and documentation of coinfection with more than 1 Bartonella spp. in patient samples is more difficult.18,20 It is becoming increasingly evident that dogs can serve as a source for human infection with B. vinsonii subsp. berkhoffii. Recently, dog bite transmission of B. vinsonii to a child in France was inferred based upon serological testing.21 Also, B. vinsonii subsp. berkhoffii genotypes I and II have been sequenced from dog saliva.22 Although our patient had cat and dog contact, this veterinarian reported no history of animal scratches or bites in the 24 months before or during the follow-up period after the accidental needle stick. Obviously, other modes of transmission (eg, arthropod exposure) are possible, but this individual rarely participated in outdoor activities. A serosurvey from the southeastern United States identified exposure to fleas, ticks, cattle, and a rural environment as risk factors associated with B. vinsonii subsp. berkhoffii seroreactivity in dogs.1 The dog in this report lived in a rural environment, was regularly infested with ticks and fleas, and had historically been treated for infection with an Ehrlichia sp. In dogs experimentally infected with E. canis, there was no serological cross-reactivity with B. vinsonii subsp. berkhoffii antigens.1 As B. vinsonii subsp. berkhoffii antibodies were found in 36–42% of E. canis seroreactors,1 we investigated the potential transmission of both organisms to this veterinarian. Five days after the needle stick, the veterinarian remained asymptomatic and there was no serologic, microbiologic, or molecular evidence of Bartonella spp. infection. Subsequently, headaches, numbness, and parethesias in the extremities developed. These clinical signs have been described previously in a small number of immunocompetent persons infected with B. vinsonii subsp. berkhoffii or B. henselae.5–7 After initiation of antibiotic treatment, this patient had 1 episode of epistaxis, a rarely reported clinical sign in cat scratch disease patients and a clinical sign associated with bartonellosis in dogs.23 If the mode of transmission was because of the needle stick, this patient required approximately 12 weeks before seroconversion was detected. Although seroconversion may have been delayed because of a low-dose inoculum, there are minimal data that define the pattern of seroconversion after transmission of any Bartonella spp. to a human. In this patient, we were fortunate to have access to 9 serum samples, spanning PID 5 through PID 234, which were all retested blindly by the same research technician at the same time, and with the same conjugate and antigen preparations. This was done to generate the most consistent serological comparisons possible. Because all known Bartonella spp. are vector-transmitted blood-borne pathogens, inadvertent transmission by needle stick or by blood transfusion seems plausible. B. henselae was successfully isolated from units of human blood after experimental inoculation and after storage at 4°C for 35 days.24 On an ultrastructural basis, the same research group implicated infection with a Bartonella spp. in an aplastic anemia patient, who died after receiving multiple red blood cell transfusions.25 At the NCSU-VTH, canine and feline blood donors are routinely screened using the BAPGM platform for evidence of Bartonella sp. infection. As evolving evidence indicates that there are numerous Bartonella spp. that have coevolved as highly adapted intravascular and intraerythrocytic organisms in pets and numerous wildlife species, animal health professionals should exercise special caution when obtaining, handling, or processing diagnostic specimens derived from animals. In conclusion, the clinical history as well as serological and molecular microbiological findings suggest the possibility of needle stick transmission of B. vinsonii subsp. berkhoffii genotypes I and III to this veterinarian. After administration of antibiotics, all clinical signs resolved, B. vinsonii subsp. berkhoffii antibodies decreased to nondiagnostic levels and repeated enrichment blood cultures were PCR negative. a Vector NTI Suite 6.0, InforMax Inc, Bethesda, MD We thank Julie Bradley for serological testing, Barbara Hegarty for preparation of Ehrlichia and Bartonella spp. antigens, and Tonya Lee for editorial assistance. This research was supported in part by a grant from the American College of Veterinary Internal Medicine Foundation and by the State of North Carolina. The data in this report were not presented previously. Disclosure : In conjunction with Dr Sushama Sontakke and North Carolina State University, Dr Breitschwerdt holds US Patent No. 7,115,385; Media and Methods for Cultivation of Microorganisms, which was issued October 3, 2006. He is the chief scientific officer for Galaxy Diagnostics, a newly formed company that provides diagnostic testing for the detection of Bartonella species infection in animals and in human patient samples. Dr Ricardo Maggi is the Scientific Technical Advisor and Laboratory Director for Galaxy Dx.}, number={5}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Oliveira, A.M. and Maggi, R.G. and Woods, C.W. and Breitschwerdt, E.B.}, year={2010}, month={Aug}, pages={1229–1232} }
 @article{breitschwerdt_maggi_cadenas_vissotto de paiva diniz_2009, title={A Groundhog, a Novel Bartonella Sequence, and My Father's Death}, volume={15}, ISSN={1080-6040}, url={http://dx.doi.org/10.3201/eid1512.090206}, DOI={10.3201/eid1512.090206}, abstractNote={During the summer of 2007, migratory joint pain developed in my (E.B.B.) 86-year-old father, previously an ironworker, farmer, and World War II veteran. Because of occasional tick attachments, a Borrelia burgdorferi ELISA was performed; antibodies were not detected, and no treatment was instituted. In the fall, subtle memory loss developed, and he fell twice a few weeks apart. Dad jokingly blamed the falls and the memory loss on “old timer’s disease.” Subsequently, episodes of subtle confusion and more frequent memory loss generated family concern as to what the future might hold. On December 15, he broke his left femur during a fall while climbing 2 stairs to enter our home. Despite having successfully climbed those stairs thousands of times in the past, he would never climb those or any other stairs again. 
 
Retrospectively obvious, a pattern of insidious illness characterized by joint pain, memory loss, and incoordination, not recognizable by my father or other family members, had begun before that summer. Medically stable historical problems included coronary artery disease, atherosclerosis, carotid artery occlusion, hypertension, and atrial fibrillation. During the previous year, a normocytic, normochromic, nonregenerative anemia persisted. Despite normal serum iron, total iron binding capacity, ferritin, and vitamin B12 values, anemia was attributed to intestinal blood loss. When examined in May 2007, before anesthesia for endoscopy, mood and affect were appropriate, recent and remote memory were intact, insight and judgment were good. A hiatal hernia, mild antral gastritis, and duodenitis were visualized.}, number={12}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Breitschwerdt, Edward B. and Maggi, Ricardo G. and Cadenas, Maria Belen and Vissotto de Paiva Diniz, Pedro Paulo}, year={2009}, month={Dec}, pages={2080–2086} }
 @inproceedings{breitschwerdt_maggi_2009, title={A confusing case of canine vector-borne disease: clinical signs and progression in a dog co-infected with Ehrlichia canis and Bartonella vinsonii ssp berkhoffii}, volume={2}, booktitle={Parasites & Vectors}, author={Breitschwerdt, E. B. and Maggi, R. G.}, year={2009} }
 @article{breitschwerdt_maggi_2009, title={A confusing case of canine vector-borne disease: clinical signs and progression in a dog co-infected with Ehrlichia canis and Bartonella vinsonii ssp. berkhoffii}, volume={2}, ISSN={1756-3305}, url={http://dx.doi.org/10.1186/1756-3305-2-S1-S3}, DOI={10.1186/1756-3305-2-S1-S3}, abstractNote={Bartonella spp. are important pathogens in human and veterinary medicine, and bartonellosis is considered as an emerging zoonosis that is being reported with increasing frequency. Of 22 known species and subspecies of Bartonella, seven have been isolated from dogs, causing disease manifestations similar to those seen in human beings. The wide variety of clinical signs and the possible chronic progression of disease manifestations are illustrated in the case of an infected Labrador retriever. Here, the authors discuss the seemingly diverse spectrum of disease manifestations, the co-infections of Bartonella spp. with other vector-borne pathogens (mainly Ehrlichia spp. or Babesia spp.) and the difficulties in microbiological confirmation of an active Bartonella infection, all of which make the disease pathogenesis and clinical diagnosis more problematic.}, number={Suppl 1}, journal={Parasites & Vectors}, publisher={Springer Nature}, author={Breitschwerdt, Edward B and Maggi, Ricardo G}, year={2009}, pages={S3} }
 @article{breitschwerdt_maggi_cadenas_diniz_2009, title={A groundhog, a novel bartonella sequence, and my father's death}, volume={15}, number={12}, journal={Emerging Infectious Diseases}, author={Breitschwerdt, E. B. and Maggi, R. G. and Cadenas, M. B. and Diniz, P. P. V. D.}, year={2009}, pages={2080–2086} }
 @article{chomel_kasten_williams_wey_henn_maggi_carrasco_mazet_boulouis_maillard_et al._2009, title={Bartonella Endocarditis}, volume={1166}, ISSN={0077-8923}, url={http://dx.doi.org/10.1111/j.1749-6632.2009.04523.x}, DOI={10.1111/j.1749-6632.2009.04523.x}, abstractNote={Bartonellae were first recognized to cause endocarditis in humans in 1993 when cases caused byBartonella quintana,B. elizabethae,andB. henselaewere reported. Since the first isolation ofBartonella vinsoniisubspeciesberkhoffiifrom a dog with endocarditis, this organism has emerged as an important pathogen in dogs and an emerging pathogen in people. Subsequently, four types ofB. vinsoniisubsp.berkhoffiihave been described, all of which have been associated with endocarditis in dogs. A limited number of dog endocarditis cases have also been associated withB. clarridgeiae,B. washoensis,B. quintana,andB. rochalimae. The second canineB. clarridgeiaeendocarditis case is presented. The clinical and pathological characteristics ofBartonellaendocarditis in dogs are similar to disease observed in humans, more often affecting the aortic valve, presenting with highly vegetative lesions with accompanying calcification, and in most instances high antibody titers. Pathological features in dogs include a combination of fibrosis, mineralization, endothelial proliferation, and neovascularization with variable inflammation. Endocarditis has also been described in animal species, which are the natural reservoir of specificBartonellaspecies, once thought to be solely healthy carriers of these pathogens. A fewBartonellaendocarditis cases, includingB. henselae, have been reported in cats in the USA and Australia. The second case ofB. henselaetype Houston I identified in the USA is presented. Furthermore, two cases ofB. bovisendocarditis were recently described in adult cows from France. Finally, on‐going investigation of valvular endocarditis in free‐ranging Alaskan sea otters suggests the involvement ofBartonellaspecies.}, number={1}, journal={Annals of the New York Academy of Sciences}, publisher={Wiley}, author={Chomel, Bruno B. and Kasten, R.W. and Williams, C. and Wey, A.C. and Henn, J.B. and Maggi, R. and Carrasco, S. and Mazet, J. and Boulouis, H.J. and Maillard, R. and et al.}, year={2009}, month={May}, pages={120–126} }
 @inproceedings{chomel_kasten_williams_wey_henn_maggi_carrasco_mazet_boulouis_maillard_et al._2009, title={Bartonella endocarditis: A pathology shared by animal reservoirs and patients}, volume={1166}, booktitle={Rickettsiology and rickettsial diseases}, author={Chomel, B. B. and Kasten, R. W. and Williams, C. and Wey, A. C. and Henn, J. B. and Maggi, R. and Carrasco, S. and Mazet, J. and Boulouis, H. J. and Maillard, R. and et al.}, year={2009}, pages={120–126} }
 @article{diniz_wood_maggi_sontakke_stepnik_breitschwerdt_2009, title={Co-isolation of Bartonella henselae and Bartonella vinsonii subsp. berkhoffii from blood, joint and subcutaneous seroma fluids from two naturally infected dogs}, volume={138}, ISSN={0378-1135}, url={http://dx.doi.org/10.1016/j.vetmic.2009.01.038}, DOI={10.1016/j.vetmic.2009.01.038}, abstractNote={This report describes the clinical presentation, isolation and treatment of two dogs naturally infected with Bartonella henselae and Bartonella vinsonii subsp. berkhoffii. Chronic and progressive polyarthritis was the primary complaint for dog #1, from which B. henselae and B. vinsonii subsp. berkhoffii were cultured on three independent occasions from blood and joint fluid samples, despite administration of nearly 4 months of non-consecutive antibiotic therapy. A clinically atypical and progressively severe trauma-associated seroma was the primary complaint for dog #2, from which B. henselae and B. vinsonii subsp. berkhoffii were isolated from serum, blood and seroma fluid. Dogs can be co-infected with two Bartonella spp. and infection with these organisms should not be ruled out if specific antibodies are not detected. Specialized culture techniques should be used for isolation and to assess antibiotic efficacy.}, number={3-4}, journal={Veterinary Microbiology}, publisher={Elsevier BV}, author={Diniz, Pedro Paulo Vissotto de Paiva and Wood, Michael and Maggi, Ricardo G. and Sontakke, Sushama and Stepnik, Matt and Breitschwerdt, Edward B.}, year={2009}, month={Sep}, pages={368–372} }
 @article{biswas_maggi_papich_keil_breitschwerdt_2009, title={Comparative Activity of Pradofloxacin, Enrofloxacin, and Azithromycin against Bartonella henselae Isolates Collected from Cats and a Human}, volume={48}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.01287-09}, DOI={10.1128/jcm.01287-09}, abstractNote={ABSTRACT}, number={2}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Biswas, S. and Maggi, R. G. and Papich, M. G. and Keil, D. and Breitschwerdt, E. B.}, year={2009}, month={Dec}, pages={617–618} }
