@article{wang_zheng_wang_liu_li_xiao_liu_hou_2024, title={BcWRKY25-BcWRKY33A-BcLRP1/BcCOW1 module promotes root development for improved salt tolerance in Bok choy}, url={https://doi.org/10.1093/hr/uhae280}, DOI={10.1093/hr/uhae280}, abstractNote={Abstract Root development is a complex process involving phytohormones and transcription factors. Our previous research has demonstrated that BcWRKY33A is significantly expressed in Bok Choy roots under salt stress, and heterologous expression of BcWRKY33A increases salt tolerance and promotes root development in transgenic Arabidopsis. However, the precise molecular mechanisms by which BcWRKY33A governs root development remain elusive. Here, we investigated the role of BcWRKY33A in both root elongation and root hair formation in transgenic Bok choy roots. Our data indicated that overexpression of BcWRKY33A stimulated root growth and stabilized root hair morphology, while silencing BcWRKY33A prevented primary root elongation and resulted in abnormal root hairs morphology. Meanwhile, our research uncovered that BcWRKY33A directly binds to the promoters of BcLRP1 and BcCOW1, leading to an upregulation of their expression. In transgenic Bok choy roots, increased BcLRP1 and BcCOW1 transcript levels improved primary root elongation and root hair formation, respectively. Additionally, we pinpointed BcWRKY25 as a NaCl-responsive gene that directly stimulates the expression of BcWRKY33A in response to salt stress. All results shed light on the regulatory mechanisms governing root development by BcWRKY25-BcWRKY33A-BcLRP1/BcCOW1 module and propose potential strategies for improving salt tolerance in Bok choy.}, journal={Horticulture Research}, author={Wang, Huiyu and Zheng, Yushan and Wang, Meiyun and Liu, Wusheng and Li, Ying and Xiao, Dong and Liu, Tongkun and Hou, Xilin}, year={2024}, month={Sep} }
 @inbook{huang_livengood_yencho_liu_2025, title={Opportunities for Gene Editing of Sweetpotato}, url={https://doi.org/10.1007/978-3-031-65003-1_10}, DOI={10.1007/978-3-031-65003-1_10}, abstractNote={Abstract Sweetpotato plays significant roles in the food supply worldwide. Conventional sweetpotato breeding methods face challenges such as self- and cross-incompatibility and high heterogeneity. Gene editing is an effective and powerful tool for modifying agronomic traits, offering a novel approach to develop cultivars by targeting specific genes for precise modifications. The transformed CRISPR/Cas can be segregated out from the gene-edited end product of sexually propagated crops but not in sweetpotato as sweetpotato is highly heterogeneous and has to be propagated clonally. Thus, innovative sweetpotato breeding methods need to be further developed to improve breeding efficacy and decrease breeding cycle. In the present book chapter, we reviewed the methods used for sweetpotato breeding, the success of gene editing in sweetpotato, and the challenges and constraints and the future perspectives of sweetpotato gene editing.}, author={Huang, Debao and Livengood, Chase and Yencho, G. Craig and Liu, Wusheng}, year={2025} }
 @article{chen_liu_guo_hao_pan_zhang_liu_zhao_luo_he_et al._2023, title={Differential SW16.1 allelic effects and genetic backgrounds contributed to increased seed weight after soybean domestication}, volume={5}, ISSN={["1744-7909"]}, DOI={10.1111/jipb.13480}, abstractNote={ABSTRACTAlthough seed weight has increased following domestication from wild soybean (Glycine soja) to cultivated soybean (Glycine max), the genetic basis underlying this change is unclear. Using mapping populations derived from chromosome segment substitution lines of wild soybean, we identified SW16.1 as the causative gene underlying a major quantitative trait locus controlling seed weight. SW16.1 encodes a nucleus‐localized LIM domain‐containing protein. Importantly, the GsSW16.1 allele from wild soybean accession N24852 had a negative effect on seed weight, whereas the GmSW16.1 allele from cultivar NN1138‐2 had a positive effect. Gene expression network analysis, reverse‐transcription quantitative polymerase chain reaction, and promoter‐luciferase reporter transient expression assays suggested that SW16.1 regulates the transcription of MT4, a positive regulator of seed weight. The natural variations in SW16.1 and other known seed weight genes were analyzed in soybean germplasm. The SW16.1 polymorphism was associated with seed weight in 247 soybean accessions, showing much higher frequency of positive‐effect alleles in cultivated soybean than in wild soybean. Interestingly, gene allele matrix analysis of the known seed weight genes revealed that G. max has lost 38.5% of the G. soja alleles and that most of the lost alleles had negative effects on seed weight. Our results suggest that eliminating negative alleles from G. soja led to a higher frequency of positive alleles and changed genetic backgrounds in G. max, which contributed to larger seeds in cultivated soybean after domestication from wild soybean. Our findings provide new insights regarding soybean domestication and should assist current soybean breeding programs.}, journal={JOURNAL OF INTEGRATIVE PLANT BIOLOGY}, author={Chen, Xianlian and Liu, Cheng and Guo, Pengfei and Hao, Xiaoshuai and Pan, Yongpeng and Zhang, Kai and Liu, Wusheng and Zhao, Lizhi and Luo, Wei and He, Jianbo and et al.}, year={2023}, month={May} }
 @article{brooks_elorriaga_liu_duduit_yuan_tsai_tuskan_ranney_yang_liu_2023, title={Plant Promoters and Terminators for High-Precision Bioengineering}, url={https://doi.org/10.34133/bdr.0013}, DOI={10.34133/bdr.0013}, abstractNote={High-precision bioengineering and synthetic biology require fine-tuning gene expression at both transcriptional and posttranscriptional levels. Gene transcription is tightly regulated by promoters and terminators. Promoters determine the timing, tissues and cells, and levels of the expression of genes. Terminators mediate transcription termination of genes and affect mRNA levels posttranscriptionally, e.g., the 3′-end processing, stability, translation efficiency, and nuclear to cytoplasmic export of mRNAs. The promoter and terminator combination affects gene expression. In the present article, we review the function and features of plant core promoters, proximal and distal promoters, and terminators, and their effects on and benchmarking strategies for regulating gene expression.}, journal={BioDesign Research}, author={Brooks, Emily G. and Elorriaga, Estefania and Liu, Yang and Duduit, James R. and Yuan, Guoliang and Tsai, Chung-Jui and Tuskan, Gerald A. and Ranney, Thomas G. and Yang, Xiaohan and Liu, Wusheng}, year={2023}, month={Jan} }
 @article{zhang_zhou_liu_wu_li_xu_li_imaizumi_hou_liu_2022, title={BrABF3 promotes flowering through the direct activation of CONSTANS transcription in pak choi}, volume={5}, ISSN={["1365-313X"]}, url={https://doi.org/10.1111/tpj.15783}, DOI={10.1111/tpj.15783}, abstractNote={SUMMARYDrought stress triggers the accumulation of the phytohormone abscisic acid (ABA), which in turn activates the expression of the floral integrator gene CONSTANS (CO), accelerating flowering. However, the molecular mechanism of ABA‐induced CO activation remains elusive. Here, we conducted a yeast one‐hybrid assay using the CO promoter from Brassica campestris (syn. Brassica rapa) ssp. chinensis (pak choi) to screen the ABA‐induced pak choi library and identified the transcription activator ABF3 (BrABF3). BrABF3, the expression of which was induced by ABA in pak choi, directly bound to the CO promoter from both pak choi and Arabidopsis. The BrABF3 promoter is specifically active in the Arabidopsis leaf vascular tissue, where CO is mainly expressed. Impaired BrABF3 expression in pak choi decreased BrCO expression levels and delayed flowering, whereas ectopic expression of BrABF3 in Arabidopsis increased CO expression and induced earlier flowering under the long‐day conditions. Electrophoretic mobility shift assay analysis showed that BrABF3 was enriched at the canonical ABA‐responsive element–ABRE binding factor (ABRE–ABF) binding motifs of the BrCO promoter. The direct binding of BrABF3 to the ABRE elements of CO was further confirmed by chromatin immunoprecipitation quantitative PCR. In addition, the induction of BrCO transcription by BrABF3 could be repressed by BrCDF1 in the morning. Thus, our results suggest that ABA could accelerate the floral transition by directly activating BrCO transcription through BrABF3 in pak choi.}, journal={PLANT JOURNAL}, publisher={Wiley}, author={Zhang, Changwei and Zhou, Qian and Liu, Wusheng and Wu, Xiaoting and Li, Zhubo and Xu, Yuanyuan and Li, Ying and Imaizumi, Takato and Hou, Xilin and Liu, Tongkun}, year={2022}, month={May} }
