@article{chen_liu_guo_hao_pan_zhang_liu_zhao_luo_he_et al._2023, title={Differential SW16.1 allelic effects and genetic backgrounds contributed to increased seed weight after soybean domestication}, volume={5}, ISSN={["1744-7909"]}, DOI={10.1111/jipb.13480}, abstractNote={ABSTRACT}, journal={JOURNAL OF INTEGRATIVE PLANT BIOLOGY}, author={Chen, Xianlian and Liu, Cheng and Guo, Pengfei and Hao, Xiaoshuai and Pan, Yongpeng and Zhang, Kai and Liu, Wusheng and Zhao, Lizhi and Luo, Wei and He, Jianbo and et al.}, year={2023}, month={May} }
 @article{huang_gao_mcadams_zhao_lu_wu_martin_sherif_subramanian_duan_et al._2023, title={Engineered Cleistogamy in Camelina sativa for bioconfinement}, volume={10}, ISSN={["2052-7276"]}, DOI={10.1093/hr/uhac280}, abstractNote={Abstract}, number={2}, journal={HORTICULTURE RESEARCH}, author={Huang, Debao and Gao, Liwei and McAdams, Jeremy and Zhao, Fangzhou and Lu, Hongyan and Wu, Yonghui and Martin, Jeremy and Sherif, Sherif M. and Subramanian, Jayasankar and Duan, Hui and et al.}, year={2023}, month={Feb} }
 @article{brooks_elorriaga_liu_duduit_yuan_tsai_tuskan_ranney_yang_liu_2023, title={Plant Promoters and Terminators for High-Precision Bioengineering}, url={https://doi.org/10.34133/bdr.0013}, DOI={10.34133/bdr.0013}, abstractNote={High-precision bioengineering and synthetic biology require fine-tuning gene expression at both transcriptional and posttranscriptional levels. Gene transcription is tightly regulated by promoters and terminators. Promoters determine the timing, tissues and cells, and levels of the expression of genes. Terminators mediate transcription termination of genes and affect mRNA levels posttranscriptionally, e.g., the 3′-end processing, stability, translation efficiency, and nuclear to cytoplasmic export of mRNAs. The promoter and terminator combination affects gene expression. In the present article, we review the function and features of plant core promoters, proximal and distal promoters, and terminators, and their effects on and benchmarking strategies for regulating gene expression.}, journal={BioDesign Research}, author={Brooks, Emily G. and Elorriaga, Estefania and Liu, Yang and Duduit, James R. and Yuan, Guoliang and Tsai, Chung-Jui and Tuskan, Gerald A. and Ranney, Thomas G. and Yang, Xiaohan and Liu, Wusheng}, year={2023}, month={Jan} }
 @article{zhang_zhou_liu_wu_li_xu_li_imaizumi_hou_liu_2022, title={BrABF3 promotes flowering through the direct activation of CONSTANS transcription in pak choi}, volume={5}, ISSN={["1365-313X"]}, url={https://doi.org/10.1111/tpj.15783}, DOI={10.1111/tpj.15783}, abstractNote={SUMMARY}, journal={PLANT JOURNAL}, publisher={Wiley}, author={Zhang, Changwei and Zhou, Qian and Liu, Wusheng and Wu, Xiaoting and Li, Zhubo and Xu, Yuanyuan and Li, Ying and Imaizumi, Takato and Hou, Xilin and Liu, Tongkun}, year={2022}, month={May} }
 @article{duduit_kosentka_miller_blanco-ulate_lenucci_panthee_perkins-veazie_liu_2022, title={Coordinated transcriptional regulation of the carotenoid biosynthesis contributes to fruit lycopene content in high-lycopene tomato genotypes}, volume={9}, ISSN={2052-7276}, url={http://dx.doi.org/10.1093/hr/uhac084}, DOI={10.1093/hr/uhac084}, abstractNote={Abstract}, journal={Horticulture Research}, publisher={Oxford University Press (OUP)}, author={Duduit, James R and Kosentka, Pawel Z and Miller, Morgan A and Blanco-Ulate, Barbara and Lenucci, Marcello S and Panthee, Dilip R and Perkins-Veazie, Penelope and Liu, Wusheng}, year={2022} }
 @article{sultana_mazarei_millwood_liu_hewezi_stewart jr_2022, title={Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max)}, volume={13}, ISSN={["1664-462X"]}, DOI={10.3389/fpls.2022.988048}, abstractNote={We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.}, journal={FRONTIERS IN PLANT SCIENCE}, author={Sultana, Mst Shamira and Mazarei, Mitra and Millwood, Reginald J. and Liu, Wusheng and Hewezi, Tarek and Stewart Jr, C. Neal}, year={2022}, month={Sep} }
 @misc{maren_duan_da_yencho_ranney_liu_2022, title={Genotype-independent plant transformation}, volume={9}, ISSN={["2052-7276"]}, DOI={10.1093/hr/uhac047}, abstractNote={Abstract}, journal={HORTICULTURE RESEARCH}, author={Maren, Nathan A. and Duan, Hui and Da, Kedong and Yencho, G. Craig and Ranney, Thomas G. and Liu, Wusheng}, year={2022}, month={Jan} }
 @article{zhao_cheng_wang_gao_huang_kong_antwi-boasiako_zheng_yan_chang_et al._2022, title={Identification of Novel Genomic Regions for Bacterial Leaf Pustule (BLP) Resistance in Soybean (Glycine max L.) via Integrating Linkage Mapping and Association Analysis}, volume={23}, ISSN={["1422-0067"]}, url={https://www.mdpi.com/1422-0067/23/4/2113}, DOI={10.3390/ijms23042113}, abstractNote={Bacterial leaf pustule (BLP), caused by Xanthornonas axonopodis pv. glycines (Xag), is a worldwide disease of soybean, particularly in warm and humid regions. To date, little is known about the underlying molecular mechanisms of BLP resistance. The only single recessive resistance gene rxp has not been functionally identified yet, even though the genotypes carrying the gene have been widely used for BLP resistance breeding. Using a linkage mapping in a recombinant inbred line (RIL) population against the Xag strain Chinese C5, we identified that quantitative trait locus (QTL) qrxp–17–2 accounted for 74.33% of the total phenotypic variations. We also identified two minor QTLs, qrxp–05–1 and qrxp–17–1, that accounted for 7.26% and 22.26% of the total phenotypic variations, respectively, for the first time. Using a genome-wide association study (GWAS) in 476 cultivars of a soybean breeding germplasm population, we identified a total of 38 quantitative trait nucleotides (QTNs) on chromosomes (Chr) 5, 7, 8, 9,15, 17, 19, and 20 under artificial infection with C5, and 34 QTNs on Chr 4, 5, 6, 9, 13, 16, 17, 18, and 20 under natural morbidity condition. Taken together, three QTLs and 11 stable QTNs were detected in both linkage mapping and GWAS analysis, and located in three genomic regions with the major genomic region containing qrxp_17_2. Real-time RT-PCR analysis of the relative expression levels of five potential candidate genes in the resistant soybean cultivar W82 following Xag treatment showed that of Glyma.17G086300, which is located in qrxp–17–2, significantly increased in W82 at 24 and 72 h post-inoculation (hpi) when compared to that in the susceptible cultivar Jack. These results indicate that Glyma.17G086300 is a potential candidate gene for rxp and the QTLs and QTNs identified in this study will be useful for marker development for the breeding of Xag-resistant soybean cultivars.}, number={4}, journal={INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES}, author={Zhao, Fangzhou and Cheng, Wei and Wang, Yanan and Gao, Xuewen and Huang, Debao and Kong, Jiejie and Antwi-Boasiako, Augustine and Zheng, Lingyi and Yan, Wenliang and Chang, Fangguo and et al.}, year={2022}, month={Feb} }