 @article{breitschwerdt_maggi_2009, title={Comparative medical features of canine and human bartonellosis}, volume={15}, ISSN={1198-743X}, url={http://dx.doi.org/10.1111/j.1469-0691.2008.02184.x}, DOI={10.1111/j.1469-0691.2008.02184.x}, abstractNote={E. B. Breitschwerdt and R. G. MaggiIntracellular Pathogens Research Laboratory, Center for Comparative Medicine and TranslationalResearch, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USAINTRODUCTIONBartonella species are increasingly recognised asimportant bacterial pathogens in veterinary andhuman medicine. These organisms can be trans-mitted by an arthropod vector or alternatively byanimal scratches or bites. Among the 22 species orsubspecies known today, seven species, includingthree subspecies of Bartonella henselae, and fourgenotypes of Bartonella vinsonii subsp. berkhoffii,have been detected in or isolated from pet dogs,thereby highlighting the zoonotic potential ofthese bacteria [1–4].Bartonella vinsonii subsp. berkhoffiiSince the isolation of B. vinsonii subsp. berkhoffiifrom the blood of a dog with intermittent epi-staxis and endocarditis in 1993, this organism hasbecome an important pathogen in dogs and is anemerging pathogen in people [1,2]. Current evi-dence indicates that canids, including coyotes,dogs and grey foxes, potentially serve as reservoirhosts. In dogs, B. vinsonii subsp. berkhoffii has beenidentified as an important cause of endocarditisand has been associated with cardiac arrhyth-mias, myocarditis, granulomatous rhinitis, ante-rior uveitis and chorioretinitis. More recently, thisspecies has been detected in a dog with systemicgranulomatous disease involving the spleen,heart, lymph nodes, liver, kidney, lung, medias-tinum and salivary glands, and also in the bloodand lymph nodes of dogs with lymphoma, and inthe saliva of healthy dogs [3–5]. In addition,co-infection with two of the four previouslydescribed B. vinsonii subspecies berkhoffii geno-types was identified in the same dog.Bartonella henselaeBased upon molecular evidence, B. henselae hasbeen implicated in several pathological conditionsin dogs, including peliosis hepatis, granuloma-tous hepatitis, generalised pyogranulomatouslymphadenitis, and endocarditis. It is unclear asto how dogs become infected and whether dogsserve as accidental hosts or as chronically bacte-raemic reservoirs for B. henselae. More recently,Bartonella spp. were detected in the blood andlymph nodes of healthy golden retrievers and ingolden retrievers with lymphoma [3,4]. Molecularprevalence of Bartonella spp. infection was 18% inboth study populations.Other Bartonella speciesSimilar to people, dogs can develop endocarditisand presumably other serious disease manifesta-tions when infected with both reservoir andnon-reservoir Bartonella species. Non-reservoirBartonella species, including Bartonella clarridgeiae,BartonellawashoensisandBartonellaelizabethae,havebeen associated with endocarditis, hepatic diseaseand sudden death in dogs. More recently, Barto-nella quintana DNA has been detected in two dogswith endocarditis, and in the blood and lymphnodes of dogs with lymphoma, and in the blood,lymph nodes and saliva of healthy dogs [4,5].BARTONELLA PRE-ENRICHMENTCULTUREWhen testing cat blood samples, B. henselae andB. clarridgeae can be isolated effectively using agar}, journal={Clinical Microbiology and Infection}, publisher={Elsevier BV}, author={Breitschwerdt, E.B. and Maggi, R.G.}, year={2009}, month={Dec}, pages={106–107} }
 @article{varanat_maggi_linder_horton_breitschwerdt_2009, title={Cross-contamination in the Molecular Detection of Bartonella from Paraffin-embedded Tissues}, volume={46}, ISSN={0300-9858 1544-2217}, url={http://dx.doi.org/10.1354/vp.08-VP-0259-B-BC}, DOI={10.1354/vp.08-VP-0259-B-BC}, abstractNote={ The genus Bartonella comprises a group of gram-negative, fastidious bacteria. Because of diagnostic limitations of culture and serologic testing, polymerase chain reaction (PCR) has become a powerful tool for the detection of Bartonella spp. in blood and tissue samples. However, because many wild and domestic animals harbor Bartonella spp., transfer of Bartonella DNA during sample collection or histologic processing could result in false-positive PCR test results. In this study, we describe evidence of Bartonella DNA dissemination and transfer in the necropsy room and during the subsequent processing of formalin-fixed paraffin-embedded tissues. Bartonella DNA was amplified from different areas of the necropsy room, from the liquid paraffin in the tissue processor, and from different parts of the microtome. Unless stringent procedures are established and followed to avoid cross-contamination, the molecular detection of Bartonella spp. from tissue samples obtained at necropsy or processed in a multispecies histopathology laboratory will not be reliable. }, number={5}, journal={Veterinary Pathology}, publisher={SAGE Publications}, author={Varanat, M. and Maggi, R. G. and Linder, K. E. and Horton, S. and Breitschwerdt, E. B.}, year={2009}, month={May}, pages={940–944} }
 @article{breitschwerdt_maggi_varanat_linder_weinberg_2009, title={Isolation of Bartonella vinsonii subsp. berkhoffii Genotype II from a Boy with Epithelioid Hemangioendothelioma and a Dog with Hemangiopericytoma}, volume={47}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.00069-09}, DOI={10.1128/JCM.00069-09}, abstractNote={ABSTRACT}, number={6}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Breitschwerdt, E. B. and Maggi, R. G. and Varanat, M. and Linder, K. E. and Weinberg, G.}, year={2009}, month={Apr}, pages={1957–1960} }
 @article{maggi_kosoy_mintzer_breitschwerdt_2009, title={Isolation of Candidatus Bartonella melophagi from Human Blood}, volume={15}, ISSN={1080-6040 1080-6059}, url={http://dx.doi.org/10.3201/eid1501.081080}, DOI={10.3201/eid1501.081080}, abstractNote={Candidatus Bartonella melophagi was isolated by blood culture from 2 women, 1 of whom was co-infected with B. henselae. Partial 16S rRNA, RNA polymerase B, and citrate synthase genes and 16S–23S internal transcribed spacer sequences indicated that human isolates were similar to Candidatus B. melophagi.}, number={1}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Maggi, Ricardo G. and Kosoy, Michael and Mintzer, Melanie and Breitschwerdt, Edward B.}, year={2009}, month={Jan}, pages={66–68} }
 @article{cherry_diniz_maggi_hummel_hardie_behrend_rozanski_defrancesco_cadenas_breitschwerdt_et al._2009, title={Isolation or Molecular Detection of Bartonella  henselae and Bartonella vinsonii subsp. berkhoffii from Dogs with Idiopathic Cavitary Effusions}, volume={23}, ISSN={0891-6640 1939-1676}, url={http://dx.doi.org/10.1111/j.1939-1676.2008.0246.x}, DOI={10.1111/j.1939-1676.2008.0246.x}, abstractNote={There are a substantial number of pathophysiologic causes for effusions in dogs.1 Previously, using an insect cell culture medium (Bartonella alpha-proteobacteria growth medium—BAPGM), our laboratory isolated Mycobacterium kansasii from a dog with therapeutically intractable pleural effusion.2 Recently, we developed a combined assay incorporating BAPGM pre-enrichment culture, so as to increase Bartonella bacterial numbers, followed by PCR amplification of organism-specific DNA sequences.3 The combined assay has substantially increased the sensitivity of molecular detection of Bartonella infection.3-5 This pre-enrichment culture medium has also isolated numerous other bacterial species of undetermined pathogenicity from human patients in our laboratory.4 In the past decade, several Bartonella species, including B. henselae, B. vinsonii subsp. berkhoffii, B. clarridgeiae, B. elizabethae, B. washoensis, and B. quintana, have been found to infect dogs.6 Currently, case-based evidence suggests that occult infection with these bacteria may contribute to a wide range of disease manifestations in dogs, humans, and potentially other animals.6B. henselae and B. vinsonii subsp. berkhoffii have been reported in association with granulomatous lymphadenitis, hepatic disease,7 and endocarditis in dogs.8 Between July 2004 and December 2007, blood and effusion samples from 20 dogs of varying breeds and ages, were submitted for BAPGM culture by veterinarians at Auburn University, North Carolina State University and Tufts University's Veterinary Teaching Hospitals, of which 5 were found to be infected with a Bartonella spp. Using a previously described approach, DNA was extracted directly from EDTA-anticoagulated blood or thoracic and abdominal effusion samples, from BAPGM pre-enrichment liquid blood and effusion cultures, and from pooled bacterial subculture isolates.3-5, 9 Extracted DNA was screened by PCR with Bartonella genus primers, targeting the 16S-23S intergenic spacer region (ITS), which has a detection limit of 2–3 genomic copies per reaction.9 ITS amplicons were sequenced to confirm the Bartonella species and strain.5, 9 This study provides the first molecular and microbiologic evidence to support infection with B. henselae and B. vinsonii subsp. berkhoffii in dogs with idiopathic cavitary effusions or constrictive pericarditis. An 8-year-old-female spayed Labrador mix was referred to Tufts for evaluation of recurrent pleural effusion. Thoracic fluid cytology was consistent with a transudate with a specific gravity of 1.019, total protein of 2.6 g/dL and 255 cells/μL. No bacterial growth or neoplastic cells were documented. A CBC, serum biochemical profile, coagulation profile, and urinalysis were unremarkable except for mild hyperbilirubinemia and hematuria. A torsed lung lobe was surgically removed. Postoperatively despite administration of azathioprine, prednisone, and spironolactone, thoracocentesis was required for 10 consecutive months. When immunosuppressive therapy was tapered, pleural effusion rapidly recurred. Antibiotics, including doxycycline, azithromycin, or enrofloxacin, did not decrease the rate of fluid accumulation, which had become a modified transudate. The dog underwent an exploratory thoracotomy and died postoperatively. B. henselae strain Houston-I was isolated and sequenced from the thoracic fluid and B. henselae strain Houston-I and B. vinsonii subsp. berkhoffii genotype II were isolated from a BAPGM blood culture. Bartonella serology was not requested. A 3-year-old-female spayed Leonberger was referred to Auburn for evaluation of lethargy, anorexia, weight loss (11 kg), and cervical pain. The only central nervous system abnormality was mild pain on cervical flexion. A possible abdominal mass was noted. There were no hematologic abnormalities. Serum biochemical abnormalities included increased alkaline phosphatase (130 U/L; reference range, 4–95) and alanine amino transferase activities (385 U/L; reference range, 26–200), increased serum creatinine concentration (1.5 mg/dL; reference range, 0.68–1.45), and hypoglobulinemia (2.1 g/dL; reference range, 2.6–5.0). Urinalysis was within normal limits and urine culture failed to grow bacteria. Thoracic radiographs indicated moderate pleural effusion. Ultrasonographic abnormalities included a thickened, stiff stomach wall, abdominal effusion, and irregular kidney margins. An echocardiogram identified no cardiac abnormalities. Pleural fluid analysis was consistent with a modified transudate with a specific gravity of 1.026, total protein of 3.9 g/dL, and 670 total cells/μL. Serum antibodies were not detected to Neospora caninum, Ehrlichia canis, Rickettsia rickettsii, Toxoplasma gondii, canine distemper virus, and Pythium insidiosum. Abdominal exploratory surgery identified a large volume of grossly pink peritoneal fluid. No histologic lesions were found in stomach, liver, omentum, duodenum, mesenteric, and pyloric lymph nodes, kidney, pancreas, and jejunum. B. henselae and B. vinsonii subsp. berkhoffii antibodies were not detected, but B. vinsonii subsp. berkhoffii genotype II was sequenced from the BAPGM pre-enrichment blood culture and the subculture isolate. Azithromycin 250 mg daily and doxycycline 100 mg PO q12 h were administered for 14 days. Nine days after beginning treatment, the dog was eating and drinking normally but pleural effusion failed to resolve. Antibiotics were continued for 2 more weeks. During the next year, the cervical pain continued. The dog was euthanized because of severe peripheral edema with spontaneous fluid extravasation 2 years later. An insulin-dependent diabetic 12-year-old-male castrated Vizsla was evaluated for coughing, gagging, and lethargy. Idiopathic chylothorax initially was diagnosed by the referring veterinarian based on cytological evaluation, which was confirmed by pleural fluid analysis at NCSU-VTH as chylous with a specific gravity of 1.023, total protein of 3.3 g/dL, and 1,940 total cells/μL. A CBC was normal. Biochemical abnormalities included hyperglycemia (serum glucose concentration 258 g/dL; reference range, 73–116), and increased SAP (270 U/L; reference range, 15–156), and ALT activities (100 U/L; reference range, 16–73). Abdominal and thoracic ultrasonography, an echocardiogram, and a helical computed tomography (CT) scan of the thorax and anterior abdomen with lymphangiography were unremarkable, except for pleural effusion. Thoracic duct ligation and partial pericardectomy were performed. The dog recovered uneventfully but continued to accumulate lesser quantities of thoracic fluid, consistently characterized as a modified transudate. Two months postsurgery, the dog developed lethargy, inability to rise, and edema involving the neck, sternum, and right front leg. Urine and pleural fluid cultures failed to grow bacteria. Pleural fluid again was classified as a modified transudate, containing atypical mesothelial cells. A seroma, accompanied by spontaneous leakage of fluid, formed in the ventral neck region. The owner elected euthanasia before availability of the BAPGM culture results. B. henselae DNA was amplified and sequenced directly from the pleural fluid and from the BAPGM enrichment culture. After subculture, an Arthrobacter spp. was isolated, as defined by sequencing the 16S rRNA gene. Serology was not requested. At necropsy, no cause was identified for the severe emaciation, pleural effusion, and subcutaneous edema. A 5-year-old-female spayed Pomeranian was referred to the NCSU-VTH for diagnostic evaluation of