 @article{duduit_kosentka_miller_blanco-ulate_lenucci_panthee_perkins-veazie_liu_2022, title={Coordinated transcriptional regulation of the carotenoid biosynthesis contributes to fruit lycopene content in high-lycopene tomato genotypes}, volume={9}, ISSN={2052-7276}, url={http://dx.doi.org/10.1093/hr/uhac084}, DOI={10.1093/hr/uhac084}, abstractNote={Abstract
               Lycopene content in tomato fruit is largely under genetic control and varies greatly among genotypes. Continued improvement of lycopene content in elite varieties with conventional breeding has become challenging, in part because little is known about the underlying molecular mechanisms in high-lycopene tomatoes (HLYs). We collected 42 HLYs with different genetic backgrounds worldwide. High-performance liquid chromatography (HPLC) analysis revealed lycopene contents differed among the positive control wild tomato Solanum pimpinellifolium, HLYs, the normal lycopene cultivar “Moneymaker”, and the non-lycopene cultivar NC 1Y at the pink and red ripe stages. Real-time RT-PCR analysis of expression of the 25 carotenoid biosynthesis pathway genes of each genotype showed a significantly higher expression in nine upstream genes (GGPPS1, GGPPS2, GGPPS3, TPT1, SSU II, PSY2, ZDS, CrtISO and CrtISO-L1 but not the well-studied PSY1, PDS and Z-ISO) at the breaker and/or red ripe stages in HLYs compared to Moneymaker, indicating a higher metabolic flux flow into carotenoid biosynthesis pathway in HLYs. Further conversion of lycopene to carotenes may be prevented via the two downstream genes (β-LCY2 and ε-LCY), which had low-abundance transcripts at either or both stages. Additionally, the significantly higher expression of four downstream genes (BCH1, ZEP, VDE, and CYP97C11) at either or both ripeness stages leads to significantly lower fruit lycopene content in HLYs than in the wild tomato. This is the first systematic investigation of the role of the complete pathway genes in regulating fruit lycopene biosynthesis across many HLYs, and enables tomato breeding and gene editing for increased fruit lycopene content.}, journal={Horticulture Research}, publisher={Oxford University Press (OUP)}, author={Duduit, James R and Kosentka, Pawel Z and Miller, Morgan A and Blanco-Ulate, Barbara and Lenucci, Marcello S and Panthee, Dilip R and Perkins-Veazie, Penelope and Liu, Wusheng}, year={2022} }
 @article{huang_gao_mcadams_zhao_lu_wu_martin_sherif_subramanian_duan_et al._2023, title={Engineered Cleistogamy in Camelina sativa for bioconfinement}, volume={10}, ISSN={["2052-7276"]}, DOI={10.1093/hr/uhac280}, abstractNote={AbstractCamelina sativa is a self-pollinating and facultative outcrossing oilseed crop. Genetic engineering has been used to improve camelina yield potential for altered fatty acid composition, modified protein profiles, improved seed and oil yield, and enhanced drought resistance. The deployment of transgenic camelina in the field posits high risks related to the introgression of transgenes into non-transgenic camelina and wild relatives. Thus, effective bioconfinement strategies need to be developed to prevent pollen-mediated gene flow (PMGF) from transgenic camelina. In the present study, we overexpressed the cleistogamy (i.e. floral petal non-openness)-inducing PpJAZ1 gene from peach in transgenic camelina. Transgenic camelina overexpressing PpJAZ1 showed three levels of cleistogamy, affected pollen germination rates after anthesis but not during anthesis, and caused a minor silicle abortion only on the main branches. We also conducted field trials to examine the effects of the overexpressed PpJAZ1 on PMGF in the field, and found that the overexpressed PpJAZ1 dramatically inhibited PMGF from transgenic camelina to non-transgenic camelina under the field conditions. Thus, the engineered cleistogamy using the overexpressed PpJAZ1 is a highly effective bioconfinement strategy to limit PMGF from transgenic camelina, and could be used for bioconfinement in other dicot species.}, number={2}, journal={HORTICULTURE RESEARCH}, author={Huang, Debao and Gao, Liwei and McAdams, Jeremy and Zhao, Fangzhou and Lu, Hongyan and Wu, Yonghui and Martin, Jeremy and Sherif, Sherif M. and Subramanian, Jayasankar and Duan, Hui and et al.}, year={2023}, month={Feb} }
 @article{sultana_mazarei_millwood_liu_hewezi_stewart jr_2022, title={Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max)}, volume={13}, ISSN={["1664-462X"]}, DOI={10.3389/fpls.2022.988048}, abstractNote={We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the −46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.}, journal={FRONTIERS IN PLANT SCIENCE}, author={Sultana, Mst Shamira and Mazarei, Mitra and Millwood, Reginald J. and Liu, Wusheng and Hewezi, Tarek and Stewart Jr, C. Neal}, year={2022}, month={Sep} }
 @misc{maren_duan_da_yencho_ranney_liu_2022, title={Genotype-independent plant transformation}, volume={9}, ISSN={["2052-7276"]}, DOI={10.1093/hr/uhac047}, abstractNote={Abstract
               Plant transformation and regeneration remain highly species- and genotype-dependent. Conventional hormone-based plant regeneration via somatic embryogenesis or organogenesis is tedious, time-consuming, and requires specialized skills and experience. Over the last 40 years, significant advances have been made to elucidate the molecular mechanisms underlying embryogenesis and organogenesis. These pioneering studies have led to a better understanding of the key steps and factors involved in plant regeneration, resulting in the identification of crucial growth and developmental regulatory genes that can dramatically improve regeneration efficiency, shorten transformation time, and make transformation of recalcitrant genotypes possible. Co-opting these regulatory genes offers great potential to develop innovative genotype-independent genetic transformation methods for various plant species, including specialty crops. Further developing these approaches has the potential to result in plant transformation without the use of hormones, antibiotics, selectable marker genes, or tissue culture. As an enabling technology, the use of these regulatory genes has great potential to enable the application of advanced breeding technologies such as genetic engineering and gene editing for crop improvement in transformation-recalcitrant crops and cultivars. This review will discuss the recent advances in the use of regulatory genes in plant transformation and regeneration, and their potential to facilitate genotype-independent plant transformation and regeneration.}, journal={HORTICULTURE RESEARCH}, author={Maren, Nathan A. and Duan, Hui and Da, Kedong and Yencho, G. Craig and Ranney, Thomas G. and Liu, Wusheng}, year={2022}, month={Jan} }