 @article{liao_ye_zhang_peng_hou_fu_tan_zhao_jiang_xu_et al._2022, title={The genomic and bulked segregant analysis of Curcuma alismatifolia revealed its diverse bract pigmentation}, volume={3}, ISSN={["2662-1738"]}, DOI={10.1007/s42994-022-00081-6}, abstractNote={Abstract}, number={3}, journal={ABIOTECH}, author={Liao, Xuezhu and Ye, Yuanjun and Zhang, Xiaoni and Peng, Dan and Hou, Mengmeng and Fu, Gaofei and Tan, Jianjun and Zhao, Jianli and Jiang, Rihong and Xu, Yechun and et al.}, year={2022}, month={Sep}, pages={178–196} }
 @article{harmon_touchell_ranney_da_liu_2022, title={Tissue Culture and Regeneration of Three Rose Cultivars}, volume={57}, ISSN={["2327-9834"]}, DOI={10.21273/HORTSCI16716-22}, abstractNote={Methods of in vitro regeneration protocols were developed for three elite rose cultivars, Chewnicebell (Oso Easy Italian Ice®), Bucbi (Carefree Beauty™), and Cheweyesup (Ringo All-Star™). We evaluated the effects of different types and concentrations of auxins [dichlorophenoxyacetic acid (2,4-D) and trichlorophenoxyacetic acid (2,4,5-T)], carbohydrates [sucrose, glucose, and fructose], and cytokinins [thidiazuron (TDZ) and 6-bezylaminopurine (BAP)] on callus induction and regeneration from leaf explants. The greatest amount of regenerative callus was obtained on media containing 10 µM 2,4-D and 30 g·L−1 sucrose for Italian Ice® (40%), 10 µM 2,4-D and 60 g·L−1 glucose for Carefree Beauty™ (24%), and 5 µM 2,4,5-T and 30 g·L−1 sucrose for Ringo All-Star™ (32%). The greatest regeneration occurred when callus was transferred to media consisting of 1/2 MS media supplemented with 2.9 µM GA3 and 5 µM TDZ for Italian Ice® and Ringo All-Star™, and with 2.9 µM GA3 and 20 µM TDZ for Carefree Beauty™. Plantlets regenerated from callus were cultured on maintenance media and successfully transferred ex vitro. This study highlights the genotype-specific responses among rose cultivars and provides the first reports of in vitro regeneration for Italian Ice® and Ringo All-Star™.}, number={11}, journal={HORTSCIENCE}, author={Harmon, Davis D. and Touchell, Darren H. and Ranney, Thomas G. and Da, Kedong and Liu, Wusheng}, year={2022}, month={Nov}, pages={1430–1435} }
 @article{zhao_maren_kosentka_liao_lu_duduit_huang_ashrafi_zhao_huerta_et al._2021, title={An optimized protocol for stepwise optimization of real-time RT-PCR analysis}, volume={8}, ISSN={["2052-7276"]}, url={https://doi.org/10.1038/s41438-021-00616-w}, DOI={10.1038/s41438-021-00616-w}, abstractNote={Abstract}, number={1}, journal={HORTICULTURE RESEARCH}, author={Zhao, Fangzhou and Maren, Nathan A. and Kosentka, Pawel Z. and Liao, Ying-Yu and Lu, Hongyan and Duduit, James R. and Huang, Debao and Ashrafi, Hamid and Zhao, Tuanjie and Huerta, Alejandra I and et al.}, year={2021}, month={Dec} }
 @article{lu_luo_wang_liu_li_belwal_xu_li_2021, title={FaMYB9 is involved in the regulation of C6 volatile biosynthesis in strawberry (vol 293, 110422, 2020)}, volume={313}, ISSN={["1873-2259"]}, DOI={10.1016/j.plantsci.2020.110496}, journal={PLANT SCIENCE}, author={Lu, Hongyan and Luo, Zisheng and Wang, Lei and Liu, Wusheng and Li, Dong and Belwal, Tarun and Xu, Yanqun and Li, Li}, year={2021}, month={Dec} }
 @article{yang_lee_poindexter_shao_liu_lenaghan_ahkami_blumwald_stewart_2021, title={Rational design and testing of abiotic stress-inducible synthetic promoters from poplar cis-regulatory elements}, volume={19}, ISSN={["1467-7652"]}, url={https://doi.org/10.1111/pbi.13550}, DOI={10.1111/pbi.13550}, abstractNote={Summary}, number={7}, journal={PLANT BIOTECHNOLOGY JOURNAL}, publisher={Wiley}, author={Yang, Yongil and Lee, Jun Hyung and Poindexter, Magen R. and Shao, Yuanhua and Liu, Wusheng and Lenaghan, Scott C. and Ahkami, Amir H. and Blumwald, Eduardo and Stewart, Charles Neal, Jr.}, year={2021}, month={Jul}, pages={1354–1369} }
 @article{maren_zhao_aryal_touchell_liu_ranney_ashrafi_2021, title={Reproductive developmental transcriptome analysis of Tripidium ravennae (Poaceae)}, volume={22}, ISSN={["1471-2164"]}, DOI={10.1186/s12864-021-07641-y}, abstractNote={Abstract}, number={1}, journal={BMC GENOMICS}, author={Maren, Nathan and Zhao, Fangzhou and Aryal, Rishi and Touchell, Darren and Liu, Wusheng and Ranney, Thomas and Ashrafi, Hamid}, year={2021}, month={Jun} }
 @misc{huang_kosentka_liu_2021, title={Synthetic biology approaches in regulation of targeted gene expression}, volume={63}, ISSN={["1879-0356"]}, url={http://dx.doi.org/10.1016/j.pbi.2021.102036}, DOI={10.1016/j.pbi.2021.102036}, abstractNote={Synthetic biology approaches are highly sought-after to facilitate the regulation of targeted gene expression in plants for functional genomics research and crop trait improvement. To date, synthetic regulation of gene expression predominantly focuses at the transcription level via engineering of synthetic promoters and transcription factors, while pioneering examples have started to emerge for synthetic regulation of gene expression at the levels of mRNA stability, translation, and protein degradation. This review discusses recent advances in plant synthetic biology for the regulation of gene expression at multiple levels, and highlights their future directions.}, journal={CURRENT OPINION IN PLANT BIOLOGY}, publisher={Elsevier BV}, author={Huang, Debao and Kosentka, Pawel Z. and Liu, Wusheng}, year={2021}, month={Oct} }
 @article{synthetic biology approaches in regulation of targeted gene expression_2021, journal={Current Opinion in Plant Biology}, year={2021} }