panhypoproteinemia. The owners reported infrequent bouts of diarrhea and poorly localized abdominal pain. Serum total protein concentration (2.6 g/dL; reference range, 5.1–7.4), albumin (1.3 g/dL; reference range, 2.8–4.0), and globulin concentrations (1.3 g/dL; reference range, 2.0–4.1) were low. Hematologic abnormalities included lymphopenia (283 lymphocytes/μL; reference range, 480–3,762) and neutrophilia (13,745 neutrophils/μL; reference range, 2,529–12,876). With the exception of bilirubinuria, urinalysis was unremarkable, urine protein/creatinine ratio was normal, and urine culture was negative. Radiographs confirmed thoracic and abdominal effusion. Ultrasonography identified bicavitary anechoic effusion, consistent with a transudate, a collapsed right lung lobe, and portal vein thrombosis. The liver was hypoechoic, abdominal lymph nodes slightly enlarged, and the intestinal lumen was distended with fluid. Echocardiography did not identify pericardial effusion or support a diagnosis of right-sided heart failure. By abdominocentesis, a clear transudative fluid with a specific gravity of 1.005 was obtained. Aerobic and anaerobic culture of the abdominal fluid failed to grow bacteria. Endoscopic gastric biopsies were unremarkable, whereas the duodenum was moderately infiltrated with lymphocytes and plasma cells, accompanied by multifocal lymphangiectasia. A heartworm antigen test was negative. Antibodies to B. henselae and B. vinsonii subsp. berkhoffii, R. rickettsii, E. canis, and Babesia canis were not detected by IFA testing. B. vinsonii subsp. berkhoffii genotype II was isolated from pleural fluid and B. henselae from the blood. Protein-losing enteropathy, accompanied by a portal vein thrombosis, was diagnosed. Treatment consisted of a high protein, low residue diet and metronidazole 10.5 mg/kg PO q8h for 4 weeks. Within 2 weeks, the portal vein thrombosis was no longer visible by ultrasonography. Serum protein concentrations increased progressively and were within reference ranges (total protein, 5.8 g/dL; albumin, 3.6 g/dL; globulin, 2.2 g/dL) by 3 months after initial evaluation. Effusion resolved and did not recur during a 3-year follow-up period. A 6-year-old-female spayed Labrador Retriever was referred for diagnostic evaluation of abdominal effusion. Historically, the dog had remained alert and active. Six liters of serosanguineous, modified transudate with a specific gravity of 1.026, total protein of 4 g/dL and 770 total cells/μL was aspirated from the abdomen. There were no hematologic or coagulation abnormalities, except hypocholesterolemia (134 mg/dL; reference range, 138–317). Central venous pressure was slightly increased (8–9 mmHg). Abdominal and thoracic CT scans identified distention of the hepatic veins and the cranial and caudal vena cava, indicative of right-sided heart failure. By echocardiography, minimal pericardial effusion and hypokinetic left ventricle free wall were documented. Catheterization of the right side of the heart detected a cranial vena cava pressure of 16.1 mmHg, right atrial pressure of 17.4 mmHg, right ventricle pressure at the end of the diastole of 15.6 mmHg and wedge pressure of 17.4 mmHg. The tracing of the right atrial pressure, with prominent x and y descents, was consistent with constrictive pericarditis. Subtotal pericardectomy was performed. On histopathology, the pericardium was variably thickened (up to 0.5 cm) with densely packed collagen fibers, containing few blood vessels and rare hemosiderin-laden macrophages. No etiologic agents were seen, no fungal species were isolated and aerobic and anaerobic blood cultures were negative. On day 8 postpericardectomy, the dog became febrile (T 104°F), vomited, and had diarrhea. A CBC was unremarkable. Two liters of serosanguineous fluid, removed by thoracocentesis, was classified cytologically as an inflammatory sterile effusion containing neutrophils, some phagocytosed by macrophages, and large, atypical mesothelial cells. Anaerobic and aerobic cultures again were negative, potentially because amoxicillin-clavulanate was started by the referring veterinarian 36 hours before sample collection. The treatment regimen was changed to ciprofloxacin, azithromycin, and metoclopramide. Pleural fluid, cultured in BAPGM, resulted in the isolation of Bartonella spp., which was not successfully sequenced. Serum was not available for Bartonella IFA testing. Once culture results became available, treatment with azithromycin (7.8 mg/kg PO q2h) was begun for 5 weeks. At reevaluation 1 month later, the dog was eating normally, active, and alert, and there was no radiographic evidence of thoracic or abdominal effusion. Nine months postpericardectomy, the dog remained healthy with normal exercise tolerance when running and swimming. In this study, we detected infection with B. henselae, B. vinsonii subsp. berkhoffii or both organisms in 5 dogs ranging in age from 3 to 12 years that were diagnosed with pleural, pericardial (constrictive pericarditis), or abdominal effusion. Clinical signs generally were nonspecific and included lethargy, fever, vomiting, diarrhea, abdominal distention, lameness, and cervical pain. DNA was not amplified directly from 3 of 3 blood samples or from 2 of 3 effusion samples, but was amplified from pre-enrichment BAPGM blood and effusion cultures and from subculture isolates, a finding that further supports the utility of the enrichment process before PCR for more optimal detection of infection with a Bartonella spp.3, 5, 9 In humans, thoracic effusions have been reported as infrequent sequelae of Cat Scratch Disease, caused by B. henselae and due to infection with B. quintana.10 Unfortunately, BAPGM cultures often were established after administration of antibiotics. If blood and effusion samples had been cultured earlier in the course of illness and before antibiotic therapy, enhanced detection of Bartonella or other fastidious bacteria may have been achieved in other cases. As extravascular accumulation of fluid is always caused by a pathologic process and as dogs can be chronically infected with B. vinsonii subsp. berkhoffii for at least a year,11 microbiologic and molecular documentation of infection with this genus of bacteria may reflect an opportunistic role, a cofactor in disease expression or a primary pathogenic role in various patients with cavitary effusion. Exudates are the expected inflammatory response induced by bacterial infection, but this paradigm may not apply to Bartonella spp. Recently, the lipopolysaccharide of B. quintana was shown to have anti-inflammatory rather than proinflammatory properties.12 In addition, previous experimental infection studies in dogs suggest that B. vinsonii subsp. berkhoffii is associated with organism-induced immunosuppression.11 These and other unknown factors potentially could contribute to the development of an effusion in the absence of a strong host inflammatory response. Recent experimental studies using rodent models emphasize the ability of Bartonella spp. to invade vascular endothelial cells.13 In immunocompromised people, endothelial infection with B. henselae induces single or multiple vasoproliferative lesions (peliosis hepatis and bacillary angiomatosis).14, 15 Therefore, it is plausible that vascular endothelial infection contributes to increased vascular permeability and aberrant fluid accumulation. Despite isolation or molecular detection of B. henselae and B. vinsonii subsp. berkhoffii in these dogs, no direct cause and effect association can be implicated. However, our results may be clinically relevant because most idiopathic effusions obtained from dogs generally are considered aseptic based on conventional microbiological culture approaches. Two dogs in this study, for which serum was available for testing, were not seroreactive to B. henselae and B. vinsonii subsp. berkhoffii antigens by IFA testing, as described previously.9 Antigenic variability among B. henselae test strains previously has resulted in false negative B. henselae IFA results in human patients with suspected cat scratch disease,16 and a similar occurrence may explain discrepant serology and PCR results. The concept that bacterial infection in transudates or modified transudates obtained from dogs is an infrequent occurrence should be reassessed in the context of Bartonella infection. This research was supported by the State of North Carolina and in part through graduate student stipend support provided to NA Cherry by Novartis Animal Health, and salary support provided by IDEXX Laboratories and Bayer Corporation. We thank Mrs Tonya Lee for editorial assistance.}, number={1}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Cherry, N. A. and Diniz, P. P. V. P. and Maggi, Ricardo and Hummel, J. B. and Hardie, E. M. and Behrend, E. N. and Rozanski, E. and DeFrancesco, T. C. and Cadenas, M. B. and Breitschwerdt, Edward and et al.}, year={2009}, month={Jan}, pages={186–189} }
 @article{bouchouicha_durand_monteil_chomel_berrich_arvand_birtles_breitschwerdt_koehler_maggi_et al._2009, title={Molecular Epidemiology of Feline and Human Bartonella henselae Isolates}, volume={15}, ISSN={1080-6040 1080-6059}, url={http://dx.doi.org/10.3201/eid1505.080995}, DOI={10.3201/eid1505.080995}, abstractNote={Multiple locus variable number tandem repeat analysis was performed on 178 Bartonella henselae isolates from 9 countries; 99 profiles were distributed into 2 groups. Human isolates/strains were placed into the second group. Genotype I and II isolates shared no common profile. All genotype I isolates clustered within group B. The evolutive implications are discussed.}, number={5}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Bouchouicha, Rim and Durand, Benoit and Monteil, Martine and Chomel, B.B. and Berrich, Moez and Arvand, Mardjan and Birtles, Richard J. and Breitschwerdt, Edward B. and Koehler, Jane E. and Maggi, Ricardo and et al.}, year={2009}, month={May}, pages={813–816} }
 @article{cherry_maggi_cannedy_breitschwerdt_2009, title={PCR detection of Bartonella bovis and Bartonella henselae in the blood of beef cattle}, volume={135}, ISSN={0378-1135}, url={http://dx.doi.org/10.1016/j.vetmic.2008.09.063}, DOI={10.1016/j.vetmic.2008.09.063}, abstractNote={Although an organism primarily associated with non-clinical bacteremia in domestic cattle and wild ruminants, Bartonella bovis was recently defined as a cause of bovine endocarditis. The purpose of this study was to develop a B. bovis species-specific PCR assay that could be used to confirm the molecular prevalence of Bartonella spp. infection. Blood samples from 142 cattle were tested by conventional PCR targeting the Bartonella 16S-23S intergenic spacer (ITS) region. Overall, Bartonella DNA was detected in 82.4% (117/142) of the cattle using either Bartonella genus primers or B. bovis species-specific primers. Based upon size, 115 of the 117 Bartonella genus ITS PCR amplicons were consistent with B. bovis infection, which was confirmed by PCR using B. bovis species-specific primers and by sequencing three randomly selected, appropriately sized Bartonella genus PCR amplicons. By DNA sequencing, Bartonella henselae was confirmed as the two remaining amplicons, showing sequence similarity to B. henselae URBHLIE 9 (AF312496) and B. henselae Houston 1 (NC_005956), respectively. Following pre-enrichment blood culture of 12 samples in Bartonella alpha Proteobacteria growth medium (BAPGM) B. henselae infection was found in another three cows. Four of the five cows infected with B. henselae were co-infected with B. bovis. To our knowledge this study describes the first detection of B. henselae in any large ruminant species in the world and supports the need for further investigation of prevalence and pathogenic potential of B. henselae and B. bovis in cattle.}, number={3-4}, journal={Veterinary Microbiology}, publisher={Elsevier BV}, author={Cherry, Natalie A. and Maggi, Ricardo G. and Cannedy, Allen L. and Breitschwerdt, Edward B.}, year={2009}, month={Mar}, pages={308–312} }
 @article{varanat_travis_lee_maggi_bissett_linder_breitschwerdt_2009, title={Recurrent Osteomyelitis in a Cat due to Infection with Bartonella vinsonii subsp. berkhoffii Genotype II}, volume={23}, ISSN={0891-6640 1939-1676}, url={http://dx.doi.org/10.1111/j.1939-1676.2009.0372.x}, DOI={10.1111/j.1939-1676.2009.0372.x}, abstractNote={A 4-year-old spayed-female Domestic Shorthair cat, obtained from a shelter as a kitten, was examined in May 2007 because of an intermittent lameness. Rectal temperature was 102°F. The cat weighed 3.3 kg. There was a focal, nonpainful, 2.5-cm-diameter firm swelling at the medial aspect of the left metatarsal region. Radiographs of the left rear leg identified lysis of the distal aspect of the 1st metatarsal bone and adjacent soft tissue swelling. Thoracic radiographs were unremarkable. Neoplasia was suspected and digital amputation was elected. Preanesthetic blood tests identified thrombocytopenia (25,000/μL; reference range, 200,000–500,000) with an adequate estimated platelet count because of clumping, mild lymphopenia (1,071 lymphocytes/μL; reference range, 1,200–8,000), mild hyperglobulinemia (5.4 g/dL; reference range, 2.3–5.3), and negative FIV and FeLV ELISA test results. The neutrophil count was 4,725/μL (reference range, 2,500–8,500) with no bands or neutrophil toxicity. Urinalysis was unremarkable. At surgery, the left medial metatarsophalangeal joint was disarticulated and the digit was removed. Histopathologic evaluation identified a mixed inflammatory response, characterized by a large number of well-differentiated plasma cells, macrophages with erythrophagocytosis and focal aggregates of neutrophils. Pyogranulomatous osteomyelitis was diagnosed. Plasma cell numbers were sufficiently high that plasma cell neoplasia was considered a plausible differential diagnosis. Fungal, acid-fast, and silver stains did not identify infectious agents. Culture of the amputated tissue was not performed. Two weeks postoperatively, an ulcer formed at the surgical site and was accompanied by moderate muscle atrophy. The distal limb became necrotic from the surgical site to the mid-tibia, which was accompanied by severe atrophy of the left rear leg to the level of the stifle