@article{rivas_tan_shaverdian_nguyen_wouters_stern_li_2024, title={A novel <i>ITGA2B</i> double cytosine frameshift variant (c.1986_1987insCC) leads to Glanzmann&apos;s thrombasthenia in a cat}, volume={3}, ISSN={["1939-1676"]}, url={https://doi.org/10.1111/jvim.17030}, DOI={10.1111/jvim.17030}, abstractNote={Abstract}, journal={JOURNAL OF VETERINARY INTERNAL MEDICINE}, author={Rivas, Victor N. and Tan, Avalene W. K. and Shaverdian, Meg and Nguyen, Nghi P. and Wouters, Jalena R. and Stern, Joshua A. and Li, Ronald H. L.}, year={2024}, month={Mar} }
 @article{rivas_crofton_jauregui_wouters_yang_wittenburg_kaplan_hwee_murphy_morgan_et al._2024, title={Cardiac myosin inhibitor, CK-586, minimally reduces systolic function and ameliorates obstruction in feline hypertrophic cardiomyopathy}, url={http://dx.doi.org/10.1038/s41598-024-62840-3}, DOI={10.1038/s41598-024-62840-3}, abstractNote={Abstract Hypertrophic cardiomyopathy (HCM) remains the most common cardiomyopathy in humans and cats with few preclinical pharmacologic interventional studies. Small-molecule sarcomere inhibitors are promising novel therapeutics for the management of obstructive HCM (oHCM) patients and have shown efficacy in left ventricular outflow tract obstruction (LVOTO) relief. The objective of this study was to explore the 6-, 24-, and 48-hour (h) pharmacodynamic effects of the cardiac myosin inhibitor, CK-586, in six purpose-bred cats with naturally occurring oHCM. A blinded, randomized, five-treatment group, crossover preclinical trial was conducted to assess the pharmacodynamic effects of CK-586 in this oHCM model. Dose assessments and select echocardiographic variables were assessed five times over a 48-h period. Treatment with oral CK-586 safely ameliorated LVOTO in oHCM cats. CK-586 treatment dose-dependently eliminated obstruction (reduced LVOTOmaxPG), increased measures of systolic chamber size (LVIDs Sx), and decreased select measures of heart function (LV FS% and LV EF%) in the absence of impact on heart rate. At all tested doses, a single oral CK-586 dose resulted in improved or resolved LVOTO with well-tolerated, dose-dependent, reductions in LV systolic function. The results from this study pave the way for the potential use of CK-586 in both the veterinary and human clinical setting.}, journal={Scientific Reports}, author={Rivas, Victor N. and Crofton, Amanda E. and Jauregui, Carina E. and Wouters, Jalena R. and Yang, Betty S. and Wittenburg, Luke A. and Kaplan, Joanna L. and Hwee, Darren T. and Murphy, Anne N. and Morgan, Bradley P. and et al.}, year={2024}, month={May} }
 @article{advancing treatments for feline hypertrophic cardiomyopathy the role of animal models and targeted_2023, url={https://publons.com/wos-op/publon/64488725/}, DOI={10.1016/J.CVSM.2023.05.011}, abstractNote={Feline HCM is the most common cardiovascular disease in cats , leading to devastating outcomes, including congestive heart failure (CHF), arterial thromboembolism (ATE), and sudden death. Evidence demonstrating long-term survival benefit with currently available therapies is lacking. Therefore, it is imperative to explore intricate genetic and molecular pathways that drive HCM pathophysiology to inspire the development of novel therapeutics. Several clinical trials exploring new drug therapies are currently underway, including those investigating small molecule inhibitors and rapamycin. This article outlines the key work performed using cellular and animal models that has led to and continues to guide the development of new innovative therapeutic strategies.}, journal={Veterinary Clinics of North America - Small Animal Practice}, year={2023} }