 @article{zhao_cheng_wang_gao_huang_kong_antwi-boasiako_zheng_yan_chang_et al._2022, title={Identification of Novel Genomic Regions for Bacterial Leaf Pustule (BLP) Resistance in Soybean (Glycine max L.) via Integrating Linkage Mapping and Association Analysis}, volume={23}, ISSN={["1422-0067"]}, url={https://www.mdpi.com/1422-0067/23/4/2113}, DOI={10.3390/ijms23042113}, abstractNote={Bacterial leaf pustule (BLP), caused by Xanthornonas axonopodis pv. glycines (Xag), is a worldwide disease of soybean, particularly in warm and humid regions. To date, little is known about the underlying molecular mechanisms of BLP resistance. The only single recessive resistance gene rxp has not been functionally identified yet, even though the genotypes carrying the gene have been widely used for BLP resistance breeding. Using a linkage mapping in a recombinant inbred line (RIL) population against the Xag strain Chinese C5, we identified that quantitative trait locus (QTL) qrxp–17–2 accounted for 74.33% of the total phenotypic variations. We also identified two minor QTLs, qrxp–05–1 and qrxp–17–1, that accounted for 7.26% and 22.26% of the total phenotypic variations, respectively, for the first time. Using a genome-wide association study (GWAS) in 476 cultivars of a soybean breeding germplasm population, we identified a total of 38 quantitative trait nucleotides (QTNs) on chromosomes (Chr) 5, 7, 8, 9,15, 17, 19, and 20 under artificial infection with C5, and 34 QTNs on Chr 4, 5, 6, 9, 13, 16, 17, 18, and 20 under natural morbidity condition. Taken together, three QTLs and 11 stable QTNs were detected in both linkage mapping and GWAS analysis, and located in three genomic regions with the major genomic region containing qrxp_17_2. Real-time RT-PCR analysis of the relative expression levels of five potential candidate genes in the resistant soybean cultivar W82 following Xag treatment showed that of Glyma.17G086300, which is located in qrxp–17–2, significantly increased in W82 at 24 and 72 h post-inoculation (hpi) when compared to that in the susceptible cultivar Jack. These results indicate that Glyma.17G086300 is a potential candidate gene for rxp and the QTLs and QTNs identified in this study will be useful for marker development for the breeding of Xag-resistant soybean cultivars.}, number={4}, journal={INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES}, author={Zhao, Fangzhou and Cheng, Wei and Wang, Yanan and Gao, Xuewen and Huang, Debao and Kong, Jiejie and Antwi-Boasiako, Augustine and Zheng, Lingyi and Yan, Wenliang and Chang, Fangguo and et al.}, year={2022}, month={Feb} }
 @article{liao_ye_zhang_peng_hou_fu_tan_zhao_jiang_xu_et al._2022, title={The genomic and bulked segregant analysis of Curcuma alismatifolia revealed its diverse bract pigmentation}, volume={3}, ISSN={["2662-1738"]}, DOI={10.1007/s42994-022-00081-6}, abstractNote={AbstractCompared with most flowers where the showy part comprises specialized leaves (petals) directly subtending the reproductive structures, most Zingiberaceae species produce showy “flowers” through modifications of leaves (bracts) subtending the true flowers throughout an inflorescence. Curcuma alismatifolia, belonging to the Zingiberaceae family, a plant species originating from Southeast Asia, has become increasingly popular in the flower market worldwide because of its varied and esthetically pleasing bracts produced in different cultivars. Here, we present the chromosome-scale genome assembly of C. alismatifolia “Chiang Mai Pink” and explore the underlying mechanisms of bract pigmentation. Comparative genomic analysis revealed C. alismatifolia contains a residual signal of whole-genome duplication. Duplicated genes, including pigment-related genes, exhibit functional and structural differentiation resulting in diverse bract colors among C. alismatifolia cultivars. In addition, we identified the key genes that produce different colored bracts in C. alismatifolia, such as F3′5'H, DFR, ANS and several transcription factors for anthocyanin synthesis, as well as chlH and CAO in the chlorophyll synthesis pathway by conducting transcriptomic analysis, bulked segregant analysis using both DNA and RNA data, and population genomic analysis. This work provides data for understanding the mechanism of bract pigmentation and will accelerate breeding in developing novel cultivars with richly colored bracts in C. alismatifolia and related species. It is also important to understand the variation in the evolution of the Zingiberaceae family.}, number={3}, journal={ABIOTECH}, author={Liao, Xuezhu and Ye, Yuanjun and Zhang, Xiaoni and Peng, Dan and Hou, Mengmeng and Fu, Gaofei and Tan, Jianjun and Zhao, Jianli and Jiang, Rihong and Xu, Yechun and et al.}, year={2022}, month={Sep}, pages={178–196} }
 @article{harmon_touchell_ranney_da_liu_2022, title={Tissue Culture and Regeneration of Three Rose Cultivars}, volume={57}, ISSN={["2327-9834"]}, DOI={10.21273/HORTSCI16716-22}, abstractNote={Methods of in vitro regeneration protocols were developed for three elite rose cultivars, Chewnicebell (Oso Easy Italian Ice®), Bucbi (Carefree Beauty™), and Cheweyesup (Ringo All-Star™). We evaluated the effects of different types and concentrations of auxins [dichlorophenoxyacetic acid (2,4-D) and trichlorophenoxyacetic acid (2,4,5-T)], carbohydrates [sucrose, glucose, and fructose], and cytokinins [thidiazuron (TDZ) and 6-bezylaminopurine (BAP)] on callus induction and regeneration from leaf explants. The greatest amount of regenerative callus was obtained on media containing 10 µM 2,4-D and 30 g·L−1 sucrose for Italian Ice® (40%), 10 µM 2,4-D and 60 g·L−1 glucose for Carefree Beauty™ (24%), and 5 µM 2,4,5-T and 30 g·L−1 sucrose for Ringo All-Star™ (32%). The greatest regeneration occurred when callus was transferred to media consisting of 1/2 MS media supplemented with 2.9 µM GA3 and 5 µM TDZ for Italian Ice® and Ringo All-Star™, and with 2.9 µM GA3 and 20 µM TDZ for Carefree Beauty™. Plantlets regenerated from callus were cultured on maintenance media and successfully transferred ex vitro. This study highlights the genotype-specific responses among rose cultivars and provides the first reports of in vitro regeneration for Italian Ice® and Ringo All-Star™.}, number={11}, journal={HORTSCIENCE}, author={Harmon, Davis D. and Touchell, Darren H. and Ranney, Thomas G. and Da, Kedong and Liu, Wusheng}, year={2022}, month={Nov}, pages={1430–1435} }
 @article{zhao_maren_kosentka_liao_lu_duduit_huang_ashrafi_zhao_huerta_et al._2021, title={An optimized protocol for stepwise optimization of real-time RT-PCR analysis}, volume={8}, ISSN={["2052-7276"]}, url={https://doi.org/10.1038/s41438-021-00616-w}, DOI={10.1038/s41438-021-00616-w}, abstractNote={AbstractComputational tool-assisted primer design for real-time reverse transcription (RT) PCR (qPCR) analysis largely ignores the sequence similarities between sequences of homologous genes in a plant genome. It can lead to false confidence in the quality of the designed primers, which sometimes results in skipping the optimization steps for qPCR. However, the optimization of qPCR parameters plays an essential role in the efficiency, specificity, and sensitivity of each gene’s primers. Here, we proposed an optimized approach to sequentially optimizing primer sequences, annealing temperatures, primer concentrations, and cDNA concentration range for each reference (and target) gene. Our approach started with a sequence-specific primer design that should be based on the single-nucleotide polymorphisms (SNPs) present in all the homologous sequences for each of the reference (and target) genes under study. By combining the efficiency calibrated and standard curve methods with the 2−ΔΔCt method, the standard cDNA concentration curve with a logarithmic scale was obtained for each primer pair for each gene. As a result, an R2 ≥ 0.9999 and the efficiency (E) = 100 ± 5% should be achieved for the best primer pair of each gene, which serve as the prerequisite for using the 2−ΔΔCt method for data analysis. We applied our newly developed approach to identify the best reference genes in different tissues and at various inflorescence developmental stages of Tripidium ravennae, an ornamental and biomass grass, and validated their utility under varying abiotic stress conditions. We also applied this approach to test the expression stability of six reference genes in soybean under biotic stress treatment with Xanthomonas axonopodis pv. glycines (Xag). Thus, these case studies demonstrated the effectiveness of our optimized protocol for qPCR analysis.}, number={1}, journal={HORTICULTURE RESEARCH}, author={Zhao, Fangzhou and Maren, Nathan A. and Kosentka, Pawel Z. and Liao, Ying-Yu and Lu, Hongyan and Duduit, James R. and Huang, Debao and Ashrafi, Hamid and Zhao, Tuanjie and Huerta, Alejandra I and et al.}, year={2021}, month={Dec} }