 @article{lu_luo_wang_liu_li_belwal_xu_li_2020, title={FaMYB9 is involved in the regulation of C6 volatile biosynthesis in strawberry}, volume={293}, ISSN={["0168-9452"]}, DOI={10.1016/j.plantsci.2020.110422}, abstractNote={The large-scale untargeted proteomic and metabolomic studies were conducted in strawberry (Fragaria × ananassa) cv. Akihime fruit at five developmental stages. We found that some C6 volatiles highly contributed to the enrichment of volatiles at the red stage of strawberry fruit. We found that 12 genes involved in LOX pathway for volatile biosynthesis showed multiple patterns in protein abundance during fruit development and ripening, and 9 out of the 12 genes exhibited a significant increase in their relative expression levels at the red stage of fruit. We also found that the MYB9 gene (FaMYB9) expression level was positively correlated with the content of C6 volatiles (R = 0.989) and with the relative expression level and protein abundance of FaLOX5 at different strawberry fruit developmental stages (R = 0.954). The interaction between FaMYB9 and FaLOX5 was detected by yeast two-hybrid, co-immunoprecipitation (Co-IP), bimolecular fluorescence complementation (BiFC), and immunofluorescence (IF) analyses. Transient silencing of FaMYB9 delayed the fruit development and ripening, resulting in a significant decrease in the contents of C6 volatiles, while overexpression of FaMYB9 increased the fruit development and ripening and the contents of C6 volatiles in Akihime fruit. Therefore, FaMYB9 is positively involved in C6 volatile biosynthesis.}, journal={PLANT SCIENCE}, author={Lu, Hongyan and Luo, Zisheng and Wang, Lei and Liu, Wusheng and Li, Dong and Belwal, Tarun and Xu, Yanqun and Li, Li}, year={2020}, month={Apr} }
 @article{liu_rudis_cheplick_millwood_yang_ondzighi-assoume_montgomery_burris_mazarei_chesnut_et al._2020, title={Lipofection-mediated genome editing using DNA-free delivery of the Cas9/gRNA ribonucleoprotein into plant cells}, volume={39}, url={http://dx.doi.org/10.1007/s00299-019-02488-w}, DOI={10.1007/s00299-019-02488-w}, abstractNote={A novel and robust lipofection-mediated transfection approach for the use of DNA-free Cas9/gRNA RNP for gene editing has demonstrated efficacy in plant cells. Precise genome editing has been revolutionized by CRISPR/Cas9 systems. DNA-based delivery of CRISPR/Cas9 is widely used in various plant species. However, protein-based delivery of the in vitro translated Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complex into plant cells is still in its infancy even though protein delivery has several advantages. These advantages include DNA-free delivery, gene-edited host plants that are not transgenic, ease of use, low cost, relative ease to be adapted to high-throughput systems, and low off-target cleavage rates. Here, we show a novel lipofection-mediated transfection approach for protein delivery of the preassembled Cas9/gRNA RNP into plant cells for genome editing. Two lipofection reagents, Lipofectamine 3000 and RNAiMAX, were adapted for successful delivery into plant cells of Cas9/gRNA RNP. A green fluorescent protein (GFP) reporter was fused in-frame with the C-terminus of the Cas9 protein and the fusion protein was successfully delivered into non-transgenic tobacco cv. 'Bright Yellow-2' (BY2) protoplasts. The optimal efficiencies for Lipofectamine 3000- and RNAiMAX-mediated protein delivery were 66% and 48%, respectively. Furthermore, we developed a biolistic method for protein delivery based on the known proteolistics technique. A transgenic tobacco BY2 line expressing an orange fluorescence protein reporter pporRFP was targeted for knockout. We found that the targeted mutagenesis frequency for our Lipofectamine 3000-mediated protein delivery was 6%. Our results showed that the newly developed lipofection-mediated transfection approach is robust for the use of the DNA-free Cas9/gRNA technology for genome editing in plant cells.}, number={2}, journal={Plant Cell Reports}, publisher={Springer Science and Business Media LLC}, author={Liu, Wusheng and Rudis, Mary R. and Cheplick, Matthew H. and Millwood, Reginald J. and Yang, Jian-Ping and Ondzighi-Assoume, Christine A. and Montgomery, Garrett A. and Burris, Kellie P. and Mazarei, Mitra and Chesnut, Jonathan D. and et al.}, year={2020}, month={Feb}, pages={245–257} }
 @article{wang_xie_liu_tao_sun_sun_zhang_2020, title={Transcription factor LkWOX4 is involved in adventitious root development in Larix kaempferi}, volume={758}, ISSN={["1879-0038"]}, url={http://dx.doi.org/10.1016/j.gene.2020.144942}, DOI={10.1016/j.gene.2020.144942}, abstractNote={WUSCHEL-related homeobox4 (WOX4) plays important roles in vascular formation and adventitious root (AR) development. Here, we cloned the WOX4 from the AR of Larix kaempferi, whose cDNA is 1452 bp in length and encodes 483 amino acids. LkWOX4 is mainly expressed in the layer formation area of the stem at 10 days after cutting and its expression levels in the middles and ends of the ARs were higher than that in the AR tips. The fused protein LkWOX4-GFP localized in the nucleus. The heterologous overexpression of LkWOX4 in 84 K poplar significantly increased AR numbers and decreased AR lengths. In LkWOX4 plants, the endogenous jasmonic acid and abscisic acid contents significantly decreased in stems, while the auxin, jasmonic acid and abscisic acid contents significantly increased in ARs. RNA-Seq of those LkWOX4 overexpression poplar plants showed that the expression of plant hormone signaling genes (ARF2, ARF3, ARF7 and ARF18), rooting-related transcription factors (WOX5, LBD29 and SCR) and root development-related genes (CYCD3, GRF1 and TAA1) were affected. Moreover, we found that LkWOX4 interacts with LkPAT18, LkACBP6, and LkCIP7 using yeast two hybrid screening. Thus, we found LkWOX4 involves in the AR initiation and development, which might be regulated through the IAA, JA and ABA signaling pathways.}, journal={GENE}, publisher={Elsevier BV}, author={Wang, Hongming and Xie, Yunhui and Liu, Wusheng and Tao, Guiyun and Sun, Chao and Sun, Xiaomei and Zhang, Shougong}, year={2020}, month={Oct} }