 @article{kaplan_rivas_walker_grubb_farrell_fitzgerald_kennedy_pjauregui_crofton_pmclaughlin_et al._2023, title={Delayed-release rapamycin halts progression of left ventricular hypertrophy in subclinical feline hypertrophic results of the RAPACAT trial}, volume={261}, ISSN={["1943-569X"]}, url={https://publons.com/wos-op/publon/65523912/}, DOI={10.2460/JAVMA.23.04.0187}, abstractNote={Abstract}, number={11}, journal={JAVMA-JOURNAL OF THE AMERICAN VETERINARY MEDICAL ASSOCIATION}, author={Kaplan, Joanna L. and Rivas, Victor N. and Walker, Ashley L. and Grubb, Louise and Farrell, Aisling and Fitzgerald, Stuart and Kennedy, Susan and Pjauregui, Carina E. and Crofton, Amanda E. and Pmclaughlin, Chris and et al.}, year={2023}, month={Nov}, pages={1628–1637} }
 @article{sharpe_oldach_rivas_kaplan_walker_kovacs_hwee_cremin_morgan_malik_et al._2023, title={Effects of <i>Aficamten</i> on cardiac contractility in a feline translational model of hypertrophic cardiomyopathy}, volume={13}, url={https://publons.com/wos-op/publon/54596599/}, DOI={10.1038/S41598-022-26630-Z}, abstractNote={Abstract}, number={1}, journal={Scientific Reports}, author={Sharpe, Ashley N and Oldach, Maureen S and Rivas, Victor N and Kaplan, Joanna L and Walker, Ashley L and Kovacs, Samantha L and Hwee, Darren T and Cremin, Peadar and Morgan, Bradley P and Malik, Fady I and et al.}, year={2023}, pages={32} }
 @article{stern_rivas_kaplan_ueda_oldach_ontiveros_kooiker_dijk_harris_2023, title={Hypertrophic cardiomyopathy in purpose-bred cats with the A31P mutation in cardiac myosin binding protein-C}, volume={13}, ISSN={["2045-2322"]}, url={https://publons.com/wos-op/publon/63367066/}, DOI={10.1038/s41598-023-36932-5}, abstractNote={Abstract}, number={1}, journal={SCIENTIFIC REPORTS}, author={Stern, Joshua A. and Rivas, Victor N. and Kaplan, Joanna L. and Ueda, Yu and Oldach, Maureen S. and Ontiveros, Eric S. and Kooiker, Kristina B. and Dijk, Sabine J. and Harris, Samantha P.}, year={2023}, month={Jun} }
 @article{rivas_kaplan_kennedy_fitzgerald_crofton_farrell_grubb_jauregui_grigorean_choi_et al._2023, title={Multi-Omic, Histopathologic, and Clinicopathologic Effects of Once-Weekly Oral Rapamycin in a Naturally Occurring Feline Model of Hypertrophic Cardiomyopathy: A Pilot Study}, volume={13}, ISSN={["2076-2615"]}, url={https://doi.org/10.3390/ani13203184}, DOI={10.3390/ani13203184}, abstractNote={Hypertrophic cardiomyopathy (HCM) remains the single most common cardiomyopathy in cats, with a staggering prevalence as high as 15%. To date, little to no direct therapeutical intervention for HCM exists for veterinary patients. A previous study aimed to evaluate the effects of delayed-release (DR) rapamycin dosing in a client-owned population of subclinical, non-obstructive, HCM-affected cats and reported that the drug was well tolerated and resulted in beneficial LV remodeling. However, the precise effects of rapamycin in the hypertrophied myocardium remain unknown. Using a feline research colony with naturally occurring hereditary HCM (n = 9), we embarked on the first-ever pilot study to examine the tissue-, urine-, and plasma-level proteomic and tissue-level transcriptomic effects of an intermittent low dose (0.15 mg/kg) and high dose (0.30 mg/kg) of DR oral rapamycin once weekly. Rapamycin remained safe and well tolerated in cats receiving both doses for eight weeks. Following repeated weekly dosing, transcriptomic differences between the low- and high-dose groups support dose-responsive suppressive effects on myocardial hypertrophy and stimulatory effects on autophagy. Differences in the myocardial proteome between treated and control cats suggest potential anti-coagulant/-thrombotic, cellular remodeling, and metabolic effects of the drug. The results of this study closely recapitulate what is observed in the human literature, and the use of rapamycin in the clinical setting as the first therapeutic agent with disease-modifying effects on HCM remains promising. The results of this study establish the need for future validation efforts that investigate the fine-scale relationship between rapamycin treatment and the most compelling gene expression and protein abundance differences reported here.