 @article{yang_lee_poindexter_shao_liu_lenaghan_ahkami_blumwald_stewart_2021, title={Rational design and testing of abiotic stress-inducible synthetic promoters from poplar cis-regulatory elements}, volume={19}, ISSN={["1467-7652"]}, url={https://doi.org/10.1111/pbi.13550}, DOI={10.1111/pbi.13550}, abstractNote={SummaryAbiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic‐related and salt stress‐inducible synthetic promoters for use in hybrid poplar. De novo motif‐detecting algorithms yielded 30 water‐deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water‐deficit stress motifs (SD18, SD13 and SD9) found in 16 co‐expressed gene promoters, and we discovered a well‐conserved motif for salt response (SS16). We characterized several native poplar stress‐inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five‐to‐eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18‐1, SD9‐2, SS16‐1, SS16‐2 and SS16‐3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18‐1 and SD9‐2 were induced by water‐deficit stress, whereas SS16‐1, SS16‐2 and SS16‐3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.}, number={7}, journal={PLANT BIOTECHNOLOGY JOURNAL}, publisher={Wiley}, author={Yang, Yongil and Lee, Jun Hyung and Poindexter, Magen R. and Shao, Yuanhua and Liu, Wusheng and Lenaghan, Scott C. and Ahkami, Amir H. and Blumwald, Eduardo and Stewart, Charles Neal, Jr.}, year={2021}, month={Jul}, pages={1354–1369} }
 @article{maren_zhao_aryal_touchell_liu_ranney_ashrafi_2021, title={Reproductive developmental transcriptome analysis of Tripidium ravennae (Poaceae)}, volume={22}, ISSN={["1471-2164"]}, DOI={10.1186/s12864-021-07641-y}, abstractNote={AbstractBackgroundTripidium ravennaeis a cold-hardy, diploid species in the sugarcane complex (PoaceaesubtribeSaccharinae) with considerable potential as a genetic resource for developing improved bioenergy and ornamental grasses. An improved understanding of the genetic regulation of reproductive processes (e.g., floral induction, inflorescence development, and seed development) will enable future applications of precision breeding and gene editing of floral and seed development. In particular, the ability to silence reproductive processes would allow for developing seedless forms of valuable but potentially invasive plants. The objective of this research was to characterize the gene expression environment of reproductive development inT. ravennae.ResultsDuring the early phases of inflorescence development, multiple key canonical floral integrators and pathways were identified. Annotations of type II subfamily of MADS-box transcription factors, in particular, were over-represented in the GO enrichment analyses and tests for differential expression (FDRp-value < 0.05). The differential expression of floral integrators observed in the early phases of inflorescence development diminished prior to inflorescence determinacy regulation. Differential expression analysis did not identify many unique genes at mid-inflorescence development stages, though typical biological processes involved in plant growth and development expressed abundantly. The increase in inflorescence determinacy regulatory elements and putative homeotic floral development unigenes at mid-inflorescence development coincided with the expression of multiple meiosis annotations and multicellular organism developmental processes. Analysis of seed development identified multiple unigenes involved in oxidative-reductive processes.ConclusionReproduction in grasses is a dynamic system involving the sequential coordination of complex gene regulatory networks and developmental processes. This research identified differentially expressed transcripts associated with floral induction, inflorescence development, and seed development inT. ravennae. These results provide insights into the molecular regulation of reproductive development and provide a foundation for future investigations and analyses, including genome annotation, functional genomics characterization, gene family evolutionary studies, comparative genomics, and precision breeding.}, number={1}, journal={BMC GENOMICS}, author={Maren, Nathan and Zhao, Fangzhou and Aryal, Rishi and Touchell, Darren and Liu, Wusheng and Ranney, Thomas and Ashrafi, Hamid}, year={2021}, month={Jun} }
 @misc{huang_kosentka_liu_2021, title={Synthetic biology approaches in regulation of targeted gene expression}, volume={63}, ISSN={["1879-0356"]}, url={http://dx.doi.org/10.1016/j.pbi.2021.102036}, DOI={10.1016/j.pbi.2021.102036}, abstractNote={Synthetic biology approaches are highly sought-after to facilitate the regulation of targeted gene expression in plants for functional genomics research and crop trait improvement. To date, synthetic regulation of gene expression predominantly focuses at the transcription level via engineering of synthetic promoters and transcription factors, while pioneering examples have started to emerge for synthetic regulation of gene expression at the levels of mRNA stability, translation, and protein degradation. This review discusses recent advances in plant synthetic biology for the regulation of gene expression at multiple levels, and highlights their future directions.}, journal={CURRENT OPINION IN PLANT BIOLOGY}, publisher={Elsevier BV}, author={Huang, Debao and Kosentka, Pawel Z. and Liu, Wusheng}, year={2021}, month={Oct} }
 @article{synthetic biology approaches in regulation of targeted gene expression_2021, journal={Current Opinion in Plant Biology}, year={2021} }
 @article{lu_luo_wang_liu_li_belwal_xu_li_2020, title={FaMYB9 is involved in the regulation of C6 volatile biosynthesis in strawberry}, volume={293}, ISSN={["0168-9452"]}, DOI={10.1016/j.plantsci.2020.110422}, abstractNote={The large-scale untargeted proteomic and metabolomic studies were conducted in strawberry (Fragaria × ananassa) cv. Akihime fruit at five developmental stages. We found that some C6 volatiles highly contributed to the enrichment of volatiles at the red stage of strawberry fruit. We found that 12 genes involved in LOX pathway for volatile biosynthesis showed multiple patterns in protein abundance during fruit development and ripening, and 9 out of the 12 genes exhibited a significant increase in their relative expression levels at the red stage of fruit. We also found that the MYB9 gene (FaMYB9) expression level was positively correlated with the content of C6 volatiles (R = 0.989) and with the relative expression level and protein abundance of FaLOX5 at different strawberry fruit developmental stages (R = 0.954). The interaction between FaMYB9 and FaLOX5 was detected by yeast two-hybrid, co-immunoprecipitation (Co-IP), bimolecular fluorescence complementation (BiFC), and immunofluorescence (IF) analyses. Transient silencing of FaMYB9 delayed the fruit development and ripening, resulting in a significant decrease in the contents of C6 volatiles, while overexpression of FaMYB9 increased the fruit development and ripening and the contents of C6 volatiles in Akihime fruit. Therefore, FaMYB9 is positively involved in C6 volatile biosynthesis.}, journal={PLANT SCIENCE}, author={Lu, Hongyan and Luo, Zisheng and Wang, Lei and Liu, Wusheng and Li, Dong and Belwal, Tarun and Xu, Yanqun and Li, Li}, year={2020}, month={Apr} }
 @article{lu_luo_wang_liu_li_belwal_xu_li_2021, title={FaMYB9 is involved in the regulation of C6 volatile biosynthesis in strawberry (vol 293, 110422, 2020)}, volume={313}, ISSN={["1873-2259"]}, DOI={10.1016/j.plantsci.2020.110496}, journal={PLANT SCIENCE}, author={Lu, Hongyan and Luo, Zisheng and Wang, Lei and Liu, Wusheng and Li, Dong and Belwal, Tarun and Xu, Yanqun and Li, Li}, year={2021}, month={Dec} }
 @article{wang_xie_liu_tao_sun_sun_zhang_2020, title={Transcription factor LkWOX4 is involved in adventitious root development in Larix kaempferi}, volume={758}, ISSN={["1879-0038"]}, url={http://dx.doi.org/10.1016/j.gene.2020.144942}, DOI={10.1016/j.gene.2020.144942}, abstractNote={WUSCHEL-related homeobox4 (WOX4) plays important roles in vascular formation and adventitious root (AR) development. Here, we cloned the WOX4 from the AR of Larix kaempferi, whose cDNA is 1452 bp in length and encodes 483 amino acids. LkWOX4 is mainly expressed in the layer formation area of the stem at 10 days after cutting and its expression levels in the middles and ends of the ARs were higher than that in the AR tips. The fused protein LkWOX4-GFP localized in the nucleus. The heterologous overexpression of LkWOX4 in 84 K poplar significantly increased AR numbers and decreased AR lengths. In LkWOX4 plants, the endogenous jasmonic acid and abscisic acid contents significantly decreased in stems, while the auxin, jasmonic acid and abscisic acid contents significantly increased in ARs. RNA-Seq of those LkWOX4 overexpression poplar plants showed that the expression of plant hormone signaling genes (ARF2, ARF3, ARF7 and ARF18), rooting-related transcription factors (WOX5, LBD29 and SCR) and root development-related genes (CYCD3, GRF1 and TAA1) were affected. Moreover, we found that LkWOX4 interacts with LkPAT18, LkACBP6, and LkCIP7 using yeast two hybrid screening. Thus, we found LkWOX4 involves in the AR initiation and development, which might be regulated through the IAA, JA and ABA signaling pathways.}, journal={GENE}, publisher={Elsevier BV}, author={Wang, Hongming and Xie, Yunhui and Liu, Wusheng and Tao, Guiyun and Sun, Chao and Sun, Xiaomei and Zhang, Shougong}, year={2020}, month={Oct} }