and a loss of distal deep pain, which required mid femoral amputation. At no time had the cat traumatized the original incision. Despite necrosis, there was minimal to no purulent discharge and the cat never appeared overtly uncomfortable, despite rapid deterioration in the limb. In November 2007, the cat was examined because of lethargy. The cat was thrombocytopenic (97,000/μL; reference range, 175,000–600,000) and neutropenic (1,064/μL; reference range, 2,500–8,500). Urinalysis identified proteinuria and neutrophils suggestive of a urinary tract infection and the cat was treated with amoxicillin-clavulanate 62.5 mg PO q12h for 7 days. Urine culture was not performed. In February 2008, diffuse distal swelling and lameness developed in the left front leg. Radiographs identified mild soft tissue swelling and mild degenerative joint disease. The cat was treated with meloxicam 0.45 mg PO q24h for 3 days, then q72h to alleviate pain and swelling. Despite this treatment, the cat remained intermittently lame. Swelling and lameness of the left front leg again were documented by physical examination in May 2008, at which time the swelling had become firmer and more localized over the left carpus. There also was thickening of the right carpal region, which was firmer and less pliable than the left carpal region. Radiographs identified osteolysis of the left radial carpal bone with concurrent periosteal reaction. There was also cortical expansion of the right 5th metacarpal bone. Although serum globulin concentration was within reference range, serum protein electrophoresis documented polyclonal gammopathy associated with increased gamma globulins (2.54 g/dL; reference range, 0.5–1.90). By June 2008, the cat had persistent decreased weight bearing on the left thoracic limb. The left carpus was swollen and painful, and the distal limb had developed a valgus deformity. The right thoracic leg was also painful during carpal palpation and range of motion manipulations, but the owner reported no lameness or pain at home. The lateral phalanges of the right thoracic limb were swollen and firm. The cat was sedated with 0.15 mg dexmeditomidine IM. Radiographs of the left and right thoracic limbs, chest, and right pelvic limb were obtained. Cytology samples were also obtained from the lesions in the left and right thoracic limbs by fine needle aspiration. Radiographs documented an ovoid expansile lesion of the right 5th metacarpal bone, characterized by extensive and irregular osteoproliferation, marked cortical bone destruction, and moderate thickening of the soft tissues lateral to the metacarpal lesion (Fig 1). Severe osteolysis of left radial carpal bone was also present, as well as irregular periosteal proliferation involving all left carpal bones and the proximal aspects of all left metacarpal bones. Moderate left carpal joint effusion was also noted. The radiographic findings of polyostotic osteolysis and irregular osteoproliferation in a patient of this age were consistent with multifocal osteomyelitis of either bacterial or fungal etiology. Given the presence of left carpal joint effusion and involvement of the left carpal bones, septic arthritis of the left carpal joint was considered likely. Soft tissue swelling adjacent to the right 5th metacarpal bone was thought to represent cellulitis. Other aggressive bone lesions (ie, primary or metastatic osseous neoplasia) were considered less likely. Right pelvic limb and thoracic radiographs were within normal limits. (A) Dorsopalmar radiograph of the right pes. Note the aggressive expansile lesion of the right 5th metacarpal bone and adjacent soft tissue swelling (white arrow). (B) Dorsopalmar radiograph of the left pes. Note the severe osteolysis of the radial carpal bone (large white arrow), osteoproliferation of the carpal and metacarpal bones (small white arrow), and carpal joint effusion (white arrowhead). Cytology from the left carpal lesion identified erythrophagocytosis, nontoxic neutrophils, epithelioid, and multinucleated cells thought to be osteoclasts, scattered plasmacytoid osteoblasts, and numerous benign plasma cells. Organisms were not seen, including lack of viral, anaplasma, or ehrlichial inclusions. The cytology results and clinical information supported chronic neutrophilic and plasmacytic osteomyelitis. Based on cellular appearance and the duration of the disease process, plasma cells were reported to be reactive rather than neoplastic, but myeloma could not be excluded from the differential diagnosis. The cat was treated with tramadol hydrochloride 12.5 mg PO q12h while the owner decided whether to pursue additional diagnostic testing. In August 2008 the cat was sedated with a combination of 80 mg ketamine, 0.16 mg dexmedetomidine, and 0.27 mg buprenorphine IM. Radiographs showed moderate progression of the osseous lesions identified in June. Blood was obtained for a CBC and serum biochemical profile. With the exception of mild thrombocytopenia (193,000/μL; reference range, 200,000–500,000) potentially associated with platelet clumping, CBC findings were within reference ranges and the neutrophil count was 5,355/μL (reference range, 2,500–8,500). Serum biochemical abnormalities included hypercalcemia (11.6 mg/dL; reference range, 8.2–10.8) and hyperglobulinemia (6.0 g/dL; reference range, 2.3–5.3). Fungal serology for aspergillosis, blastomycosis, coccidiomycosis, and histoplasmosis was negative and repeat FIV and FeLV test results were negative. A bone marrow aspiration sample, obtained to further assess the possibility of a plasma cell myeloma, was unremarkable. Aerobic culture of the bone marrow aspirate yielded mild growth of Salmonella enterica subsp. enterica, which was considered a potential sample collection contaminant. Mycoplasma and fungal cultures of the bone marrow aspirate were negative. Aerobic, anaerobic, fungal, and Mycoplasma cultures of joint fluid, aspirated from the left carpal-metacarpal joint were negative for growth. An aseptically obtained jugular blood sample, submitted to the Vector Borne Diseases Diagnostic Laboratory, NCSU-CVM, was cultured in BAPGM (Bartonella alpha proteobacteria growth medium).1 Although awaiting test results, the cat was treated with 20 mg PO q12h and azithromycin 20 mg PO q48h for presumptive intracellular bacterial infection. Bartonella spp. PCR following direct extraction from the blood sample was negative. After a 7-day incubation period, Bartonella vinsonii subsp. berkhoffii genotype II DNA was PCR amplified and sequenced from the BAPGM enrichment blood culture.1Bartonella henselae DNA and DNA from a healthy dog served as positive and negative controls, respectively. Subculture onto an agar plate did not result in bacterial growth. By IFA testing, B. vinsonii subsp. berkhoffii and B. henselae antibody titers were 1 : 128 and 1 : 64, respectively. The cat was treated for bartonellosis for 3 months with azithromycin 36 mg (10 mg/kg) PO q48h and concurrently with amoxicillin-clavulanate 62.5 mg PO q12h for 2 months for possible infection with S. enterica. During this time period, the owner reported a progressive increase in weight bearing on the left forelimb and decreased pain when walking, and meloxicam and tramadol were discontinued. In February 2009, repeated BAPGM blood culture failed to detect B. vinsonii subsp. berkhoffii DNA or growth of bacteria. B. vinsonii subsp. berkhoffii and B. henselae antibody titers were negative. The cat continued to be less painful, but both the left and right carpi were grossly larger than in November 2008. Radiographs showed continued progression of the previously described thoracic limb lesions. Radiographs of the right pelvic limb and thorax remained within normal limits. Azithromycin was discontinued once blood culture results became available. Reculture was recommended, but not performed 1 month after cessation of antibiotics. As of June 2009, the cat was healthy, was walking without pain, and had not received additional antibiotics or pain medications. After successful blood culture detection of B. vinsonii subsp. berkhoffii in August 2008, the original formalin-fixed, paraffin-embedded left medial metatarsal osteomyelitis lesion, was sent to the Intracellular Pathogens Research Laboratory to determine if the cat was infected with B. vinsonii subsp. berkhoffii at the time of digital amputation. B. vinsonii subsp. berkhoffii genotype II DNA again was amplified and sequenced from the original lesion. B. vinsonii subsp. berkhoffii genotype I was isolated for the 1st time in 1993 from a dog with shifting leg lameness, epistaxis, recent-onset seizures, and endocarditis.2 Subsequently, 3 additional genotypes (designated II–IV), all of which have been implicated as a cause of endocarditis in dogs, were described based upon sequence differences in the Bartonella 16S-23S intergenic spacer region and the pap31 gene.3,4 In pet dogs, both seroprevalence studies and blood culture isolation results indicate infrequent exposure to or active infection with any of the 4 B. vinsonii subsp. berkhoffii genotypes, whereas exposure is more frequent in rural and working dogs, and in coyotes and feral dog populations.1,3,5,6 On a comparative medical basis, dogs and humans infected with Bartonella spp. can develop similar disease manifestations, including endocarditis, granulomatous lymphadenitis, granulomatous hepatitis, bacillary angiomatosis, peliosis hepatis, seizures, and arthritis.5,6 Although seemingly well-adapted on an evolutionary basis to induce persistent infection in canine reservoir hosts (eg, coyotes), B. vinsonii subsp. berkhoffii has only rarely been isolated from pet dogs, foxes, or humans.2,3 To our knowledge, this case report describes the 1st isolation of B. vinsonii subsp. berkhoffii from a cat and the 1st association of a Bartonella spp. with osteomyelitis in any animal other than a human being. B. henselae and Bartonella clarridgeiae are transmitted among cats by Ctenocephalides felis.5,7 Healthy cats are considered reservoir hosts for these 2 Bartonella spp. and are generally nonclinical carriers of these intravascular bacteria.5,7 In various study populations throughout the world, B. henselae bacteremia has been reported in 8–56% of healthy cats whereas prevalence of B. clarridgeiae bacteremia generally is much lower.7 Although disease associated with B. henselae and B. clarridgeiae is not commonly recognized in cats, other non–reservoir-adapted Bartonella spp., such as B. vinsonii subsp. berkhoffii, for which dogs are the only known reservoir hosts,3–5 may be pathogenic when transmitted to cats. In humans, musculoskeletal manifestations, including osteomyelitis, have been reported as a complication of cat scratch disease (CSD), caused by B. henselae. In a study by Maman et al,8 about 10% of CSD patients developed chronic musculoskeletal complications including myalgia, arthritis, osteomyelitis, and neuralgia. There are also case reports of B. henselae-associated osteomyelitis, most often in children, at times, not accompanied by fever or lymphadenopathy.9,10 Non–host-adapted Bartonella spp. are more likely to be associated with development of pathology, for example B. henselae osteomyelitis in people and B. vinsonii subsp. berkhoffii osteomyelitis in this cat. Because B. vinsonii subsp. berkhoffii genotype II was PCR amplified and sequenced from an enrichment blood culture obtained 15 months after digital amputation and then was retrospectively amplified and sequenced from the paraffin block produced at the time of initial surgery, it is likely that this organism caused persistent bacteremia, recurrent osteomyelitis, and arthritis in this cat. Recently, we described Bartonella spp. DNA carryover when processing necropsy and biopsy tissue samples, which represents a potentially unique problem for the molecular diagnosis of bartonellosis in veterinary medicine.11 In this cat, recurrent disease accompanied by repeated sequencing of an infrequently detected subspecies and defined genotype makes DNA carryover less likely. In addition, special precautions were taken in our laboratory when sampling paraffin blocks to minimize this possibility. Whether infection with B. vinsonii subsp. berkhoffii after digital amputation contributed to postoperative necrosis and what appeared to be ischemic atrophy of the left rear leg could not be determined because tissues from the amputated leg were not submitted for histopathology. Current recommendations for the treatment of Bartonella musculoskeletal infections are based predominantly on empirical data. Although reinfection cannot be ruled out, it seems likely that B. vinsonii subsp. berkhoffii was not immunologically or therapeutically eliminated after digital and rear leg amputations in this cat. BAPGM enrichment cultures of blood and joint fluid recently were used to document failure of azithromycin or marbofloxacin to eliminate B. henselae and B. vinsonii subsp. berkhoffii from a dog that progressed from nonerosive to erosive polyarthritis.12 Resistance to macrolide antibiotics has been reported for B. henselae,13 but additional studies are required to determine if B. vinsonii subsp. berkhoffii can also develop macrolide resistance. In addition to osteomyelitis, clinical and radiographic findings in this cat suggested chronic, progressive polyarthritis, which also was reported in 3 dogs that were seroreactive to B. vinsonii subsp. berkhoffii antigens.14 As reported in this cat, clinical improvement occurred in these dogs in conjunction with antimicrobial therapy and was accompanied by a rapid decrease in B. vinsonii subsp. berkhoffii antibodies.14 In humans with B. henselae osteomyelitis, prognosis is good with patients being treated for a median duration of 32 days with mono, dual, or triple antibiotic therapy.9 Bartonella sp. are highly fastidious organisms that can be difficult or impossible to isolate by conventional blood culture or to detect by PCR amplification after direct extraction of DNA from patient samples.1,15 These diagnostic limitations are especially applicable when attempting to document infection with a Bartonella spp. in a nonreservoir host.16,17 In conjunction with efforts to enhance the sensitivity of PCR for detection of Bartonella-specific