@article{tzanetakis_guzman-baeny_vanesbroeck_fernandez_martin_2009, title={First Report of Impatiens necrotic spot virus in Blackberry in the Southeastern United States}, volume={93}, ISSN={["0191-2917"]}, DOI={10.1094/PDIS-93-4-0432A}, abstractNote={ Blackberry yellow vein disease (BYVD) has emerged as an important disease of blackberry (Rubus spp.) in the south and southeastern United States (2,3). In an effort to characterize viruses that may be involved in the disease, double-stranded RNA extracted from a symptomatic ‘Apache’ blackberry from South Carolina was used for shotgun cDNA cloning (4). Sequence analysis showed that in addition to Blackberry yellow vein associated virus (BYVaV) (2), a constant component of BYVD, sequences of Impatiens necrotic spot virus (INSV) also were obtained. The 623-nt fragment of INSV (Genbank Accession No. EU287930) shared 98% nucleotide and amino acid sequence identity with GenBank Accession No. NC003616. Confirmation of the results of the initial shotgun cloning was done by reverse transcription-PCR with primers INSVF (5′ GATCTGTCCTGGGATTGTTC 3′) and INSVR (5′ GTCTCCTTCTGGTTCTATAATCAT 3′) that amplify a 460 base fragment of the M RNA of INSV. Amplicons obtained from single-stranded and dsRNA templates were sequenced and found to be identical with EU287930. The identity of INSV by PCR was also supported by positive results with a commercially available INSV-ELISA kit (AC Diagnostics, Fayetteville, AR). Earlier, more than 400 plants from North Carolina, South Carolina, and Virginia with BYVD and other virus-like symptoms were tested for INSV by ELISA and approximately 33% were found to be infected with the virus (1). Thus, INSV appears to be one of the major viruses infecting blackberry in the southeastern United States, and it remains to be seen if INSV acts synergistically with BYVaV and other viruses to contribute to the severity of BYDV. To our knowledge, this is the first report of INSV infecting Rubus spp. }, number={4}, journal={PLANT DISEASE}, author={Tzanetakis, I. E. and Guzman-Baeny, T. L. and VanEsbroeck, Z. P. and Fernandez, G. E. and Martin, R. R.}, year={2009}, month={Apr}, pages={432–432} }
 @article{leandro_guzman_ferguson_fernandez_louws_2007, title={Population dynamics of Trichoderma in fumigated and compost-amended soil and on strawberry roots}, volume={35}, ISSN={["1873-0272"]}, DOI={10.1016/j.apsoil.2006.04.008}, abstractNote={Effectiveness of Trichoderma strains for biocontrol of soilborne pathogens requires an improved understanding of soil and root ecology of this fungus. We compared the population dynamics of Trichoderma hamatum strain T382 (T382) and indigenous Trichoderma spp. in soil and on roots in different strawberry production systems. Strawberry transplants, either amended or not-amended with Trichoderma biocontrol strains, were planted in field soil left untreated or treated with soil fumigant, compost, and compost-amended with T382. Soil and root samples were taken between October and June of two production seasons (2002-03 and 2003-04), and Trichoderma populations were assessed by plating soil dilutions and root pieces onto selective medium. Identity of T382 was confirmed using strain-specific primers. T382 became established and maintained a stable population of 103 cfu/g soil throughout the growing season when added to field soil in amended compost, but T382 was rarely isolated from strawberry roots. Populations of indigenous Trichoderma spp. were up to 60-fold greater in fumigated soil than in any other soil treatment. Indigenous Trichoderma spp. were isolated from a greater proportion (20–50%) of roots in fumigated soil than from roots in the other treatments (0–20%). Transplant treatments did not significantly affect Trichoderma populations on roots or in soil during field production. This study showed that compost may be used as a substrate to establish and promote survival of Trichoderma in field soil, and illustrates how soil manipulation can affect population dynamics of indigenous Trichoderma spp. on roots and in soil.}, number={1}, journal={APPLIED SOIL ECOLOGY}, publisher={Elsevier BV}, author={Leandro, L. F. S. and Guzman, T. and Ferguson, L. M. and Fernandez, G. E. and Louws, F. J.}, year={2007}, month={Jan}, pages={237–246} }