 @article{ondzighi-assoume_willis_ouma_allen_king_parrott_liu_burris_lenaghan_stewart_2019, title={Embryogenic cell suspensions for high-capacity genetic transformation and regeneration of switchgrass (Panicum virgatum L.)}, volume={12}, url={http://dx.doi.org/10.1186/s13068-019-1632-3}, DOI={10.1186/s13068-019-1632-3}, abstractNote={AbstractBackgroundSwitchgrass (Panicum virgatumL.), a North American prairie grassland species, is a potential lignocellulosic biofuel feedstock owing to its wide adaptability and biomass production. Production and genetic manipulation of switchgrass should be useful to improve its biomass composition and production for bioenergy applications. The goal of this project was to develop a high-throughput stable switchgrass transformation method usingAgrobacterium tumefacienswith subsequent plant regeneration.ResultsRegenerable embryogenic cell suspension cultures were established from friable type II callus-derived inflorescences using two genotypes selected from the synthetic switchgrass variety ‘Performer’ tissue culture lines 32 and 605. The cell suspension cultures were composed of a heterogeneous fine mixture culture of single cells and aggregates.Agrobacterium tumefaciensstrain GV3101 was optimum to transfer into cells the pANIC-10A vector with a hygromycin-selectable marker gene and apporRFPorange fluorescent protein marker gene at an 85% transformation efficiency. Liquid cultures gave rise to embryogenic callus and then shoots, of which up to 94% formed roots. The resulting transgenic plants were phenotypically indistinguishable from the non-transgenic parent lines.ConclusionThe new cell suspension-based protocol enables high-throughputAgrobacterium-mediated transformation and regeneration of switchgrass in which plants are recovered within 6–7 months from culture establishment.}, number={1}, journal={Biotechnology for Biofuels}, publisher={Springer Science and Business Media LLC}, author={Ondzighi-Assoume, Christine A. and Willis, Jonathan D. and Ouma, Wilson K. and Allen, Sara M. and King, Zachary and Parrott, Wayne A. and Liu, Wusheng and Burris, Jason N. and Lenaghan, Scott C. and Stewart, C. Neal}, year={2019}, month={Dec} }
 @article{liu_rudis_cheplick_millwood_yang_ondzighi-assoume_montgomery_burris_mazarei_chesnut_et al._2020, title={Lipofection-mediated genome editing using DNA-free delivery of the Cas9/gRNA ribonucleoprotein into plant cells}, volume={39}, url={http://dx.doi.org/10.1007/s00299-019-02488-w}, DOI={10.1007/s00299-019-02488-w}, abstractNote={A novel and robust lipofection-mediated transfection approach for the use of DNA-free Cas9/gRNA RNP for gene editing has demonstrated efficacy in plant cells. Precise genome editing has been revolutionized by CRISPR/Cas9 systems. DNA-based delivery of CRISPR/Cas9 is widely used in various plant species. However, protein-based delivery of the in vitro translated Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complex into plant cells is still in its infancy even though protein delivery has several advantages. These advantages include DNA-free delivery, gene-edited host plants that are not transgenic, ease of use, low cost, relative ease to be adapted to high-throughput systems, and low off-target cleavage rates. Here, we show a novel lipofection-mediated transfection approach for protein delivery of the preassembled Cas9/gRNA RNP into plant cells for genome editing. Two lipofection reagents, Lipofectamine 3000 and RNAiMAX, were adapted for successful delivery into plant cells of Cas9/gRNA RNP. A green fluorescent protein (GFP) reporter was fused in-frame with the C-terminus of the Cas9 protein and the fusion protein was successfully delivered into non-transgenic tobacco cv. 'Bright Yellow-2' (BY2) protoplasts. The optimal efficiencies for Lipofectamine 3000- and RNAiMAX-mediated protein delivery were 66% and 48%, respectively. Furthermore, we developed a biolistic method for protein delivery based on the known proteolistics technique. A transgenic tobacco BY2 line expressing an orange fluorescence protein reporter pporRFP was targeted for knockout. We found that the targeted mutagenesis frequency for our Lipofectamine 3000-mediated protein delivery was 6%. Our results showed that the newly developed lipofection-mediated transfection approach is robust for the use of the DNA-free Cas9/gRNA technology for genome editing in plant cells.}, number={2}, journal={Plant Cell Reports}, publisher={Springer Science and Business Media LLC}, author={Liu, Wusheng and Rudis, Mary R. and Cheplick, Matthew H. and Millwood, Reginald J. and Yang, Jian-Ping and Ondzighi-Assoume, Christine A. and Montgomery, Garrett A. and Burris, Kellie P. and Mazarei, Mitra and Chesnut, Jonathan D. and et al.}, year={2020}, month={Feb}, pages={245–257} }
 @article{transcription coactivator angustifolia3 (an3) regulates leafy head formation in chinese cabbage_2019, url={http://dx.doi.org/10.3389/fpls.2019.00520}, DOI={10.3389/fpls.2019.00520}, abstractNote={Leafy head formation in Chinese cabbage (B. rapa ssp. pekinensis cv. Bre) results from leaf curvature, which is under the tight control of genes involved in the adaxial-abaxial patterning during leaf development. The transcriptional coactivator ANGUSTIFOLIA3 (AN3) binds to the SWI/SNF chromatin remodeling complexes formed around ATPases such as BRAHMA (BRM) in order to regulate transcription in various aspects of leaf development such as cell proliferation, leaf primordia expansion, and leaf adaxial/abaxial patterning in Arabidopsis. However, its regulatory function in Chinese cabbage remains poorly understood. Here, we analyzed the expression patterns of the Chinese cabbage AN3 gene (BrAN3) before and after leafy head formation, and produced BrAN3 gene silencing plants by using the turnip yellow mosaic virus (TYMV)-derived vector in order to explore its potential function in leafy head formation in Chinese cabbage. We found that BrAN3 had distinct expression patterns in the leaves of Chinese cabbage at the rosette and heading stages. We also found silencing of BrAN3 stimulated leafy head formation at the early stage. Transcriptome analysis indicated that silencing of BrAN3 modulated the hormone signaling pathways of auxin, ethylene, GA, JA, ABA, BR, CK, and SA in Chinese cabbage. Our study offers unique insights into the function of BrAN3 in leafy head formation in Chinese cabbage.}, journal={Frontiers in Plant Science}, year={2019}, month={Apr} }