DNA sequences, we have recently incorporated pre-enrichment culture of aseptically obtained diagnostic samples (blood, cerebrospinal, aqueous, and joint fluids and effusions) using a liquid insect cell culture-based medium (BAPGM) before PCR testing.8 Combining pre-enrichment culture with PCR amplification has substantially improved diagnostic sensitivity when testing samples from dogs and humans infected with novel Bartonella species.18 Historically, because B. henselae and B. clarridgeiae could be readily isolated from cat blood after an incubation period of a few weeks in a high CO2 incubator, our laboratory did not initially recommend the use of BAPGM when culturing cat blood samples. As illustrated by this cat, direct PCR from blood was negative, suggesting that an enrichment culture approach may be necessary to diagnose infection with non–reservoir-adapted Bartonella spp. in cats, as has been shown for dogs and human patients.1,4,16,17 In addition, PCR amplification of B. vinsonii subsp. berkhoffii DNA only after enrichment culture supports the presence of viable bacteria in the blood sample, because the initial PCR-negative blood sample was diluted 1 part blood to 10 parts BAPGM before incubation for 7 days. Various Bartonella spp. are transmitted among reservoir hosts by fleas, lice, sand flies, keds, and possibly biting flies and ticks.19 Transmission to non–reservoir-adapted hosts can occur via an arthropod bite or a scratch or bite by a carrier animal. The mode of B. vinsonii subsp. berkhoffii transmission to this cat is unknown. B. vinsonii subsp. berkhoffii DNA has been amplified and sequenced from saliva obtained from healthy dogs, and dogs have been implicated in the direct transmission of B. henselae to humans.20 Therefore, dog bite transmission could have been a source of infection for this cat. Although there is clinical and epidemiological evidence to support B. vinsonii subsp. berkhoffii transmission by Rhipicephalus sanguineus, tick transmission has not been proven.19 In recent years, Bartonella spp. have been associated with a wide spectrum of inflammatory lesions in dogs and human patients, including endocarditis, encephalitis, meningitis, granulomatous hepatitis, splenitis, and necrotizing granulomatous lymphadenitis.6,21,22 Classically these facultative, intracellular bacteria induce a B-cell–associated granulomatous reaction, characterized by numerous histiocytes, plasmacytoid monocytes, small lymphocytes, multinucleated giant cells, and plasma cells intermingled with monocytoid B-cells.23 Granulomatous inflammation, accompanied by an unusually large number of plasma cells and hyperglobulinemia, was most likely related to B. vinsonii subsp. berkhoffii infection in this cat. Importantly, 2 pathologists thought plasma cell tumor was a diagnostic consideration. Fever and leukocytosis were not associated with polyarthritis and osteomyelitis in this cat. Thrombocytopenia and neutropenia have been reported in dogs and humans infected with Bartonella spp.24 Although osteomyelitis may have caused hypercalcemia, endogenous production of active vitamin D may have contributed, as reported in twins with CSD.25 Additional studies are needed to determine the frequency of B. vinsonii subsp. berkhoffii infection in cats. Based on this case report, Bartonella spp. infection should be considered in the differential diagnosis of osteomyelitis, hypercalcemia, hyperglobulinemia, and thrombocytopenia in cats. This study was supported by the State of North Carolina and in part through graduate student stipend or salary support provided by Bayer Animal Health and IDEXX Laboratories.}, number={6}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Varanat, M. and Travis, A. and Lee, W. and Maggi, R.G. and Bissett, S.A. and Linder, K.E. and Breitschwerdt, E.B.}, year={2009}, month={Nov}, pages={1273–1277} }
 @article{sontakke_cadenas_maggi_diniz_breitschwerdt_2009, title={Use of broad range16S rDNA PCR in clinical microbiology}, volume={76}, ISSN={0167-7012}, url={http://dx.doi.org/10.1016/j.mimet.2008.11.002}, DOI={10.1016/j.mimet.2008.11.002}, abstractNote={Broad range 16S rDNA PCR can be used to facilitate the diagnosis of infectious diseases of bacterial origin by detecting 16S rDNA sequences in patient samples. Post amplification sequencing facilitates identification of the infecting organism, but may not allow for differentiation at the species or strain level. This review focuses on the historical use and current applications of broad range 16S rDNA PCR in the diagnosis of bacterial infection. Use of an enrichment liquid culture prior to PCR and the use of real time PCR are also considered. A review of the literature indicates that the diagnostic utility of broad range 16S rDNA PCR is enhanced substantially, if the detected organism is a well-documented pathogen. Frequent detection of environmental organisms of undetermined pathogenicity is currently a limitation. This review also examines weighted criteria developed by different researchers and proposes a decision making tree that establishes the relative importance of various criteria for attributing diagnostic relevance when evaluating individual patient samples. Based upon our review of the literature, a more uniform consensus on the accurate interpretation of broad range 16S rDNA PCR results are needed to improve the microbiological utility of this modality for the diagnosis of bacterial infections in animals and in human patients.}, number={3}, journal={Journal of Microbiological Methods}, publisher={Elsevier BV}, author={Sontakke, Sushama and Cadenas, Maria B. and Maggi, Ricardo G. and Diniz, Pedro Paulo V.P. and Breitschwerdt, Edward B.}, year={2009}, month={Mar}, pages={217–225} }
 @article{duncan_marr_birkenheuer_maggi_williams_correa_breitschwerdt_2008, title={Bartonella DNA in the Blood and Lymph Nodes of Golden Retrievers with Lymphoma and in Healthy Controls}, volume={22}, ISSN={0891-6640 1939-1676}, url={http://dx.doi.org/10.1111/j.1939-1676.2007.0018.x}, DOI={10.1111/j.1939-1676.2007.0018.x}, abstractNote={Background:Although lymphoma is the most common neoplastic process reported in dogs, its precise etiology is unknown. Golden Retrievers are more likely to develop lymphoma, suggesting a breed predisposition; however, other factors, including environment, immunity, and infection, are likely contributors to oncogenesis.}, number={1}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Duncan, A.W. and Marr, H.S. and Birkenheuer, A.J. and Maggi, R.G. and Williams, L.E. and Correa, M.T. and Breitschwerdt, E.B.}, year={2008}, month={Jan}, pages={89–95} }
 @article{maggi_raverty_lester_huff_haulena_ford_nielsen_robinson_breitschwerdt_2008, title={Bartonella Henselae in Captive and Hunter-Harvested Beluga (Delphinapterus Leucas)}, volume={44}, ISSN={0090-3558}, url={http://dx.doi.org/10.7589/0090-3558-44.4.871}, DOI={10.7589/0090-3558-44.4.871}, abstractNote={Previously, we reported the isolation of Bartonella henselae from the blood of harbor porpoises (Phocoena phocoena) and loggerhead sea turtles (Caretta caretta) from the North Carolina coast. Hematologic, pathologic, and microbiologic findings surrounding the death of a juvenile captive beluga in Vancouver initiated an outbreak investigation designed to define the molecular prevalence of Bartonella infection in belugas. Using polymerase chain reaction analyses targeting the intergenic spacer region (ITS), two B. henselae ITS strains were identified in 78% of captive and free-ranging hunter-harvested belugas. These findings may have public health implications and may influence aquarium management procedures for captive marine mammals.}, number={4}, journal={Journal of Wildlife Diseases}, publisher={Wildlife Disease Association}, author={Maggi, Ricardo G. and Raverty, Stephen A. and Lester, Sally J. and Huff, David G. and Haulena, Martin and Ford, Susan L. and Nielsen, Ole and Robinson, John H. and Breitschwerdt, Edward B.}, year={2008}, month={Oct}, pages={871–877} }
 @article{breitschwerdt_maggi_nicholson_cherry_woods_2008, title={Bartonella sp. Bacteremia in Patients with Neurological and Neurocognitive Dysfunction}, volume={46}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.00832-08}, DOI={10.1128/JCM.00832-08}, abstractNote={ABSTRACT}, number={9}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Breitschwerdt, E. B. and Maggi, R. G. and Nicholson, W. L. and Cherry, N. A. and Woods, C. W.}, year={2008}, month={Jul}, pages={2856–2861} }
 @article{harms_maggi_breitschwerdt_clemons-chevis_solangi_rotstein_fair_hansen_hohn_lovewell_et al._2008, title={Bartonella species detection in captive, stranded and free-ranging cetaceans}, volume={39}, ISSN={0928-4249 1297-9716}, url={http://dx.doi.org/10.1051/vetres:2008036}, DOI={10.1051/vetres:2008036}, abstractNote={We present prevalence of Bartonella spp. for multiple cohorts of wild and captive cetaceans. One hundred and six cetaceans including 86 bottlenose dolphins (71 free-ranging, 14 captive in a facility with a dolphin experiencing debility of unknown origin, 1 stranded), 11 striped dolphins, 4 harbor porpoises, 3 Risso's dolphins, 1 dwarf sperm whale and 1 pygmy sperm whale (all stranded) were sampled. Whole blood (n = 95 live animals) and tissues (n = 15 freshly dead animals) were screened by PCR (n = 106 animals), PCR of enrichment cultures (n = 50 animals), and subcultures (n = 50 animals). Bartonella spp. were detected from 17 cetaceans, including 12 by direct extraction PCR of blood or tissues, 6 by PCR of enrichment cultures, and 4 by subculture isolation. Bartonella spp. were more commonly detected from the captive (6/14, 43%) than from free-ranging (2/71, 2.8%) bottlenose dolphins, and were commonly detected from the stranded animals (9/21, 43%; 3/11 striped dolphins, 3/4 harbor porpoises, 2/3 Risso's dolphins, 1/1 pygmy sperm whale, 0/1 dwarf sperm whale, 0/1 bottlenose dolphin). Sequencing identified a Bartonella spp. most similar to B. henselae San Antonio 2 in eight cases (4 bottlenose dolphins, 2 striped dolphins, 2 harbor porpoises), B. henselae Houston 1 in three cases (2 Risso's dolphins, 1 harbor porpoise), and untyped in six cases (4 bottlenose dolphins, 1 striped dolphin, 1 pygmy sperm whale). Although disease causation has not been established, Bartonella species were detected more commonly from cetaceans that were overtly debilitated or were cohabiting in captivity with a debilitated animal than from free-ranging animals. The detection of Bartonella spp. from cetaceans may be of pathophysiological concern.}, number={6}, journal={Veterinary Research}, publisher={EDP Sciences}, author={Harms, Craig A. and Maggi, Ricardo G. and Breitschwerdt, Edward B. and Clemons-Chevis, Connie L. and Solangi, Mobashir and Rotstein, David S. and Fair, Patricia A. and Hansen, Larry J. and Hohn, Aleta A. and Lovewell, Gretchen N. and et al.}, year={2008}, month={Aug}, pages={59} }
 @article{cross_rossmeisl_maggi_breitschwerdt_duncan_2008, title={Bartonella-Associated Meningoradiculoneuritis and Dermatitis or Panniculitis in 3 Dogs}, volume={22}, ISSN={0891-6640 1939-1676}, url={http://dx.doi.org/10.1111/j.1939-1676.2008.0087.x}, DOI={10.1111/j.1939-1676.2008.0087.x}, abstractNote={An 11-year-old castrated male mixed breed (dog 1) was evaluated for an 11-day history of progressive paraparesis. The dog traveled extensively throughout the United States and was frequently exposed to ticks. Physical examination abnormalities included a 1-cm subdermal nodule on the caudolateral aspect of the thorax. Neurologic deficits were consistent with a T3–L3 myelopathy, including ambulatory pelvic limb ataxia and paraparesis with intact pelvic limb reflexes, and spinal hyperpathia in the midlumbar area. A CBC, serum biochemical profile, and urinalysis were within reference ranges. Cytologic examination of the subdermal mass revealed pyogranulomatous inflammation. Thoracic radiographs revealed a mild bronchiolar pattern. The dog was anesthetized for radiography and computed tomography (CT) of the thoracolumbar spine. No significant abnormalities were noted on radiographs. The CT revealed an extradural soft-tissue mass (Fig 1A) that was hyperattenuating relative to the spinal cord, and enhanced uniformly following contrast administration (iothalamate sodium [0.45 mL/kg], IV). The mass extended irregularly from the caudal L3 to the cranial L5 vertebral bodies, resulting in significant spinal cord compression in the L4 midbody region and focal bone resorption of the L4 vertebral body (Fig 1B). Differential diagnoses for the CT abnormalities included soft-tissue sarcoma (nerve sheath neoplasia, fibrosarcoma), extradural meningioma, lymphoma, or inflammatory granuloma. (A) Transverse, postcontrast computed tomography (CT) image from dog 1 at the level of the L4 vertebral body. Note the uniformly contrast enhancing mass (arrow) within the vertebral canal resulting in spinal cord compression. Window = 300, level = 40. (B) Transverse, postcontrast CT image from dog 1, obtained at the same level (A). The arrows delineate a focal area of vertebral bone resorption associated with the mass (m) lesion. Window = 1500, level = 300. A right hemilaminectomy defect extending from L3 to L5 was created, which revealed a tan, friable extradural mass extending from L3 to L5. After removal of the extradural mass in a piecemeal fashion, multifocal intradural masses were visualized between L4 and L5, which prompted performance of a regional durectomy and subsequent removal of the intradural masses using blunt dissection. Rhizotomy of the L4 dorsal and ventral roots was performed because of gross thickening of visualized intra- and extradural portions of the nerve roots and nerve. The extradural mass, intradural masses, dura, nerve, and nerve roots were submitted for histopathologic examination. The hemilaminectomy defect was covered with gelfoam and the surgical wound was closed routinely. Histopathologic examination of extra- and intradural portions of the masses revealed abundant fibrous tissue with multiple infiltrative foci consisting of primarily neutrophils with fewer macrophages and giant cells admixed with fibrin and necrotic debris (Fig 2A). There were lymphocytes and plasma cells in the periphery