}, number={20}, journal={ANIMALS}, author={Rivas, Victor N. and Kaplan, Joanna L. and Kennedy, Susan A. and Fitzgerald, Stuart and Crofton, Amanda E. and Farrell, Aisling and Grubb, Louise and Jauregui, Carina E. and Grigorean, Gabriela and Choi, Eunju and et al.}, year={2023}, month={Oct} }
 @article{sharpe_oldach_kaplan_rivas_kovacs_hwee_morgan_malik_harris_stern_2023, title={Pharmacokinetics of a single dose of <i>Aficamten</i> (CK-274) on cardiac contractility in a A31P <i>MYBPC3</i> hypertrophic cardiomyopathy cat model}, volume={46}, url={https://publons.com/wos-op/publon/52530096/}, DOI={10.1111/JVP.13103}, abstractNote={Abstract}, number={1}, journal={Journal of Veterinary Pharmacology and Therapeutics}, author={Sharpe, Ashley N and Oldach, Maureen S and Kaplan, Joanna L and Rivas, Victor and Kovacs, Samantha L and Hwee, Darren T and Morgan, Bradley P and Malik, Fady I and Harris, Samantha P and Stern, Joshua A}, year={2023}, pages={52—61} }
 @article{rivas_ueda_stern_2023, title={Sex-specific differences and predictors of echocardiographic measures of diastolic dysfunction in rhesus macaques (Macaca mulatta)}, volume={7}, ISSN={["1600-0684"]}, url={https://doi.org/10.1111/jmp.12662}, DOI={10.1111/jmp.12662}, abstractNote={Abstract}, journal={JOURNAL OF MEDICAL PRIMATOLOGY}, author={Rivas, Victor N. and Ueda, Yu and Stern, Joshua A.}, year={2023}, month={Jul} }
 @article{lo_li_georges_nguyen_chen_stuhlmann_oldach_rivas_fousse_harris_et al._2023, title={Synergistic inhibitory effects of clopidogrel and rivaroxaban on platelet function and platelet‐dependent thrombin generation in cats}, volume={37}, ISSN={0891-6640 1939-1676}, url={http://dx.doi.org/10.1111/jvim.16727}, DOI={10.1111/jvim.16727}, abstractNote={Abstract}, number={4}, journal={Journal of Veterinary Internal Medicine}, publisher={Wiley}, author={Lo, Sara T. and Li, Ronald H. L. and Georges, Catherine J. and Nguyen, Nghi and Chen, Cheyenne K. and Stuhlmann, Claire and Oldach, Maureen Sigmund and Rivas, Victor Noel and Fousse, Samantha and Harris, Samantha P. and et al.}, year={2023}, month={May}, pages={1390–1400} }
 @article{rivas_stern_ueda_2023, title={The Role of Personalized Medicine in Companion Animal Cardiology}, volume={53}, ISSN={["1878-1306"]}, url={https://publons.com/wos-op/publon/65523949/}, DOI={10.1016/J.CVSM.2023.05.016}, abstractNote={Cardiomyopathies remain one of the most common inherited cardiac diseases in both human and veterinary patients. To date, well over 100 mutated genes are known to cause cardiomyopathies in humans with only a handful known in cats and dogs . This review highlights the need and use of personalized one-health approaches to cardiovascular case management and advancement in pharmacogenetic-based therapy in veterinary medicine . Personalized medicine holds promise in understanding the molecular basis of disease and ultimately will unlock the next generation of targeted novel pharmaceuticals and aid in the reversal of detrimental effects at a molecular level.}, number={6}, journal={VETERINARY CLINICS OF NORTH AMERICA-SMALL ANIMAL PRACTICE}, author={Rivas, Victor N. and Stern, Joshua A. and Ueda, Yu}, year={2023}, month={Nov}, pages={1255–1276} }