 @article{xu_liu_ye_mazarei_huang_zhang_stewart_2018, title={A profilin gene promoter from switchgrass (Panicum virgatum L.) directs strong and specific transgene expression to vascular bundles in rice}, volume={37}, ISSN={["1432-203X"]}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-85040614740&partnerID=MN8TOARS}, DOI={10.1007/s00299-018-2253-1}, abstractNote={A switchgrass vascular tissue-specific promoter (PvPfn2) and its 5'-end serial deletions drive high levels of vascular bundle transgene expression in transgenic rice. Constitutive promoters are widely used for crop genetic engineering, which can result in multiple off-target effects, including suboptimal growth and epigenetic gene silencing. These problems can be potentially avoided using tissue-specific promoters for targeted transgene expression. One particularly urgent need for targeted cell wall modification in bioenergy crops, such as switchgrass (Panicum virgatum L.), is the development of vasculature-active promoters to express cell wall-affective genes only in the specific tissues, i.e., xylem and phloem. From a switchgrass expression atlas we identified promoter sequence upstream of a vasculature-specific switchgrass profilin gene (PvPfn2), especially in roots, nodes and inflorescences. When the putative full-length (1715 bp) and 5'-end serial deletions of the PvPfn2 promoter (shortest was 413 bp) were used to drive the GUS reporter expression in stably transformed rice (Oryza sativa L.), strong vasculature-specificity was observed in various tissues including leaves, leaf sheaths, stems, and flowers. The promoters were active in both phloem and xylem. It is interesting to note that the promoter was active in many more tissues in the heterologous rice system than in switchgrass. Surprisingly, all four 5'-end promoter deletions, including the shortest fragment, had the same expression patterns as the full-length promoter and with no attenuation in GUS expression in rice. These results indicated that the PvPfn2 promoter variants are new tools to direct transgene expression specifically to vascular tissues in monocots. Of special interest is the very compact version of the promoter, which could be of use for vasculature-specific genetic engineering in monocots.}, number={4}, journal={PLANT CELL REPORTS}, author={Xu, Wenzhi and Liu, Wusheng and Ye, Rongjian and Mazarei, Mitra and Huang, Debao and Zhang, Xinquan and Stewart, C. Neal, Jr.}, year={2018}, month={Apr}, pages={587–597} }
 @article{liu_mazarei_ye_peng_shao_baxter_sykes_turner_davis_wang_et al._2018, title={Switchgrass (Panicum virgatum L.) promoters for green tissue-specific expression of the MYB4 transcription factor for reduced-recalcitrance transgenic switchgrass}, volume={11}, ISSN={["1754-6834"]}, url={http://dx.doi.org/10.1186/s13068-018-1119-7}, DOI={10.1186/s13068-018-1119-7}, abstractNote={Genetic engineering of switchgrass (Panicum virgatum L.) for reduced cell wall recalcitrance and improved biofuel production has been a long pursued goal. Up to now, constitutive promoters have been used to direct the expression of cell wall biosynthesis genes toward attaining that goal. While generally sufficient to gauge a transgene’s effects in the heterologous host, constitutive overexpression often leads to undesirable plant phenotypic effects. Green tissue-specific promoters from switchgrass are potentially valuable to directly alter cell wall traits exclusively in harvestable aboveground biomass while not changing root phenotypes. We identified and functionally characterized three switchgrass green tissue-specific promoters and assessed marker gene expression patterns and intensity in stably transformed rice (Oryza sativa L.), and then used them to direct the expression of the switchgrass MYB4 (PvMYB4) transcription factor gene in transgenic switchgrass to endow reduced recalcitrance in aboveground biomass. These promoters correspond to photosynthesis-related light-harvesting complex II chlorophyll-a/b binding gene (PvLhcb), phosphoenolpyruvate carboxylase (PvPEPC), and the photosystem II 10 kDa R subunit (PvPsbR). Real-time RT-PCR analysis detected their strong expression in the aboveground tissues including leaf blades, leaf sheaths, internodes, inflorescences, and nodes of switchgrass, which was tightly up-regulated by light. Stable transgenic rice expressing the GUS reporter under the control of each promoter (756–2005 bp in length) further confirmed their strong expression patterns in leaves and stems. With the exception of the serial promoter deletions of PvLhcb, all GUS marker patterns under the control of each 5′-end serial promoter deletion were not different from that conveyed by their respective promoters. All of the shortest promoter fragments (199–275 bp in length) conveyed strong green tissue-specific GUS expression in transgenic rice. PvMYB4 is a master repressor of lignin biosynthesis. The green tissue-specific expression of PvMYB4 via each promoter in transgenic switchgrass led to significant gains in saccharification efficiency, decreased lignin, and decreased S/G lignin ratios. In contrast to constitutive overexpression of PvMYB4, which negatively impacts switchgrass root growth, plant growth was not compromised in green tissue-expressed PvMYB4 switchgrass plants in the current study. Each of the newly described green tissue-specific promoters from switchgrass has utility to change cell wall biosynthesis exclusively in aboveground harvestable biomass without altering root systems. The truncated green tissue promoters are very short and should be useful for targeted expression in a number of monocots to improve shoot traits while restricting gene expression from roots. Green tissue-specific expression of PvMYB4 is an effective strategy for improvement of transgenic feedstocks.}, journal={BIOTECHNOLOGY FOR BIOFUELS}, author={Liu, Wusheng and Mazarei, Mitra and Ye, Rongjian and Peng, Yanhui and Shao, Yuanhua and Baxter, Holly L. and Sykes, Robert W. and Turner, Geoffrey B. and Davis, Mark F. and Wang, Zeng-Yu and et al.}, year={2018}, month={Apr} }
 @article{stewart_liu_2017, title={Synthetic promoters for precise control of gene expression in plants}, volume={113}, journal={Chemical Engineering Progress}, author={Stewart, C.N., Jr. and Liu, W.}, year={2017}, pages={36–39} }
 @inbook{liu_stewart_2016, place={New Jersey, USA}, edition={2nd edition}, title={Plant systems biology}, booktitle={Plant Biotechnology and Genetics: Principles, Techniques and Applications}, publisher={Wiley and Sons}, author={Liu, W. and Stewart, C.N., Jr}, editor={Stewart, C.N., JrEditor}, year={2016} }
 @inbook{liu_miki_stewart_2016, place={New Jersey, USA}, edition={2nd edition}, title={Promoters and Marker genes}, booktitle={Plant Biotechnology and Genetics: Principles, Techniques and Applications}, publisher={Wiley and Sons}, author={Liu, W. and Miki, B. and Stewart, C.N., Jr}, editor={Stewart, C.N., JrEditor}, year={2016} }
 @inbook{liu_stewart_2016, place={New Jersey, USA}, edition={2nd edition}, title={The Future: advanced plant biotechnology, genome editing and synthetic biology}, booktitle={Plant Biotechnology and Genetics: Principles, Techniques and Applications}, publisher={Wiley and Sons}, author={Liu, W. and Stewart, C.N., Jr}, editor={Stewart, C.N., JrEditor}, year={2016} }
 @article{ye_huang_alexander_liu_millwood_wang_stewart_2016, title={Field Studies on Dynamic Pollen Production, Deposition, and Dispersion of Glyphosate-Resistant Horseweed (Conyza canadensis)}, volume={64}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84954567920&partnerID=MN8TOARS}, DOI={10.1614/WS-D-15-00073.1}, abstractNote={Glyphosate-resistant (GR) horseweed has become an especially problematic weed in different crop production systems across the United States and the world. In this field study, we used a nondestructive measurement system to analyze the pollen production, deposition, and dispersion of a Tennessee glyphosate resistant (TNR) horseweed biotype in Knoxville, TN during the 2013 pollination season. We observed that the pollination season of TNR horseweed lasted about 2 mo (54 d). About 78.93% of horseweed pollen was released between 9:00 A.M. and 7:00 P.M. during each sampling day and the release peak was at about 1:30 P.M. The seasonal release of pollen grains was estimated to be 5.11 million grains plant−1. The release rate data indicated that the integrated horizontal flux density and deposition flux density contributed to 78.17% and 21.83% of the release rate, respectively. We also found that pollen concentration decreased with distance from the source field; the average pollen concentration decreased to 50.69% at a distance of 16 m from the source plot. This is the first result of a systematic, direct examination of the release rate (emission and deposition), release pattern (daily and seasonal), and dispersion pattern of GR horseweed pollen.}, number={1}, journal={Weed Science}, author={Ye, R. and Huang, H. and Alexander, J. and Liu, W. and Millwood, R.J. and Wang, J. and Stewart, C.N.}, year={2016}, pages={101–111} }