 @article{ondzighi-assoume_willis_ouma_allen_king_parrott_liu_burris_lenaghan_stewart_2019, title={Embryogenic cell suspensions for high-capacity genetic transformation and regeneration of switchgrass (Panicum virgatum L.)}, volume={12}, url={http://dx.doi.org/10.1186/s13068-019-1632-3}, DOI={10.1186/s13068-019-1632-3}, abstractNote={Abstract}, number={1}, journal={Biotechnology for Biofuels}, publisher={Springer Science and Business Media LLC}, author={Ondzighi-Assoume, Christine A. and Willis, Jonathan D. and Ouma, Wilson K. and Allen, Sara M. and King, Zachary and Parrott, Wayne A. and Liu, Wusheng and Burris, Jason N. and Lenaghan, Scott C. and Stewart, C. Neal}, year={2019}, month={Dec} }
 @article{transcription coactivator angustifolia3 (an3) regulates leafy head formation in chinese cabbage_2019, url={http://dx.doi.org/10.3389/fpls.2019.00520}, DOI={10.3389/fpls.2019.00520}, abstractNote={Leafy head formation in Chinese cabbage (B. rapa ssp. pekinensis cv. Bre) results from leaf curvature, which is under the tight control of genes involved in the adaxial-abaxial patterning during leaf development. The transcriptional coactivator ANGUSTIFOLIA3 (AN3) binds to the SWI/SNF chromatin remodeling complexes formed around ATPases such as BRAHMA (BRM) in order to regulate transcription in various aspects of leaf development such as cell proliferation, leaf primordia expansion, and leaf adaxial/abaxial patterning in Arabidopsis. However, its regulatory function in Chinese cabbage remains poorly understood. Here, we analyzed the expression patterns of the Chinese cabbage AN3 gene (BrAN3) before and after leafy head formation, and produced BrAN3 gene silencing plants by using the turnip yellow mosaic virus (TYMV)-derived vector in order to explore its potential function in leafy head formation in Chinese cabbage. We found that BrAN3 had distinct expression patterns in the leaves of Chinese cabbage at the rosette and heading stages. We also found silencing of BrAN3 stimulated leafy head formation at the early stage. Transcriptome analysis indicated that silencing of BrAN3 modulated the hormone signaling pathways of auxin, ethylene, GA, JA, ABA, BR, CK, and SA in Chinese cabbage. Our study offers unique insights into the function of BrAN3 in leafy head formation in Chinese cabbage.}, journal={Frontiers in Plant Science}, year={2019}, month={Apr} }
 @article{xu_liu_ye_mazarei_huang_zhang_stewart_2018, title={A profilin gene promoter from switchgrass (Panicum virgatum L.) directs strong and specific transgene expression to vascular bundles in rice}, volume={37}, ISSN={["1432-203X"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85040614740&partnerID=MN8TOARS}, DOI={10.1007/s00299-018-2253-1}, abstractNote={A switchgrass vascular tissue-specific promoter (PvPfn2) and its 5'-end serial deletions drive high levels of vascular bundle transgene expression in transgenic rice. Constitutive promoters are widely used for crop genetic engineering, which can result in multiple off-target effects, including suboptimal growth and epigenetic gene silencing. These problems can be potentially avoided using tissue-specific promoters for targeted transgene expression. One particularly urgent need for targeted cell wall modification in bioenergy crops, such as switchgrass (Panicum virgatum L.), is the development of vasculature-active promoters to express cell wall-affective genes only in the specific tissues, i.e., xylem and phloem. From a switchgrass expression atlas we identified promoter sequence upstream of a vasculature-specific switchgrass profilin gene (PvPfn2), especially in roots, nodes and inflorescences. When the putative full-length (1715 bp) and 5'-end serial deletions of the PvPfn2 promoter (shortest was 413 bp) were used to drive the GUS reporter expression in stably transformed rice (Oryza sativa L.), strong vasculature-specificity was observed in various tissues including leaves, leaf sheaths, stems, and flowers. The promoters were active in both phloem and xylem. It is interesting to note that the promoter was active in many more tissues in the heterologous rice system than in switchgrass. Surprisingly, all four 5'-end promoter deletions, including the shortest fragment, had the same expression patterns as the full-length promoter and with no attenuation in GUS expression in rice. These results indicated that the PvPfn2 promoter variants are new tools to direct transgene expression specifically to vascular tissues in monocots. Of special interest is the very compact version of the promoter, which could be of use for vasculature-specific genetic engineering in monocots.}, number={4}, journal={PLANT CELL REPORTS}, author={Xu, Wenzhi and Liu, Wusheng and Ye, Rongjian and Mazarei, Mitra and Huang, Debao and Zhang, Xinquan and Stewart, C. Neal, Jr.}, year={2018}, month={Apr}, pages={587–597} }
 @article{liu_mazarei_ye_peng_shao_baxter_sykes_turner_davis_wang_et al._2018, title={Switchgrass (Panicum virgatum L.) promoters for green tissue-specific expression of the MYB4 transcription factor for reduced-recalcitrance transgenic switchgrass}, volume={11}, ISSN={["1754-6834"]}, url={http://dx.doi.org/10.1186/s13068-018-1119-7}, DOI={10.1186/s13068-018-1119-7}, abstractNote={Genetic engineering of switchgrass (Panicum virgatum L.) for reduced cell wall recalcitrance and improved biofuel production has been a long pursued goal. Up to now, constitutive promoters have been used to direct the expression of cell wall biosynthesis genes toward attaining that goal. While generally sufficient to gauge a transgene’s effects in the heterologous host, constitutive overexpression often leads to undesirable plant phenotypic effects. Green tissue-specific promoters from switchgrass are potentially valuable to directly alter cell wall traits exclusively in harvestable aboveground biomass while not changing root phenotypes. We identified and functionally characterized three switchgrass green tissue-specific promoters and assessed marker gene expression patterns and intensity in stably transformed rice (Oryza sativa L.), and then used them to direct the expression of the switchgrass MYB4 (PvMYB4) transcription factor gene in transgenic switchgrass to endow reduced recalcitrance in aboveground biomass. These promoters