of the lesion. The L4 spinal nerve and nerve roots were infiltrated with islands of lymphocytes, plasma cells, and few neutrophils (Fig 2B). No infectious organisms were detected in excised tissue sections subjected to Gram, Warthin-Starry silver, acid-fast, or periodic acid Schiff (PAS) stains. The final histopathologic diagnosis was pyogranulomatous, lymphoplasmocytic meningoradiculoneuritis. (A) Photomicrograph of intradural portions of the mass lesion from dog 1 demonstrating a pyogranulomatous and lymphoplasmocytic meningitis. Hematoxylin and eosin stain. (B) Photomicrograph of L4 spinal nerve of dog 1. Islands of lymphoplasmocytic infiltrates are visible within the section. Hematoxylin and eosin stain. Serologic assays for blastomycosis, coccidiomycosis, neosporosis, and toxoplasmosis antibodies were negative, as was a cryptococcal capsular antigen test. By indirect fluorescent antibody (IFA) testing, the dog was seroreactive to Bartonella vinsonii subsp. berkhoffi antigens (titer 1 : 64).b Postoperative care included morphine (0.25 mg/kg SC q6h), deracoxib (2.7 mg/kg PO q24h), and lactated Ringers solution (2.75 mL/kg/h IV). Paraparesis improved the day after surgery, and the dog was discharged 5 days later. The owner was instructed to administer azithromycin (13.9 mg/kg PO q24h for 5 days followed by q48h for 23 days). The neurologic examination was normal on recheck day 8 after surgery. B. vinsonii subsp. berkhoffi DNA was detected in an EDTA-anticoagulated blood sample collected at that time using real-time polymerase chain reaction (PCR).b Real-time PCR for Bartonella species performed on formalin-fixed, paraffin-embedded tissues were negative.b,c The histologic findings, serology, and PCR results were interpreted as consistent with active B. vinsonii subsp. berkhoffi infection. Four months later, no clinical abnormalities were present on reexamination. A repeated B. vinsonii subsp. berkhoffi antibody titer was <1 : 16, and PCR on EDTA-anticoagulated blood was negative.b A CT examination of the surgical site was performed under anesthesia and revealed a scant amount of contrast enhancing soft tissue material in the dorsal aspect of the L4 vertebral body in the region of previously noted bone resorption, with no evidence of spinal cord compression (Fig 3). Therapy with azithromycin was repeated (7 mg/kg PO q12h for 6 weeks), based on the CT results. The dog remains clinically normal to date (29 months after surgery). Transverse, postcontrast computed tomography (CT) image from dog 1 at the level of the L4 vertebral body obtained at the 4-month recheck examination, demonstrating relief of spinal cord compression previously associated with the mass lesion. Contrast enhancement of the gelfoam used to cover the hemilaminectomy defect can be seen. Window = 300, level = 40. An 8-year-old, spayed female Shetland sheepdog (dog 2) was referred with a 5-week history of progressive paraparesis despite prednisone therapy (1.3 mg/kg/day PO). The dog had been observed to have multiple infestations with fleas and ticks. Results of a CBC, serum biochemical profile, urinalysis, and thoracolumbar radiographs performed before referral revealed no significant abnormalities. Physical examination abnormalities included multiple, variably sized (0.3–1 cm in diameter) subcutaneous nodules located in the thoracic, flank, and inguinal areas, and palpable hepatomegaly. Neurologic abnormalities were consistent with a T3–L3 myelopathy and included ambulatory pelvic limb ataxia and paraparesis, exaggerated pelvic limb spinal reflexes, a normal cutaneous trunci reflex, and spinal hyperpathia at the L2 level. Fine needle aspirates of nodules from the flank and inguinal areas were cytologically consistent with pyogranulomatous inflammation. Additional cytologic specimens stained with Gram and acid-fast stains did not result in the visualization of organisms. Abdominal ultrasonography revealed a diffusely hyperechoic hepatic parenchyma. No significant abnormalities were noted on thoracic radiographs. The dog was anesthetized for thoracolumbar magnetic resonance imaging, which revealed an intradural-extramedullary mass lesion extending from the L3 vertebra cranially to exit the left L2–L3 intervertebral foramen that was contiguous with a focal nodular thickening of the left L3 spinal nerve. Relative to skeletal muscle, the mass was isointense on T1 images and hyperintense on T2 images, and demonstrated marked homogenous enhancement on postcontrast (gadolinium-DTPA [0.1 mmol/kg], IV) T1 images. Intradural portions of the mass were associated with spinal cord compression in the L2–L3 region. Lumbar cerebrospinal fluid (CSF) was consistent with a mild mixed cellular pleocytosis, characterized by nondegenerate neutrophils and lymphocytes. Nerve sheath neoplasia and meningioma were considered the primary differential diagnoses. The dog was aseptically prepared for an L2–L3 hemilaminectomy and excisional biopsy of one of the lateral thoracic subcutaneous nodules. After creation of a hemilaminectomy defect at L2–L3, a reddish-gray subdural mass centered over the body of L3 was visualized. The mass coursed to the caudal limits of hemilaminectomy, so the defect was extended to involve L3–L4. A durectomy extending from L2 to L4 was performed, which revealed a reddish, friable, intradural-extramedullary mass, which was subsequently removed in a piecemeal fashion. Both intradural and extradural portions of the L3 dorsal and ventral nerve roots and nerve appeared thickened and nodular, and an L3 rhizotomy was performed. The excised mass was submitted for histopathologic analysis and aerobic and fungal cultures. The hemilaminectomy defect was covered with autologous fat, and the surgical site was closed routinely. Biopsies of the intradural mass, excised spinal nerve and nerve roots, and subcutaneous nodule were consistent with pyogranulomatous and lymphoplasmocytic meningitis, radiculoneuritis, and panniculitis, respectively. No etiologic agents were detected following Gram, acid-fast, and PAS staining procedures. Postoperatively, morphine (0.4 mg/kg SC q4–6h) and lactated Ringer's solution (3 mL/kg/h IV) were administered for 36 hours. Serology was negative for blastomycosis and neosporosis. CSF assays for Toxoplasma gondii antibodies and crytococcal capsular antigen were negative. The dog was seropositive to B. vinsonii subsp. berkhoffi (titer 1 : 256).b Real-time PCR for Bartonella species DNA, performed on EDTA-anticoagulated plasma and freshly excised portions of the intradural mass, were both positive for B. vinsonii subsp. berkhoffi DNA.c Aerobic and fungal cultures of the excised mass, CSF, and the skin nodule did not yield bacterial or fungal growth. The dog was discharged to the owners 72 hours after surgery with instructions to administer azithromycin (11.7 mg/kg PO q24h for 6 weeks), and taper the prednisone (0.6 mg/kg PO q24h). Thirteen days after surgery, the subcutaneous nodules had largely resolved, with only 2 small nodules being noted in the inguinal region. The dog was ambulating with mild pelvic limb ataxia, and the owners were instructed to continue the azithromycin for 3 more weeks, and reduce the prednisone therapy to 0.6 mg/kg PO q48h for 1 week. Six months later, the dog was normal on recheck examination. The serum B. vinsonii antibody titer was < 1:16, and Bartonella PCR using EDTA-anticoagulated blood was negative.b Another recheck performed 17 months postoperatively identified no physical abnormalities. A 9-year-old, castrated male Miniature Schnauzer was evaluated for an 18-day history of progressive paraparesis. The dog lived primarily indoors and did not travel extensively. Physical examination abnormalities included multiple cutaneous nodules over the right quadriceps and right popliteal lymphadenopathy. Neurologic deficits were consistent with a T3–L3 myelopathy (paraplegia, clonic pelvic limb reflexes, intact nociception, and cutaneous trunci reflex absent caudal to L1). A CBC, biochemical profile, urinalysis, and fine needle aspirates of the right popliteal lymph node and cutaneous nodules were performed. The CBC and urinalysis were unremarkable. Serum biochemical abnormalities included increased alanine aminotransferase (166 U/L; reference range, 17–66 U/L) and ALP activities (234 U/L; reference range, 14–105 U/L), and hyperglobulinemia (4.4 g/dL; reference range, 2.2–4.0 g/dL). The lymph node and cutaneous nodule aspirates were consistent with reactive hyperplasia and pyogranulomatous inflammation, respectively. The dog was anesthetized for a thoracolumbar CT, which revealed a ventral extradural, homogenously contrast enhancing mass lesion causing spinal cord compression in the L1–L2 region. Lumbar CSF analysis was consistent with a lymphocytic pleocytosis. Following a left L1–L2 hemilaminectomy, a tan, friable, extradural mass was visualized and removed. Portions of the mass were adherent to the dura, which was locally excised, and the surgical site was closed routinely. Postoperative treatment consisted of morphine (0.4 mg/kg SC q4–6h) and urinary bladder expression q8h. The excised mass was histologically consistent with pyogranulomatous meningitis, with no etiologic agents visualized. An EDTA-anticoagulated blood sample was positive for B. vinsonii subsp. berkhoffi DNA using real-time PCR.c Five days postoperatively, the dog was discharged with weak voluntary motor activity. The owners were instructed to begin treatment with clindamycin (13 mg/kg PO q12h) and enrofloxacin (5.9 mg/kg PO q12h). On recheck 10 days later, the subcutaneous nodules had diminished in size, and the dog was able to ambulate with sling assistance and urinate voluntarily. The clindamycin and enrofloxacin were continued for 6 weeks. Eight weeks later, the referring veterinarian reported that the cutaneous nodules and lymphadenopathy had resolved, and the dog was ambulatory with mild ataxia. To the authors' knowledge, these are the first dogs with B. vinsonii subsp. berkhoffi associated with inflammation involving the spinal meninges, nerve roots, and nerves. Although direct causation has not been established, Bartonella spp. have been associated with various canine nervous system disorders, including myelopathy,1 neutrophilic or granulomatous meningoencephalitis,2 anterior uveitis and choroiditis,3 and meningitis.4Bartonella may affect any topographical portion of the nervous system, resulting in meningoencephalitis, transverse myelitis, vertebral osteomyelitis associated with extradural abscessation, and focal pyogranulomatous meningoradiculoneuritis.1,2,4–6 Proposed mechanisms for Bartonella-associated neurologic disease include direct bacterial invasion and indirect toxin-, immune-, or vasculitis-mediated injury.7 In in vitro studies using feline microglial cells, B. henselae was able to invade microglia, but not astrocytes, and intracellular infection did not induce ultrastructural microglial changes.8 The cellular localization of Bartonella spp. within specific nervous tissues has not been studied, and the extent to which organisms can persist within cells of the CNS is unknown. Experimental infection of cats with B. henselae and B. clarridgeiae suggests that CNS tissues can harbor Bartonella during periods of abacteremia.9 All dogs in this series had concurrent pyogranulomatous dermatitis or panniculitis. Bartonella spp. have been associated with granulomatous inflammation in extraneural canine tissues, including lymphadenitis, rhinitis, panniculitis, and polysystemic granulomatous disease.4,10–12Bartonella species DNA was found in the blood of a dog with α1-proteinase inhibitor deficiency, panniculitis, polyarthritis, and meningitis.4 The role of Bartonella as a cause or cofactor in the development of panniculitis in dogs requires additional investigation. Diagnosing bartonellosis can be difficult. Unless immunocompromised, the Warthrin–Starry silver stain is insensitive for the diagnosis of Bartonella infection in humans.13 Isolation of Bartonella species by conventional blood culture also has a low sensitivity in dogs and humans.14,15 In a study of canine endocarditis, 5/18 dogs demonstrated seroreactivity to Bartonella spp. antigens and had postmortem evidence of Bartonella spp. DNA in diseased aortic valves, although only 1/5 dogs was positive by conventional blood culture.15 Because of the chronic, insidious nature of bartonellosis, prior antibiotic treatment complicates the diagnosis of Bartonella infection by making culture and PCR less sensitive.16,17 Although serology can be useful to establish prior exposure to or active infection with Bartonella species, nearly half of infected dogs can be seronegative by IFA testing.4,14,16 Combinations of pre-enrichment liquid culture in an insect cell culture–based growth medium with PCR detection of Bartonella spp. resulted in enhanced detection or isolation of several Bartonella spp. as compared with conventional culture techniques.14 The ideal antibiotic for the treatment of Bartonella infections in dogs is unknown. Bartonella isolates have demonstrated in vitro susceptibility to β-lactams, aminoglycosides, macrolides, doxycycline, and rifampin.18 Tetracyclines, fluoroquinolones, β-lactams, and combinations of these drugs have been used to treat dogs and cats with Bartonella spp. infections.2,11,17 However, in vivo treatment becomes more difficult as Bartonella species have been found within erythrocytes, macrophages, endothelial cells, microglial cells, pericytes, and neutrophils in cell cultures and tissues obtained from multiple animal species.8 Using antibiotics that accumulate within leukocytes, such as azithromycin and fluoroquinolones, may prove beneficial because these cells can migrate to infectious foci such as granulomatous lesions.19 Evidence suggests that specific strains of B. henselae can be resistant to macrolides.20 One study indicated that enrofloxacin was more efficient at eliminating Bartonella-associated bacteremia than doxycycline, but neither drug eliminated bacteremia in all experimentally infected cats.17 It has been speculated that the variation in antimicrobial therapeutic outcome may not be solely related to the efficacy of each antibiotic, but to the immune-mediated changes caused by Bartonella species.21 The outcomes of the dogs in this series provide support for fluoroquinolone or azithromycin usage for Bartonella infections. In this report, additional decompressive surgery also allowed for rapid improvement in neurologic deficits. Surgical decompression, in combination with appropriate antimicrobial therapy, is indicated in humans and dogs with specific focal infectious spinal cord diseases.5,22 Although not evaluated in this study, medical management alone might result in progressive neurological deterioration or residual dysfunction. Bartonella spp. infections should be considered as a differential diagnosis in dogs with thoracolumbar myelopathy, especially if accompanied by a nodular dermatosis. Serology, pre-enrichment blood culture, and PCR from tissues should be used to support the diagnosis. Treatment through surgical decompression with azithromycin or doxycycline-enrofloxacin combinations may be appropriate for Bartonella-associated pyogranulomatous inflammation in dogs. Prospective studies are needed to determine the incidence of focal neurologic lesions in animals and humans that are positive for Bartonella spp. based on serology, culture, or PCR. aCross JR, Rossmeisl JH. Bartonella-associated pyogranulomatous meningoradiculoneuritis and nodular dermatitis in 3 dogs. J Vet Int Med 2007;21(3):591 (abstract #68) bIntracellular Pathogens Research Laboratory, Center for Comparative Medicine and Translational Research, College of Veterinary Medicine, North Carolina State University, Raleigh, NC cVeterinary Diagnostic Laboratory, Colorado State University, College of Veterinary Medicine and Biomedical Sciences, Fort Collins, CO}, number={3}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Cross, J.R. and Rossmeisl, J.H. and Maggi, R.G. and Breitschwerdt, E.B. and Duncan, R.B.}, year={2008}, month={May}, pages={674–678} }