 @article{liu_stewart_2015, title={Plant synthetic biology}, volume={20}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84928828879&partnerID=MN8TOARS}, DOI={10.1016/j.tplants.2015.02.004}, abstractNote={Plant synthetic biology is an emerging field that combines engineering principles with plant biology toward the design and production of new devices. This emerging field should play an important role in future agriculture for traditional crop improvement, but also in enabling novel bioproduction in plants. In this review we discuss the design cycles of synthetic biology as well as key engineering principles, genetic parts, and computational tools that can be utilized in plant synthetic biology. Some pioneering examples are offered as a demonstration of how synthetic biology can be used to modify plants for specific purposes. These include synthetic sensors, synthetic metabolic pathways, and synthetic genomes. We also speculate about the future of synthetic biology of plants.}, number={5}, journal={Trends in Plant Science}, author={Liu, W. and Stewart, C.N.}, year={2015}, pages={309–317} }
 @article{liu_stewart_2016, title={Plant synthetic promoters and transcription factors}, volume={37}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84945358935&partnerID=MN8TOARS}, DOI={10.1016/j.copbio.2015.10.001}, abstractNote={Synthetic promoters and transcription factors (TFs) have become incredibly powerful and efficient components for precise regulation of targeted plant transgene expression. Synthetic promoters can be rationally designed and constructed using specific type, copy number and spacing of motifs placed upstream of synthetic or native core promoters. Similarly, synthetic TFs can be constructed using a variety of DNA binding domains (DBDs) and effector domains. Synthetic promoters and TFs can provide tremendous advantages over their natural counterparts with regards to transgene expression strength and specificity. They will probably be needed for coordinated transgene expression for metabolic engineering and synthetic circuit applications in plants for bioenergy and advanced crop engineering. In this article we review the recent advances in synthetic promoters and TFs in plants and speculate on their future.}, journal={Current Opinion in Biotechnology}, author={Liu, W. and Stewart, C.N.}, year={2016}, pages={36–44} }
 @article{liu_mazarei_peng_fethe_rudis_lin_millwood_arelli_stewart_2014, title={Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode-inducible synthetic promoters}, volume={12}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84925969416&partnerID=MN8TOARS}, DOI={10.1111/pbi.12206}, abstractNote={SummaryComputational methods offer great hope but limited accuracy in the prediction of functional cis‐regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)‐inducible motif discovery among promoters of 18 co‐expressed soybean genes that were selected from six reported microarray studies involving a compatible soybean–SCN interaction. A total of 116 overlapping motif regions (OMRs) were discovered bioinformatically that were identified by at least four out of seven bioinformatic tools. Using synthetic promoters, the inducibility of each OMR or motif itself was evaluated by co‐localization of gain of function of an orange fluorescent protein reporter and the presence of SCN in transgenic soybean hairy roots. Among 16 OMRs detected from two experimentally confirmed SCN‐inducible promoters, 11 OMRs (i.e. 68.75%) were experimentally confirmed to be SCN‐inducible, leading to the discovery of 23 core motifs of 5‐ to 7‐bp length, of which 14 are novel in plants. We found that a combination of the three best tools (i.e. SCOPE, W‐AlignACE and Weeder) could detect all 23 core motifs. Thus, this strategy is a high‐throughput approach for de novo motif discovery in soybean and offers great potential for novel motif discovery and synthetic promoter engineering for any plant and trait in crop biotechnology.}, number={8}, journal={Plant Biotechnology Journal}, author={Liu, W. and Mazarei, M. and Peng, Y. and Fethe, M.H. and Rudis, M.R. and Lin, J. and Millwood, R.J. and Arelli, P.R. and Stewart, C.N.}, year={2014}, pages={1015–1026} }
 @article{fethe_liu_burris_millwood_mazarei_rudis_yeaman_dubosquielle_stewart_2014, title={The performance of pathogenic bacterial phytosensing transgenic tobacco in the field}, volume={12}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84904763653&partnerID=MN8TOARS}, DOI={10.1111/pbi.12180}, abstractNote={SummaryPhytosensors are useful for rapid‐on‐the‐plant detection of contaminants and agents that cause plant stress. Previously, we produced a series of plant pathogen‐inducible synthetic promoters fused to an orange fluorescent protein (OFP) reporter gene and transformed them into tobacco and Arabidopsis thaliana plants; in these transgenic lines, an OFP signal is expressed commensurate with the presence of plant pathogens. We report here the results of 2 years of field experiments using a subset of these bacterial phytosensing tobacco plants. Time‐course analysis of field‐grown phytosensors showed that a subset of plants responded predictably to treatments with Pseudomonas phytopathogens. There was a twofold induction in the OFP fluorescence driven by two distinct salicylic acid‐responsive synthetic promoters, 4 × PR1 and 4 × SARE. Most notably, transgenic plants containing 4 × PR1 displayed the earliest and highest OFP induction at 48 and 72 h postinoculation (h p.i.) upon inoculation with two phytopathogens Pseudomonas syringae pv. tomato and P. syringae pv. tabaci, respectively. These results demonstrate transgenic tobacco harbouring a synthetic inducible promoter‐driven OFP could be used to facilitate monitoring and early‐warning reporting of phytopathogen infections in agricultural fields.}, number={6}, journal={Plant Biotechnology Journal}, author={Fethe, M.H. and Liu, W. and Burris, J.N. and Millwood, R.J. and Mazarei, M. and Rudis, M.R. and Yeaman, D.G. and Dubosquielle, M. and Stewart, C.N.}, year={2014}, pages={755–764} }
 @article{advanced genetic tools for plant biotechnology_2013, volume={14}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84886092842&partnerID=MN8TOARS}, DOI={10.1038/nrg3583}, abstractNote={Basic research has provided a much better understanding of the genetic networks and regulatory hierarchies in plants. To meet the challenges of agriculture, we must be able to rapidly translate this knowledge into generating improved plants. Therefore, in this Review, we discuss advanced tools that are currently available for use in plant biotechnology to produce new products in plants and to generate plants with new functions. These tools include synthetic promoters, 'tunable' transcription factors, genome-editing tools and site-specific recombinases. We also review some tools with the potential to enable crop improvement, such as methods for the assembly and synthesis of large DNA molecules, plant transformation with linked multigenes and plant artificial chromosomes. These genetic technologies should be integrated to realize their potential for applications to pressing agricultural and environmental problems.}, number={11}, journal={Nature Reviews Genetics}, year={2013}, pages={781–793} }
 @article{lin_mazarei_zhao_zhu_zhuang_liu_pantalone_arelli_stewart_chen_2013, title={Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode}, volume={11}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84888136842&partnerID=MN8TOARS}, DOI={10.1111/pbi.12108}, abstractNote={SummarySalicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in soybean defence against soybean cyst nematode (Heterodera glycines Ichinohe, SCN). GmSAMT1 was identified as a candidate SCN defence‐related gene in our previous analysis of soybean defence against SCN using GeneChip microarray experiments. The current study started with the isolation of the full‐length cDNAs of GmSAMT1 from a SCN‐resistant soybean line and from a SCN‐susceptible soybean line. The two cDNAs encode proteins of identical sequences. The GmSAMT1 cDNA was expressed in Escherichia coli. Using in vitro enzyme assays, E. coli‐expressed GmSAMT1 was confirmed to function as salicylic acid methyltransferase. The apparent Km value of GmSAMT1 for salicylic acid was approximately 46 μm. To determine the role of GmSAMT1 in soybean defence against SCN, transgenic hairy roots overexpressing GmSAMT1 were produced and tested for SCN resistance. Overexpression of GmSAMT1 in SCN‐susceptible backgrounds significantly reduced the development of SCN, indicating that overexpression of GmSAMT1 in the transgenic hairy root system could confer resistance to SCN. Overexpression of GmSAMT1 in transgenic hairy roots was also found to affect the expression of selected genes involved in salicylic acid biosynthesis and salicylic acid signal transduction.}, number={9}, journal={Plant Biotechnology Journal}, author={Lin, J. and Mazarei, M. and Zhao, N. and Zhu, J.J. and Zhuang, X. and Liu, W. and Pantalone, V.R. and Arelli, P.R. and Stewart, C.N. and Chen, F.}, year={2013}, pages={1135–1145} }