correspond to photosynthesis-related light-harvesting complex II chlorophyll-a/b binding gene (PvLhcb), phosphoenolpyruvate carboxylase (PvPEPC), and the photosystem II 10 kDa R subunit (PvPsbR). Real-time RT-PCR analysis detected their strong expression in the aboveground tissues including leaf blades, leaf sheaths, internodes, inflorescences, and nodes of switchgrass, which was tightly up-regulated by light. Stable transgenic rice expressing the GUS reporter under the control of each promoter (756–2005 bp in length) further confirmed their strong expression patterns in leaves and stems. With the exception of the serial promoter deletions of PvLhcb, all GUS marker patterns under the control of each 5′-end serial promoter deletion were not different from that conveyed by their respective promoters. All of the shortest promoter fragments (199–275 bp in length) conveyed strong green tissue-specific GUS expression in transgenic rice. PvMYB4 is a master repressor of lignin biosynthesis. The green tissue-specific expression of PvMYB4 via each promoter in transgenic switchgrass led to significant gains in saccharification efficiency, decreased lignin, and decreased S/G lignin ratios. In contrast to constitutive overexpression of PvMYB4, which negatively impacts switchgrass root growth, plant growth was not compromised in green tissue-expressed PvMYB4 switchgrass plants in the current study. Each of the newly described green tissue-specific promoters from switchgrass has utility to change cell wall biosynthesis exclusively in aboveground harvestable biomass without altering root systems. The truncated green tissue promoters are very short and should be useful for targeted expression in a number of monocots to improve shoot traits while restricting gene expression from roots. Green tissue-specific expression of PvMYB4 is an effective strategy for improvement of transgenic feedstocks.}, journal={BIOTECHNOLOGY FOR BIOFUELS}, author={Liu, Wusheng and Mazarei, Mitra and Ye, Rongjian and Peng, Yanhui and Shao, Yuanhua and Baxter, Holly L. and Sykes, Robert W. and Turner, Geoffrey B. and Davis, Mark F. and Wang, Zeng-Yu and et al.}, year={2018}, month={Apr} }
 @article{stewart_liu_2017, title={Synthetic promoters for precise control of gene expression in plants}, volume={113}, journal={Chemical Engineering Progress}, author={Stewart, C.N., Jr. and Liu, W.}, year={2017}, pages={36–39} }
 @article{ye_huang_alexander_liu_millwood_wang_stewart_2016, title={Field Studies on Dynamic Pollen Production, Deposition, and Dispersion of Glyphosate-Resistant Horseweed (Conyza canadensis)}, volume={64}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84954567920&partnerID=MN8TOARS}, DOI={10.1614/WS-D-15-00073.1}, abstractNote={Glyphosate-resistant (GR) horseweed has become an especially problematic weed in different crop production systems across the United States and the world. In this field study, we used a nondestructive measurement system to analyze the pollen production, deposition, and dispersion of a Tennessee glyphosate resistant (TNR) horseweed biotype in Knoxville, TN during the 2013 pollination season. We observed that the pollination season of TNR horseweed lasted about 2 mo (54 d). About 78.93% of horseweed pollen was released between 9:00 A.M. and 7:00 P.M. during each sampling day and the release peak was at about 1:30 P.M. The seasonal release of pollen grains was estimated to be 5.11 million grains plant−1. The release rate data indicated that the integrated horizontal flux density and deposition flux density contributed to 78.17% and 21.83% of the release rate, respectively. We also found that pollen concentration decreased with distance from the source field; the average pollen concentration decreased to 50.69% at a distance of 16 m from the source plot. This is the first result of a systematic, direct examination of the release rate (emission and deposition), release pattern (daily and seasonal), and dispersion pattern of GR horseweed pollen.}, number={1}, journal={Weed Science}, author={Ye, R. and Huang, H. and Alexander, J. and Liu, W. and Millwood, R.J. and Wang, J. and Stewart, C.N.}, year={2016}, pages={101–111} }
 @article{liu_stewart_2016, title={Plant synthetic promoters and transcription factors}, volume={37}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84945358935&partnerID=MN8TOARS}, DOI={10.1016/j.copbio.2015.10.001}, abstractNote={Synthetic promoters and transcription factors (TFs) have become incredibly powerful and efficient components for precise regulation of targeted plant transgene expression. Synthetic promoters can be rationally designed and constructed using specific type, copy number and spacing of motifs placed upstream of synthetic or native core promoters. Similarly, synthetic TFs can be constructed using a variety of DNA binding domains (DBDs) and effector domains. Synthetic promoters and TFs can provide tremendous advantages over their natural counterparts with regards to transgene expression strength and specificity. They will probably be needed for coordinated transgene expression for metabolic engineering and synthetic circuit applications in plants for bioenergy and advanced crop engineering. In this article we review the recent advances in synthetic promoters and TFs in plants and speculate on their future.}, journal={Current Opinion in Biotechnology}, author={Liu, W. and Stewart, C.N.}, year={2016}, pages={36–44} }
 @inbook{liu_stewart_2016, place={New Jersey, USA}, edition={2nd edition}, title={Plant systems biology}, booktitle={Plant Biotechnology and Genetics: Principles, Techniques and Applications}, publisher={Wiley and Sons}, author={Liu, W. and Stewart, C.N., Jr}, editor={Stewart, C.N., JrEditor}, year={2016} }
 @inbook{liu_miki_stewart_2016, place={New Jersey, USA}, edition={2nd edition}, title={Promoters and Marker genes}, booktitle={Plant Biotechnology and Genetics: Principles, Techniques and Applications}, publisher={Wiley and Sons}, author={Liu, W. and Miki, B. and Stewart, C.N., Jr}, editor={Stewart, C.N., JrEditor}, year={2016} }