 @article{jones_maggi_shuler_alward_breitschwerdt_2008, title={Detection ofBartonella henselaein the Blood of 2 Adult Horses}, volume={22}, ISSN={0891-6640 1939-1676}, url={http://dx.doi.org/10.1111/j.1939-1676.2008.0043.x}, DOI={10.1111/j.1939-1676.2008.0043.x}, abstractNote={Background:   Bartonella spp. are emerging zoonotic agents that have been found in a wide variety of domestic animals and wildlife and cause a number of clinical syndromes. Bartonella sp. infection has been identified in a growing number of animal species, including cats, rodents, porpoises, and canids, but has not been reported in horses.}, number={2}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Jones, S.L. and Maggi, R. and Shuler, J. and Alward, A. and Breitschwerdt, E.B.}, year={2008}, month={Mar}, pages={495–498} }
 @article{kidd_maggi_diniz_hegarty_tucker_breitschwerdt_2008, title={Evaluation of conventional and real-time PCR assays for detection and differentiation of Spotted Fever Group Rickettsia in dog blood}, volume={129}, ISSN={0378-1135}, url={http://dx.doi.org/10.1016/j.vetmic.2007.11.035}, DOI={10.1016/j.vetmic.2007.11.035}, abstractNote={Spotted Fever Group Rickettsia is important cause of emerging and re-emerging infectious disease in people and dogs. Importantly, dogs can serve as sentinels for disease in people. Sensitive and specific diagnostic tests that differentiate among species of infecting Rickettsia are needed. The objective of this study was to develop a sensitive and specific PCR that differentiates SFG Rickettsia infecting dog blood. Conventional and real-time PCR assays were developed using primers that targeted a small region of the ompA gene. Their sensitivity, determined by testing a cloned target sequence in the presence of host DNA, was 15–30 and 5 copies of DNA, respectively. Testing of Rickettsia cultures and analysis of Rickettsia gene sequences deposited in GenBank verified DNA could be amplified and used to differentiate species. DNA from the blood of infected dogs was also tested. Importantly, Rickettsia DNA was detected before seroconversion in some dogs. The species of infecting Rickettsia was also identified. We conclude these assays may assist in the timely diagnosis of infection with SFG Rickettsia. They may also facilitate the discovery of novel SFG Rickettsia infecting dogs, and in the investigation of dogs as sentinels for emerging rickettsioses.}, number={3-4}, journal={Veterinary Microbiology}, publisher={Elsevier BV}, author={Kidd, L. and Maggi, R. and Diniz, P.P.V.P. and Hegarty, B. and Tucker, M. and Breitschwerdt, E.}, year={2008}, month={Jun}, pages={294–303} }
 @article{cadenas_bradley_maggi_takara_hegarty_breitschwerdt_2008, title={Molecular Characterization of Bartonella vinsonii subsp. berkhoffii Genotype III}, volume={46}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.02456-07}, DOI={10.1128/JCM.02456-07}, abstractNote={ABSTRACT}, number={5}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Cadenas, M. B. and Bradley, J. and Maggi, R. G. and Takara, M. and Hegarty, B. C. and Breitschwerdt, E. B.}, year={2008}, month={Mar}, pages={1858–1860} }
 @article{cadenas_bradley_maggi_takara_hegarty_breitschwerdt_2008, title={Molecular characterization of Bartonella vinsonii subsp berkhoffii genotype III}, volume={46}, DOI={10.1128/JCM.62456-07}, number={5}, journal={Journal of Clinical Microbiology}, author={Cadenas, M. B. and Bradley, J. and Maggi, Ricardo and Takara, M. and Hegarty, B. C. and Breitschwerdt, Edward}, year={2008}, pages={1858–1860} }
 @article{wagner_riess_linke_eberhardt_schäfer_reutter_maggi_kempf_2008, title={Use of Bartonella adhesin A (BadA) immunoblotting in the serodiagnosis of Bartonella henselae infections}, volume={298}, ISSN={1438-4221}, url={http://dx.doi.org/10.1016/j.ijmm.2008.01.013}, DOI={10.1016/j.ijmm.2008.01.013}, abstractNote={Bartonella henselae causes a variety of human diseases (e.g. cat scratch disease and the vasculoproliferative disorders, bacillary angiomatosis and peliosis hepatis). The laboratory diagnosis of B. henselae infections is usually based on the detection of anti-B. henselae antibodies by an indirect immunofluorescence assay (IFA) which, unfortunately, suffers from a significant amount of cross-reactivity and hence is prone to deliver false-positive results. In this pilot study, we evaluated the use of a potential two-step serodiagnosis of B. henselae infections by combining IFA and anti-Bartonella adhesin A (BadA) immunoblotting. Our data revealed that approximately 75% of the IFA-positive sera of patients with a suspected B. henselae infection reacted specifically with BadA but only approximately 25% of the IFA-negative sera of healthy blood donors. Although Yersinia adhesin A (YadA) is structurally closely related to BadA, no cross-reactivity of sera from patients suffering from a Yersinia enterocolitica or Y. pseudotuberculosis infection with BadA was detected in immunoblotting. Unfortunately, recombinantly expressed BadA domains (head, connector, stalk fragment) were not suitable for immunoblotting. Finally, the best resolution for full-length BadA immunoblotting was obtained when whole cell lysates of B. henselae were separated using continuous 4–15% sodium dodecyl sulfate polyacrylamide gels. In summary, our results show that BadA antibodies are detectable in the sera of B. henselae-infected patients and, therefore, this pilot study suggests to include BadA immunoblotting in the laboratory diagnosis of B. henselae infections.}, number={7-8}, journal={International Journal of Medical Microbiology}, publisher={Elsevier BV}, author={Wagner, Carola L. and Riess, Tanja and Linke, Dirk and Eberhardt, Christian and Schäfer, Andrea and Reutter, Sabine and Maggi, Ricardo G. and Kempf, Volkhard A.J.}, year={2008}, month={Oct}, pages={579–590} }
 @article{duncan_maggi_breitschwerdt_2007, title={A combined approach for the enhanced detection and isolation of Bartonella species in dog blood samples: Pre-enrichment liquid culture followed by PCR and subculture onto agar plates}, volume={69}, ISSN={0167-7012}, url={http://dx.doi.org/10.1016/j.mimet.2007.01.010}, DOI={10.1016/j.mimet.2007.01.010}, abstractNote={Historically, direct plating, lysis centrifugation, or freeze–thaw approaches have proven to be highly insensitive methods for confirming Bartonella species infection in dogs. A prospective study was designed to compare diagnostic methods for the detection of Bartonella using samples submitted to the Vector-Borne Disease Diagnostic Laboratory at North Carolina State University. Methods included indirect immunofluorescence assay, PCR, direct inoculation of a blood agar plate (trypticase soy agar with 5% rabbit blood), and inoculation into a novel pre-enrichment liquid medium, Bartonella/alpha-Proteobacteria growth medium (BAPGM). Sequential research efforts resulted in the development of a combinational approach consisting of pre-enrichment culture of Bartonella species in BAPGM, sub-inoculation of the liquid culture onto agar plates, followed by DNA amplification using PCR. The multi-faceted approach resulted in substantial improvement in the microbiological detection and isolation of Bartonella when compared to direct inoculation of a blood agar plate. Importantly, this approach facilitated the detection and subsequent isolation of both single and co-infections with two Bartonella species in the blood of naturally infected dogs. The use of a combinational approach of pre-enrichment culture and PCR may assist in the diagnostic confirmation of bartonellosis in dogs and other animals.}, number={2}, journal={Journal of Microbiological Methods}, publisher={Elsevier BV}, author={Duncan, Ashlee W. and Maggi, Ricardo G. and Breitschwerdt, Edward B.}, year={2007}, month={May}, pages={273–281} }
 @article{valentine_harms_cadenas_birkenheuer_marr_braun-mcneill_maggi_breitschwerdt_2007, title={Bartonella DNA in Loggerhead Sea Turtles}, volume={13}, ISSN={1080-6040 1080-6059}, url={http://dx.doi.org/10.3201/eid1306.061551}, DOI={10.3201/eid1306.061551}, abstractNote={To the Editor: Bartonella are fastidious, aerobic, gram-negative, facultative, intracellular bacteria that infect erythrocytes, erythroblasts, endothelial cells, monocytes, and dendritic cells, and are transmitted by arthropod vectors or by animal scratches or bites (1–6). Currently, 20 species or subspecies of Bartonella have been characterized, of which 8 are known zoonotic pathogens (7). B. henselae has been recently identified from canine blood (8) and from harbor porpoises (9). Pathogenic bacteria are an important threat in terrestrial and marine environments, and in the case of B. henselae, reservoir hosts may be more diverse than currently recognized.}, number={6}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Valentine, K. Hope and Harms, Craig A. and Cadenas, Maria B. and Birkenheuer, Adam J. and Marr, Henry S. and Braun-McNeill, Joanne and Maggi, Ricardo G. and Breitschwerdt, Edward B.}, year={2007}, month={Jun}, pages={949–950} }
 @article{cockwill_taylor_phillbert_breitschwerdt_maggi_2007, title={Bartonella vinsonii subsp berkhoffii endocarditis in a dog from Saskatchewan}, volume={48}, number={8}, journal={Canadian Veterinary Journal}, author={Cockwill, K. R. and Taylor, S. M. and Phillbert, H. M. and Breitschwerdt, E. B. and Maggi, R. G.}, year={2007}, pages={839–844} }
 @article{duncan_maggi_breitschwerdt_2007, title={BartonellaDNA in Dog Saliva}, volume={13}, ISSN={1080-6040 1080-6059}, url={http://dx.doi.org/10.3201/eid1312.070653}, DOI={10.3201/eid1312.070653}, abstractNote={Bartonella species, transmitted by arthropods or animal bites and scratches, are emerging pathogens in human and veterinary medicine. PCR and DNA sequencing were used to test oral swabs collected from dogs. Results indicated the presence of 4 Bartonella species: B. bovis, B. henselae, B. quintana, and B. vinsonii subspecies berkhoffii.}, number={12}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Duncan, Ashlee W. and Maggi, Ricardo G. and Breitschwerdt, Edward B.}, year={2007}, month={Dec}, pages={1948–1950} }
 @article{breitschwerdt_maggi_duncan_nicholson_hegarty_woods_2007, title={BartonellaSpecies in Blood of Immunocompetent Persons with Animal and Arthropod Contact}, volume={13}, ISSN={1080-6040 1080-6059}, url={http://dx.doi.org/10.3201/eid1306.061337}, DOI={10.3201/eid1306.061337}, abstractNote={Using PCR in conjunction with pre-enrichment culture, we detected Bartonella henselae and B. vinsonii subspecies berkhoffii in the blood of 14 immunocompetent persons who had frequent animal contact and arthropod exposure.}, number={6}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Breitschwerdt, Edward B. and Maggi, Ricardo G. and Duncan, Ashlee W. and Nicholson, William L. and Hegarty, Barbara C. and Woods, Christopher W.}, year={2007}, month={Jun}, pages={938–941} }
 @article{vissotto de paiva diniz_maggi_schwartz_cadenas_bradley_hegarty_breitschwerdt_2007, title={Canine bartonellosis: serological and molecular prevalence in Brazil and evidence of co-infection with Bartonella henselae and Bartonella vinsonii subsp berkhoffii}, volume={38}, ISSN={["0928-4249"]}, DOI={10.1051/vetres:2007023}, abstractNote={The purpose of this study was to determine the serological and molecular prevalence of Bartonella spp. infection in a sick dog population from Brazil. At the São Paulo State University Veterinary Teaching Hospital in Botucatu, 198 consecutive dogs with clinicopathological abnormalities consistent with tick-borne infections were sampled. Antibodies to Bartonella henselae and Bartonella vinsonii subsp. berkhoffii were detected in 2.0% (4/197) and 1.5% (3/197) of the dogs, respectively. Using 16S-23S rRNA intergenic transcribed spacer (ITS) primers, Bartonella DNA was amplified from only 1/198 blood samples. Bartonella seroreactive and/or PCR positive blood samples (n=8) were inoculated into a liquid pre-enrichment growth medium (BAPGM) and subsequently sub-inoculated onto BAPGM/blood-agar plates. PCR targeting the ITS region, pap31 and rpoB genes amplified B. henselae from the blood and/or isolates of the PCR positive dog (ITS: DQ346666; pap31 gene: DQ351240; rpoB: EF196806). B. henselae and B. vinsonii subsp. berkhoffii (pap31: DQ906160; rpoB: EF196805) co-infection was found in one of the B. vinsonii subsp. berkhoffii seroreactive dogs. We conclude that dogs in this study population were infrequently exposed to or infected with a Bartonella species. The B. henselae and B. vinsonii subsp. berkhoffii strains identified in this study are genetically similar to strains isolated from septicemic cats, dogs, coyotes and human beings from other parts of the world. To our knowledge, these isolates provide the first Brazilian DNA sequences from these Bartonella species and the first evidence of Bartonella co-infection in dogs.}, number={5}, journal={VETERINARY RESEARCH}, author={Vissotto De Paiva Diniz, Pedro Paulo and Maggi, Ricardo Guillermo and Schwartz, Denise Saretta and Cadenas, Maria Belen and Bradley, Julie Meredith and Hegarty, Barbara and Breitschwerdt, Edward Bealmear}, year={2007}, pages={697–710} }