 @article{increased alpha-tocopherol metabolism in horses with equine neuroaxonal dystrophy_2021, url={https://publons.com/wos-op/publon/56367468/}, DOI={10.1111/JVIM.16233}, abstractNote={Abstract}, journal={Journal of Veterinary Internal Medicine}, year={2021} }
 @article{a nonsense variant in rap guanine nucleotide exchange factor 5 (rapgef5) is associated with equine familial isolated hypoparathyroidism in thoroughbred foals_2020, url={https://publons.com/wos-op/publon/38285852/}, DOI={10.1371/JOURNAL.PGEN.1009028}, abstractNote={Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prioritize potential genetic variants. Of the 2,808 variants that significantly associated with the phenotype using an AR mode of inheritance (P<0.02) and located within a region of homozygosity, 1,507 (54%) were located in a 9.7 Mb region on chr4 (44.9–54.6 Mb). Within this region, a nonsense variant (RAPGEF5 c.2624C>A,p.Ser875*) was significantly associated with the hypoparathyroid phenotype (Pallelic = 0.008). Affected foals were homozygous for the variant, with two additional affected foals subsequently confirmed in 2019. Necropsies of all affected foals failed to identify any histologically normal parathyroid glands. Because the nonsense mutation in RAPGEF5 was near the C-terminal end of the protein, the impact on protein function was unclear. Therefore, we tested the variant in our Xenopus overexpression model and demonstrated RAPGEF5 loss-of-function. This RAPGEF5 variant represents the first genetic variant for hypoparathyroidism identified in any domestic animal species.}, journal={PLOS Genetics}, year={2020} }
 @article{trim39-rpp21 variants (delta 19insccc) are not associated with juvenile idiopathic epilepsy in egyptian arabian horses_2019, url={https://publons.com/wos-op/publon/26456235/}, DOI={10.3390/GENES10100816}, abstractNote={Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.}, journal={Genes}, year={2019} }
 @article{an innate immune response and altered nuclear receptor activation defines the spinal cord transcriptome during alpha-tocopherol deficiency in <i>ttpa</i>-null mice_2018, url={https://publons.com/wos-op/publon/20546746/}, DOI={10.1016/J.FREERADBIOMED.2018.02.037}, abstractNote={Mice with deficiency in tocopherol (alpha) transfer protein gene develop peripheral tocopherol deficiency and sensory neurodegeneration. Ttpa-/- mice maintained on diets with deficient α-tocopherol (α-TOH) had proprioceptive deficits by six months of age, axonal degeneration and neuronal chromatolysis within the dorsal column of the spinal cord and its projections into the medulla. Transmission electron microscopy revealed degeneration of dorsal column axons. We addressed the potential pathomechanism of α-TOH deficient neurodegeneration by global transcriptome sequencing within the spinal cord and cerebellum. RNA-sequencing of the spinal cord in Ttpa-/- mice revealed upregulation of genes associated with the innate immune response, indicating a molecular signature of microglial activation as a result of tocopherol deficiency. For the first time, low level Ttpa expression was identified in the murine spinal cord. Further, the transcription factor liver X receptor (LXR) was strongly activated by α-TOH deficiency, triggering dysregulation of cholesterol biosynthesis. The aberrant activation of transcription factor LXR suppressed the normal induction of the transcription factor retinoic-related orphan receptor-α (RORA), which is required for neural homeostasis. Thus we find that α-TOH deficiency induces LXR, which may lead to a molecular signature of microglial activation and contribute to sensory neurodegeneration.}, journal={Free Radical Biology and Medicine}, year={2018} }