 @inbook{liu_stewart_2016, place={New Jersey, USA}, edition={2nd edition}, title={The Future: advanced plant biotechnology, genome editing and synthetic biology}, booktitle={Plant Biotechnology and Genetics: Principles, Techniques and Applications}, publisher={Wiley and Sons}, author={Liu, W. and Stewart, C.N., Jr}, editor={Stewart, C.N., JrEditor}, year={2016} }
 @article{liu_stewart_2015, title={Plant synthetic biology}, volume={20}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84928828879&partnerID=MN8TOARS}, DOI={10.1016/j.tplants.2015.02.004}, abstractNote={•Plant synthetic biology is an emerging field of advanced genetic engineering driven by engineering principles. •Enabling tools include those for designing components and their assembly and deployment. •Pioneering examples are synthetic sensors, metabolic pathways, and plastids. Plant synthetic biology is an emerging field that combines engineering principles with plant biology toward the design and production of new devices. This emerging field should play an important role in future agriculture for traditional crop improvement, but also in enabling novel bioproduction in plants. In this review we discuss the design cycles of synthetic biology as well as key engineering principles, genetic parts, and computational tools that can be utilized in plant synthetic biology. Some pioneering examples are offered as a demonstration of how synthetic biology can be used to modify plants for specific purposes. These include synthetic sensors, synthetic metabolic pathways, and synthetic genomes. We also speculate about the future of synthetic biology of plants. Plant synthetic biology is an emerging field that combines engineering principles with plant biology toward the design and production of new devices. This emerging field should play an important role in future agriculture for traditional crop improvement, but also in enabling novel bioproduction in plants. In this review we discuss the design cycles of synthetic biology as well as key engineering principles, genetic parts, and computational tools that can be utilized in plant synthetic biology. Some pioneering examples are offered as a demonstration of how synthetic biology can be used to modify plants for specific purposes. These include synthetic sensors, synthetic metabolic pathways, and synthetic genomes. We also speculate about the future of synthetic biology of plants. the identification and establishment of hierarchies of functional units for the design process. an individual element/entity occurring in the composition of a biological object and contributing to its function. the imitation of the structures and functions of systems and elements of nature for the purpose of solving complex problems. the host organisms implemented with synthetic devices or gene networks. a functional unit rationally designed and assembled with synthetic parts for specific logical functions inside a cell or chassis. a biological device comprising heterogeneous parts. the breakdown of any object into simpler parts. the breaking down of complicated entities (systems, functions, or problems) into manageable, independent, and simpler constituents. functions arranged at different levels. functional independence of biological parts and devices. functionally equivalent and context-free properties of biological parts. an overlapping set of patent rights used to defend against competitors designing around a licensed patent. standard DNA sequences (such as promoters, coding sequences, and terminators) used as Lego-like building blocks for the design and assembly of synthetic biological devices in plants. a regulatory segment of a mRNA molecule that binds to its effectors, resulting in changes in its own activity. the definitive description and characterization of functionally equivalent and interchangeable (i.e., orthogonal) biological parts as well as the standardized conditions for construction and testing. information coming from different hierarchical levels.}, number={5}, journal={Trends in Plant Science}, author={Liu, W. and Stewart, C.N.}, year={2015}, pages={309–317} }
 @article{liu_mazarei_peng_fethe_rudis_lin_millwood_arelli_stewart_2014, title={Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode-inducible synthetic promoters}, volume={12}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84925969416&partnerID=MN8TOARS}, DOI={10.1111/pbi.12206}, abstractNote={Summary}, number={8}, journal={Plant Biotechnology Journal}, author={Liu, W. and Mazarei, M. and Peng, Y. and Fethe, M.H. and Rudis, M.R. and Lin, J. and Millwood, R.J. and Arelli, P.R. and Stewart, C.N.}, year={2014}, pages={1015–1026} }
 @article{liu_rudis_peng_mazarei_millwood_yang_xu_chesnut_stewart_2014, title={Synthetic TAL effectors for targeted enhancement of transgene expression in plants}, volume={12}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84899063623&partnerID=MN8TOARS}, DOI={10.1111/pbi.12150}, abstractNote={Summary}, number={4}, journal={Plant Biotechnology Journal}, author={Liu, W. and Rudis, M.R. and Peng, Y. and Mazarei, M. and Millwood, R.J. and Yang, J.-P. and Xu, W. and Chesnut, J.D. and Stewart, C.N.}, year={2014}, pages={436–446} }
 @article{fethe_liu_burris_millwood_mazarei_rudis_yeaman_dubosquielle_stewart_2014, title={The performance of pathogenic bacterial phytosensing transgenic tobacco in the field}, volume={12}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84904763653&partnerID=MN8TOARS}, DOI={10.1111/pbi.12180}, abstractNote={Summary}, number={6}, journal={Plant Biotechnology Journal}, author={Fethe, M.H. and Liu, W. and Burris, J.N. and Millwood, R.J. and Mazarei, M. and Rudis, M.R. and Yeaman, D.G. and Dubosquielle, M. and Stewart, C.N.}, year={2014}, pages={755–764} }