 @article{morales_breitschwerdt_washabau_matise_maggi_duncan_2007, title={Detection of Bartonella henselae DNA in two dogs with pyogranulomatous lymphadenitis}, volume={230}, ISSN={0003-1488}, url={http://dx.doi.org/10.2460/javma.230.5.681}, DOI={10.2460/javma.230.5.681}, abstractNote={Abstract}, number={5}, journal={Journal of the American Veterinary Medical Association}, publisher={American Veterinary Medical Association (AVMA)}, author={Morales, Sofia C. and Breitschwerdt, Edward B. and Washabau, Robert J. and Matise, Ilze and Maggi, Ricardo G. and Duncan, Ashlee W.}, year={2007}, month={Mar}, pages={681–685} }
 @article{cadenas_maggi_diniz_breitschwerdt_sontakke_breithschwerdt_2007, title={Identification of bacteria from clinical samples using Bartonella alpha-Proteobacteria growth medium}, volume={71}, ISSN={0167-7012}, url={http://dx.doi.org/10.1016/j.mimet.2007.08.006}, DOI={10.1016/j.mimet.2007.08.006}, abstractNote={In an effort to overcome historical problems associated with the isolation of Bartonella species from animal and human blood samples, our laboratory developed a novel, chemically modified, insect-based, liquid culture medium (Bartonella alpha-Proteobacteria growth medium, BAPGM). In this study, we describe the isolation of non-Bartonella bacteria from aseptically obtained human blood and tissue samples that were inoculated into BAPGM pre-enrichment culture medium, and were obtained during attempts to define each individuals Bartonella infection status. After incubation for at least 7 days in liquid BAPGM, pre-enriched inoculums were sub-cultured onto a BAPGM/blood agar plate. Bacterial DNA was extracted from pooled plated colonies and amplified using conventional PCR targeting the 16S rRNA gene. Subsequently, amplicons were cloned, sequenced and compared to GenBank database sequences using the BLAST program. Regardless of the patient's Bartonella status, seventeen samples generated only one 16S rDNA sequence, representing the following genera: Arthrobacter, Bacillus, Bartonella, Dermabacter, Methylobacterium, Propionibacterium, Pseudomonas, Staphylococcus and bacteria listed as “non-cultured” in the GenBank database. Alkalibacterium, Arthrobacter, Erwinia, Kineococcus, Methylobacterium, Propionibacterium, Sphingomonas, and Staphylococcus were isolated from nine Bartonella-infected individuals. Co-isolation of Acinetobacter, Sphingomonas, Staphylococcus spp. and bacteria listed as “non-cultured” in the GenBank database was achieved for four samples in which Bartonella spp. were not detected. Despite the phylogenetic limitations of using partial 16S rRNA gene sequencing for species and strain identification, the investigational methodology described in this study may provide a complementary approach for the isolation and identification of bacteria from patient samples.}, number={2}, journal={Journal of Microbiological Methods}, publisher={Elsevier BV}, author={Cadenas, Maria B. and Maggi, Ricardo G. and Diniz, Pedro P.V.P. and Breitschwerdt, Kyle T. and Sontakke, Sushama and Breithschwerdt, Edward B.}, year={2007}, month={Nov}, pages={147–155} }
 @article{jones_valenzisi_sontakke_sprayberry_maggi_hegarty_breitschwerdt_2007, title={Use of an insect cell culture growth medium to isolate bacteria from horses with effusive, fibrinous pericarditis: A preliminary study}, volume={121}, ISSN={0378-1135}, url={http://dx.doi.org/10.1016/j.vetmic.2006.11.024}, DOI={10.1016/j.vetmic.2006.11.024}, abstractNote={Effusive, fibrinous pericarditis is an uncommon disease entity in horses. In 2001, pericarditis occurred in conjunction with an epizootic in central Kentucky that was associated with exposure to eastern tent caterpillars (ETCs). Bacterial isolation from equine pericardial fluid samples was attempted using an insect cell culture growth medium (ICCGM). Using previously cultured, stored frozen samples from four horses with fibrinous pericarditis, inoculation of 10% blood agar plates yielded no growth, whereas simultaneous inoculation of ICCGM resulted in the isolation of Proprionibacterium acnes, Staphylococcus equorum, a Streptococcus sp. and Pseudomonas rhodesiae from pericardial fluid samples. A similar or novel caterpillar-associated bacteria was not identified; however, use of an ICCGM might enhance isolation of bacteria from equine pericardial fluid.}, number={1-2}, journal={Veterinary Microbiology}, publisher={Elsevier BV}, author={Jones, Samuel L. and Valenzisi, Amy and Sontakke, Sushama and Sprayberry, Kimberly A. and Maggi, Ricardo and Hegarty, Barbara and Breitschwerdt, Edward}, year={2007}, month={Mar}, pages={177–181} }
 @article{maggi_chomel_hegarty_henn_breitschwerdt_2006, title={A Bartonella vinsonii berkhoffii typing scheme based upon 16S–23S ITS and Pap31 sequences from dog, coyote, gray fox, and human isolates}, volume={20}, ISSN={0890-8508}, url={http://dx.doi.org/10.1016/j.mcp.2005.11.002}, DOI={10.1016/j.mcp.2005.11.002}, abstractNote={Since the isolation of Bartonella vinsonii subspecies berkhoffii from a dog with endocarditis in 1993, this organism has emerged as an important pathogen in dogs and as an emerging pathogen in people. Current evidence indicates that coyotes, dogs and gray foxes potentially serve as reservoir hosts. Based upon sequence differences within the 16S–23S ITS region and Pap31 gene, we propose a classification scheme that divides B. vinsonii subsp. berkhoffii isolates into four distinct types. Two conserved sequences, of 37 and 18 bp, respectively, are differentially present within the ITS region of each of the four B. vinsonii subsp. berkhoffii types. To date, B. vinsonii berkhoffii types I, II, and III have been identified in the US, type III in Europe and type IV in Canada. Based upon the proposed genotyping scheme, the geographic distribution of B. vinsonii berkhoffii types needs to be more thoroughly delineated in future molecular epidemiological studies involving Bartonella infection in coyotes, dogs, gray foxes, human beings and potentially other animals or in arthropod vectors. Strain typing may help to better define the reservoir potential, carriership patterns, modes of transmission, and geographic distribution for each B. vinsonii berkhoffii type.}, number={2}, journal={Molecular and Cellular Probes}, publisher={Elsevier BV}, author={Maggi, Ricardo G. and Chomel, Bruno and Hegarty, Barbara C. and Henn, Jennifer and Breitschwerdt, Edward B.}, year={2006}, month={Apr}, pages={128–134} }
 @article{mellor_fetz_maggi_haugland_dunning_villiers_mellanby_williams_breitschwerdt_herrtage_2006, title={Alpha1-proteinase inhibitor deficiency and Bartonella infection in association with panniculitis, polyarthritis, and meningitis in a dog}, volume={20}, number={4}, journal={Journal of Veterinary Internal Medicine}, author={Mellor, P. J. and Fetz, K. and Maggi, R. G. and Haugland, S. and Dunning, M. and Villiers, E. J. and Mellanby, R. J. and Williams, D. and Breitschwerdt, E. and Herrtage, M. E.}, year={2006}, pages={1023–1028} }
 @article{kelly_rolain_maggi_sontakke_keene_hunter_lepidi_breitschwerdt_breitschwerdt_raoult_et al._2006, title={Bartonella quintana Endocarditis in Dogs}, volume={12}, ISSN={1080-6040}, url={http://dx.doi.org/10.3201/eid1212.060724}, DOI={10.3201/eid1212.060724}, abstractNote={TOC summary line: PCR and sequencing provide the first evidence that B. quintana can be pathogenic in dogs.}, number={12}, journal={Emerging Infectious Diseases}, publisher={Centers for Disease Control and Prevention (CDC)}, author={Kelly, P. and Rolain, J. M. and Maggi, Ricardo and Sontakke, S. and Keene, B. and Hunter, S. and Lepidi, H. and Breitschwerdt, K. T. and Breitschwerdt, Edward and Raoult, D. and et al.}, year={2006}, pages={1869–1872} }
 @article{diniz_schwartz_maggi_cadenas_breitschwerdt_2006, title={Molecular prevalence of bartonella spp. in brazilian dogs}, volume={20}, number={3}, journal={Journal of Veterinary Internal Medicine}, author={Diniz, P. and Schwartz, D.S. and Maggi, R.G. and Cadenas, M.B. and Breitschwerdt, E.B.}, year={2006}, pages={762} }
 @article{breitschwerdt_hegarty_maggi_hawkins_dyer_2005, title={Bartonella Species as a Potential Cause of Epistaxis in Dogs}, volume={43}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.43.5.2529-2533.2005}, DOI={10.1128/JCM.43.5.2529-2533.2005}, abstractNote={ABSTRACT}, number={5}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Breitschwerdt, E. B. and Hegarty, B. C. and Maggi, R. and Hawkins, E. and Dyer, P.}, year={2005}, month={May}, pages={2529–2533} }
 @article{maggi_harms_hohn_pabst_mclellan_walton_rotstein_breitschwerdt_2005, title={Bartonella henselae in porpoise blood}, volume={11}, number={12}, journal={Emerging Infectious Diseases}, author={Maggi, R. G. and Harms, C. A. and Hohn, A. A. and Pabst, D. A. and McLellan, W. A. and Walton, W. J. and Rotstein, D. S. and Breitschwerdt, E. B.}, year={2005}, pages={1894–1898} }
 @article{maggi_breitschwerdt_2005, title={Isolation of Bacteriophages from <i>Bartonella vinsonii </i>subsp.<i> berkhoffii</i> and the Characterization of Pap31 Gene Sequences from Bacterial and Phage DNA}, volume={9}, ISSN={1464-1801 1660-2412}, url={http://dx.doi.org/10.1159/000088145}, DOI={10.1159/000088145}, abstractNote={Bacteriophages enhance bacterial survival, facilitate bacterial adaptation to new environmental conditions, assist in the adaptation to a new host species, and enhance bacterial evasion or inactivation of host defense mechanisms. We describe the detection and purification of a novel tailed bacteriophage from <i>Bartonella vinsonii </i>subsp.<i> berkhoffii</i>, which was previously described as a bacteriophage-negative species. We also compare <i>B. vinsonii </i>subsp.<i> berkhoffi </i>Pap31 bacteriophage gene sequences to <i>B. henselae </i>(Houston I), and <i>B. quintana</i> (Fuller) bacteriophage Pap31 sequences. Negative staining electron microscopy of log phase culturesof <i>B. vinsonii </i>subsp.<i> berkhoffii </i>identifiedbacteriophages, possessing a 50-nm icosahedric head diameter and a 60- to 80-nm contractile tail. Sequence analysis of the bacteriophage Pap31 gene from<i> B. vinsonii </i>subsp.<i> berkhoffii</i> showed three consensus sequences and a 12-bp insertion when compared with Pap31 gene sequences from <i>B. henselae (</i>Houston I) and <i>B. quintana (</i>Fuller) bacteriophages. Isolation of <i>B. vinsonii </i>subsp.<i> berkhoffii</i> bacteriophages containing a Pap31 gene suggests that this heme-binding protein gene might play an important role in bacterial virulence through the genetic exchange of DNA within this subspecies. Defining phage-associated genes may also contribute to the enhanced understanding of the evolutionary relationships among members of the genus <i>Bartonella</i>.}, number={1}, journal={Journal of Molecular Microbiology and Biotechnology}, publisher={S. Karger AG}, author={Maggi, Ricardo G. and Breitschwerdt, Edward B.}, year={2005}, pages={44–51} }
 @article{maggi_duncan_breitschwerdt_2005, title={Novel Chemically Modified Liquid Medium That Will Support the Growth of Seven Bartonella Species}, volume={43}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.43.6.2651-2655.2005}, DOI={10.1128/JCM.43.6.2651-2655.2005}, abstractNote={ABSTRACT}, number={6}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Maggi, R. G. and Duncan, A. W. and Breitschwerdt, E. B.}, year={2005}, month={Jun}, pages={2651–2655} }
 @article{maggi_breitschwerdt_2005, title={Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species}, volume={43}, ISSN={0095-1137}, url={http://dx.doi.org/10.1128/JCM.43.3.1171-1176.2005}, DOI={10.1128/JCM.43.3.1171-1176.2005}, abstractNote={ABSTRACT}, number={3}, journal={Journal of Clinical Microbiology}, publisher={American Society for Microbiology}, author={Maggi, R. G. and Breitschwerdt, E. B.}, year={2005}, month={Mar}, pages={1171–1176} }
 @misc{breitschwerdt_maggi_2005, title={Potential limitations of the 16S-23S rRNA intergenic region for molecular detection of Bartonella species - Authors' reply}, volume={43}, number={9}, journal={Journal of Clinical Microbiology}, author={Breitschwerdt, E. B. and Maggi, R. G.}, year={2005}, pages={4922} }
 @article{maggi_govind_2004, title={Regulated expression of green fluorescent protein in Debaryomyces hansenii}, volume={31}, ISSN={1367-5435 1476-5535}, url={http://dx.doi.org/10.1007/s10295-004-0150-9}, DOI={10.1007/s10295-004-0150-9}, abstractNote={The broad range of environmental conditions under which Debaryomyces hansenii can grow, and its production of lipolytic and proteolytic enzymes, have promoted its widespread use. The present work represents a preliminary characterization of D. hansenii for heterologous expression and secretion of green fluorescent protein (GFP). Six heterologous expression vectors were used to address protein production efficiency under regulated expression conditions. Protein expression in D. hansenii seems to be similar to that in Saccharomyces cerevisiae, with transcription being controlled by almost all of the S. cerevisiae and D. hansenii inducible promoters tested, with the exception of the alcohol dehydrogenase 2 gene promoter from S. cerevisiae. Extracellular protein levels in D. hansenii were lower than in S. cerevisiae when Saccharomyces signal peptides were used.}, number={7}, journal={Journal of Industrial Microbiology & Biotechnology}, publisher={Springer Science and Business Media LLC}, author={Maggi, Ricardo G. and Govind, Nadathur S.}, year={2004}, month={Jul}, pages={301–310} }