 @article{advanced genetic tools for plant biotechnology_2013, volume={14}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84886092842&partnerID=MN8TOARS}, DOI={10.1038/nrg3583}, abstractNote={Basic research has provided a much better understanding of the genetic networks and regulatory hierarchies in plants. To meet the challenges of agriculture, we must be able to rapidly translate this knowledge into generating improved plants. Therefore, in this Review, we discuss advanced tools that are currently available for use in plant biotechnology to produce new products in plants and to generate plants with new functions. These tools include synthetic promoters, 'tunable' transcription factors, genome-editing tools and site-specific recombinases. We also review some tools with the potential to enable crop improvement, such as methods for the assembly and synthesis of large DNA molecules, plant transformation with linked multigenes and plant artificial chromosomes. These genetic technologies should be integrated to realize their potential for applications to pressing agricultural and environmental problems.}, number={11}, journal={Nature Reviews Genetics}, year={2013}, pages={781–793} }
 @article{liu_mazarei_rudis_fethe_peng_millwood_schoene_burris_stewart_2013, title={Bacterial pathogen phytosensing in transgenic tobacco and Arabidopsis plants}, volume={11}, ISSN={1467-7644 1467-7652}, url={http://dx.doi.org/10.1111/pbi.12005}, DOI={10.1111/pbi.12005}, abstractNote={Summary}, number={1}, journal={Plant Biotechnology Journal}, publisher={Wiley}, author={Liu, Wusheng and Mazarei, Mitra and Rudis, Mary R. and Fethe, Michael H. and Peng, Yanhui and Millwood, Reginald J. and Schoene, Gisele and Burris, Jason N. and Stewart, C. Neal, Jr}, year={2013}, pages={43–52} }
 @article{lin_mazarei_zhao_zhu_zhuang_liu_pantalone_arelli_stewart_chen_2013, title={Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode}, volume={11}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84888136842&partnerID=MN8TOARS}, DOI={10.1111/pbi.12108}, abstractNote={Summary}, number={9}, journal={Plant Biotechnology Journal}, author={Lin, J. and Mazarei, M. and Zhao, N. and Zhu, J.J. and Zhuang, X. and Liu, W. and Pantalone, V.R. and Arelli, P.R. and Stewart, C.N. and Chen, F.}, year={2013}, pages={1135–1145} }
 @article{gene expression profiling of resistant and susceptible soybean lines infected with soybean cyst nematode_2011, volume={123}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-80855123881&partnerID=MN8TOARS}, DOI={10.1007/s00122-011-1659-8}, abstractNote={Soybean cyst nematode (SCN) is the most devastating pathogen of soybean. Information about the molecular basis of soybean-SCN interactions is needed to assist future development of effective management tools against this pathogen. Toward this end, soybean transcript abundance was measured using the Affymetrix Soybean Genome Array in a susceptible and a resistant reaction of soybean to SCN infection. Two genetically related soybean sister lines TN02-226 and TN02-275, which are resistant and susceptible, respectively, to the SCN race 2 infection were utilized in these experiments. Pairwise comparisons followed by false discovery rate analysis indicated that the expression levels of 162 transcripts changed significantly in the resistant line, of which 84 increased while 78 decreased. However, in the susceptible line, 1,694 transcripts changed significantly, of which 674 increased while 1,020 decreased. Comparative analyses of these transcripts indicated that a total of 51 transcripts were in common between resistance and susceptible responses. In this set, 42 transcripts increased in the resistant line, but decreased in the susceptible line. Quantitative real-time reverse-transcription polymerase chain reaction confirmed the results of microarray analysis. Of the transcripts to which a function could be assigned, genes were associated with metabolism, cell wall modification, signal transduction, transcription, and defense. Microarray analyses examining two genetically related soybean lines against the same SCN population provided additional insights into the specific changes in gene expression of a susceptible and a resistant reaction beneficial for identification of genes involved in defense.}, number={7}, journal={Theoretical and Applied Genetics}, year={2011}, pages={1193–1206} }
 @article{rapid in vivo analysis of synthetic promoters for plant pathogen phytosensing_2011, volume={11}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-81155127545&partnerID=MN8TOARS}, DOI={10.1186/1472-6750-11-108}, abstractNote={Abstract}, journal={BMC Biotechnology}, year={2011} }
 @article{mann_king_liu_joyce_percifield_hawkins_lafayette_artelt_burris_mazarei_et al._2011, title={Switchgrass (Panicum virgatum L.) polyubiquitin gene (PvUbi1 and PvUbi2) promoters for use in plant transformation}, volume={11}, ISSN={1472-6750}, url={http://dx.doi.org/10.1186/1472-6750-11-74}, DOI={10.1186/1472-6750-11-74}, abstractNote={The ubiquitin protein is present in all eukaryotic cells and promoters from ubiquitin genes are good candidates to regulate the constitutive expression of transgenes in plants. Therefore, two switchgrass (Panicum virgatum L.) ubiquitin genes (PvUbi1 and PvUbi2) were cloned and characterized. Reporter constructs were produced containing the isolated 5' upstream regulatory regions of the coding sequences (i.e. PvUbi1 and PvUbi2 promoters) fused to the uidA coding region (GUS) and tested for transient and stable expression in a variety of plant species and tissues. PvUbi1 consists of 607 bp containing cis-acting regulatory elements, a 5' untranslated region (UTR) containing a 93 bp non-coding exon and a 1291 bp intron, and a 918 bp open reading frame (ORF) that encodes four tandem, head -to-tail ubiquitin monomer repeats followed by a 191 bp 3' UTR. PvUbi2 consists of 692 bp containing cis-acting regulatory elements, a 5' UTR containing a 97 bp non-coding exon and a 1072 bp intron, a 1146 bp ORF that encodes five tandem ubiquitin monomer repeats and a 183 bp 3' UTR. PvUbi1 and PvUbi2 were expressed in all examined switchgrass tissues as measured by qRT-PCR. Using biolistic bombardment, PvUbi1 and PvUbi2 promoters showed strong expression in switchgrass and rice callus, equaling or surpassing the expression levels of the CaMV 35S, 2x35S, ZmUbi1, and OsAct1 promoters. GUS staining following stable transformation in rice demonstrated that the PvUbi1 and PvUbi2 promoters drove expression in all examined tissues. When stably transformed into tobacco (Nicotiana tabacum), the PvUbi2+3 and PvUbi2+9 promoter fusion variants showed expression in vascular and reproductive tissues. The PvUbi1 and PvUbi2 promoters drive expression in switchgrass, rice and tobacco and are strong constitutive promoter candidates that will be useful in genetic transformation of monocots and dicots.}, number={1}, journal={BMC Biotechnology}, publisher={Springer Nature}, author={Mann, David GJ and King, Zachary R and Liu, Wusheng and Joyce, Blake L and Percifield, Ryan J and Hawkins, Jennifer S and LaFayette, Peter R and Artelt, Barbara J and Burris, Jason N and Mazarei, Mitra and et al.}, year={2011}, month={Jul} }
 @article{karve_liu_willet_torii_shpak_2011, title={The presence of multiple introns is essential for ERECTA expression in Arabidopsis}, volume={17}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-80053176443&partnerID=MN8TOARS}, DOI={10.1261/rna.2825811}, abstractNote={Gene expression in eukaryotes is often enhanced by the presence of introns. Depending on the specific gene, this enhancement can be minor or very large and occurs at both the transcriptional and post-transcriptional levels. The Arabidopsis ERECTA gene contains 27 exons encoding a receptor-like kinase that promotes cell proliferation and inhibits cell differentiation in above-ground plant organs. The expression of ERECTA very strongly depends on the presence of introns. The intronless ERECTA gene does not rescue the phenotype of erecta mutant plants and produces about 500–900 times less protein compared with the identical construct containing introns. This result is somewhat surprising as the region upstream of the ERECTA coding sequence effectively promotes the expression of extraneous genes. Here, we demonstrate that introns are essential for ERECTA mRNA accumulation and, to a lesser extent, for mRNA utilization in translation. Since mRNA produced by intronless ERECTA is degraded at the 3′ end, we speculate that introns increase mRNA accumulation through increasing its stability at least in part. No individual intron is absolutely necessary for ERECTA expression, but rather multiple introns in specific locations increase ERECTA expression in an additive manner. The ability of introns to promote ERECTA expression might be linked to the process of splicing and not to a particular intron sequence.}, number={10}, journal={RNA}, author={Karve, R. and Liu, W. and Willet, S.G. and Torii, K.U. and Shpak, E.D.}, year={2011}, pages={1907–1921} }
 @article{shaw_lickey_beck_farmer_liu_miller_siripun_winder_schilling_small_2005, title={The tortoise and the hare II: Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis}, volume={92}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-19944430021&partnerID=MN8TOARS}, DOI={10.3732/ajb.92.1.142}, abstractNote={Chloroplast DNA sequences are a primary source of data for plant molecular systematic studies. A few key papers have provided the molecular systematics community with universal primer pairs for noncoding regions that have dominated the field, namely trnL‐trnF and trnK/matK. These two regions have provided adequate information to resolve species relationships in some taxa, but often provide little resolution at low taxonomic levels. To obtain better phylogenetic resolution, sequence data from these regions are often coupled with other sequence data. Choosing an appropriate cpDNA region for phylogenetic investigation is difficult because of the scarcity of information about the tempo of evolutionary rates among different noncoding cpDNA regions. The focus of this investigation was to determine whether there is any predictable rate heterogeneity among 21 noncoding cpDNA regions identified as phylogenetically useful at low levels. To test for rate heterogeneity among the different cpDNA regions, we used three species from each of 10 groups representing eight major phylogenetic lineages of phanerogams. The results of this study clearly show that a survey using as few as three representative taxa can be predictive of the amount of phylogenetic information offered by a cpDNA region and that rate heterogeneity exists among noncoding cpDNA regions.}, number={1}, journal={American Journal of Botany}, author={Shaw, J. and Lickey, E.B. and Beck, J.T. and Farmer, S.B. and Liu, W. and Miller, J. and Siripun, K.C. and Winder, C.T. and Schilling, E.E. and Small, R.L.}, year={2005}, pages={142–166} }
 @article{lihuan_ling_quanshe_wusheng_1999, title={Wild fruit resources and exploitation in Xiaoxing’an Mountains}, volume={10}, ISSN={1007-662X 1993-0607}, url={http://dx.doi.org/10.1007/bf02855475}, DOI={10.1007/bf02855475}, number={1}, journal={Journal of Forestry Research}, publisher={Springer Science and Business Media LLC}, author={Lihuan, Zhuo and Ling, Wang and Quanshe, Chen and Wusheng, Liu}, year={1999}, month={Mar}, pages={31–33} }
 @article{li_zhang_wang_liu_1998, title={Investigation on the Medical Plant Resources of Beizhang Experimental Area in the Upper Reaches of Miyun Reservoir}, volume={2}, journal={Quarterly of Forest By-Product And Speciality in China}, author={Li, G. and Zhang, Y. and Wang, J. and Liu, W.}, year={1998}, pages={45–46} }
 @article{zhang_wang_liu_li_li_1997, title={The preliminary study on the vegetation qualities of Beizhuang experimental area in the upper reaches of Miyun reservoir}, volume={19}, journal={Journal of Beijing Forestry University}, author={Zhang, Y. and Wang, J. and Liu, W. and Li, G. and Li, F.}, year={1997}, pages={39–44} }
 @inbook{zhuo_yang_liu_1994, place={Harbin, P.R. China}, title={Early spring wild herbal flower resources and its utilization in urban landscaping in Heilongjiang Province}, booktitle={New Studies on Forest Management and Forest Resource Exploitation in Northeast China-Zhong Guo Dong Bei Lin Qu (1990-1994)}, publisher={Heilongjiang Science & Technology Press}, author={Zhuo, L. and Yang, W. and Liu, W.}, editor={Yang, Cui Xiao and Wen, Wang QingEditors}, year={1994}, pages={286–290} }
 @inbook{zhuo_liu_yang_1994, place={Harbin, P.R. China}, title={Investigation and utilization of the wild fruit resources in Xiaoxing’an Mountains}, booktitle={New Studies on Forest Management and Forest Resource Exploitation in Northeast China-Zhong Guo Dong Bei Lin Qu (1990-1994)}, publisher={Heilongjiang Science & Technology Press}, author={Zhuo, L. and Liu, W. and Yang, W.}, editor={Yang, Cui Xiano and Wen, Wang QingEditors}, year={1994}, pages={266–270} }