 @article{liu_rudis_peng_mazarei_millwood_yang_xu_chesnut_stewart_2014, title={Synthetic TAL effectors for targeted enhancement of transgene expression in plants}, volume={12}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-84899063623&partnerID=MN8TOARS}, DOI={10.1111/pbi.12150}, abstractNote={SummaryTranscription activator‐like effectors (TALEs), secreted by the pathogenic bacteria Xanthomonas, specifically activate expression of targeted genes in plants. Here, we designed synthetic TALEs that bind to the flanking regions of the TATA‐box motif on the CaMV 35S promoter for the purpose of understanding the engineerable ‘hot‐spots’ for increasing transgene expression. We demonstrated that transient expression of de novo‐engineered TALEs using agroinfiltration could significantly increase reporter gene expression in stable transgenic tobacco expressing the orange fluorescent protein reporter gene pporRFP under the control of synthetic inducible, minimal or full‐length 35S promoters. Moreover, the additive effects of a combination of two different synthetic TALEs could significantly enhance the activation effects of TALEs on reporter gene expression more than when each TALE was used individually. We also studied the effects of the C‐terminal domain and the activation domain of synthetic TALEs, as well as the best ‘hot‐spots’ on the 35S promoter on targeted transgene activation. Furthermore, TALE activation of the Arabidopsis MYB transcription factor AtPAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1) in stable transgenic tobacco gave rise to a dark purple colour on infiltrated leaves when driven by four copies of cis‐regulatory elements of pathogenesis‐related gene (PR1) with enhancer motifs B and A1 from the 35S promoter. These results provide novel insights into the potential applications of synthetic TALEs for targeted gene activation of transgenes in plants.}, number={4}, journal={Plant Biotechnology Journal}, author={Liu, W. and Rudis, M.R. and Peng, Y. and Mazarei, M. and Millwood, R.J. and Yang, J.-P. and Xu, W. and Chesnut, J.D. and Stewart, C.N.}, year={2014}, pages={436–446} }
 @article{liu_mazarei_rudis_fethe_peng_millwood_schoene_burris_stewart_2013, title={Bacterial pathogen phytosensing in transgenic tobacco and Arabidopsis plants}, volume={11}, ISSN={1467-7644 1467-7652}, url={http://dx.doi.org/10.1111/pbi.12005}, DOI={10.1111/pbi.12005}, abstractNote={SummaryPlants are subject to attack by a wide range of phytopathogens. Current pathogen detection methods and technologies are largely constrained to those occurring post‐symptomatically. Recent efforts were made to generate plant sentinels (phytosensors) that can be used for sensing and reporting pathogen contamination in crops. Engineered phytosensors indicating the presence of plant pathogens as early‐warning sentinels potentially have tremendous utility as wide‐area detectors. We previously showed that synthetic promoters containing pathogen and/or defence signalling inducible cis‐acting regulatory elements (RE) fused to a fluorescent protein (FP) reporter could detect phytopathogenic bacteria in a transient phytosensing system. Here, we further advanced this phytosensing system by developing stable transgenic tobacco and Arabidopsis plants containing candidate constructs. The inducibility of each synthetic promoter was examined in response to biotic (bacterial pathogens) or chemical (plant signal molecules salicylic acid, ethylene and methyl jasmonate) treatments using stably transgenic plants. The treated plants were visualized using epifluorescence microscopy and quantified using spectrofluorometry for FP synthesis upon induction. Time‐course analyses of FP synthesis showed that both transgenic tobacco and Arabidopsis plants were capable to respond in predictable ways to pathogen and chemical treatments. These results provide insights into the potential applications of transgenic plants as phytosensors and the implementation of emerging technologies for monitoring plant disease outbreaks in agricultural fields.}, number={1}, journal={Plant Biotechnology Journal}, publisher={Wiley}, author={Liu, Wusheng and Mazarei, Mitra and Rudis, Mary R. and Fethe, Michael H. and Peng, Yanhui and Millwood, Reginald J. and Schoene, Gisele and Burris, Jason N. and Stewart, C. Neal, Jr}, year={2013}, pages={43–52} }
 @article{gene expression profiling of resistant and susceptible soybean lines infected with soybean cyst nematode_2011, volume={123}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-80855123881&partnerID=MN8TOARS}, DOI={10.1007/s00122-011-1659-8}, abstractNote={Soybean cyst nematode (SCN) is the most devastating pathogen of soybean. Information about the molecular basis of soybean-SCN interactions is needed to assist future development of effective management tools against this pathogen. Toward this end, soybean transcript abundance was measured using the Affymetrix Soybean Genome Array in a susceptible and a resistant reaction of soybean to SCN infection. Two genetically related soybean sister lines TN02-226 and TN02-275, which are resistant and susceptible, respectively, to the SCN race 2 infection were utilized in these experiments. Pairwise comparisons followed by false discovery rate analysis indicated that the expression levels of 162 transcripts changed significantly in the resistant line, of which 84 increased while 78 decreased. However, in the susceptible line, 1,694 transcripts changed significantly, of which 674 increased while 1,020 decreased. Comparative analyses of these transcripts indicated that a total of 51 transcripts were in common between resistance and susceptible responses. In this set, 42 transcripts increased in the resistant line, but decreased in the susceptible line. Quantitative real-time reverse-transcription polymerase chain reaction confirmed the results of microarray analysis. Of the transcripts to which a function could be assigned, genes were associated with metabolism, cell wall modification, signal transduction, transcription, and defense. Microarray analyses examining two genetically related soybean lines against the same SCN population provided additional insights into the specific changes in gene expression of a susceptible and a resistant reaction beneficial for identification of genes involved in defense.}, number={7}, journal={Theoretical and Applied Genetics}, year={2011}, pages={1193–1206} }
 @article{rapid in vivo analysis of synthetic promoters for plant pathogen phytosensing_2011, volume={11}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-81155127545&partnerID=MN8TOARS}, DOI={10.1186/1472-6750-11-108}, abstractNote={Abstract
          
            Background
            We aimed to engineer transgenic plants for the purpose of early detection of plant pathogen infection, which was accomplished by employing synthetic pathogen inducible promoters fused to reporter genes for altered phenotypes in response to the pathogen infection. Toward this end, a number of synthetic promoters consisting of inducible regulatory elements fused to a red fluorescent protein (RFP) reporter were constructed for use in phytosensing.
          
          
            Results
            For rapid analysis, an Agrobacterium-mediated transient expression assay was evaluated, then utilized to assess the inducibility of each synthetic promoter construct in vivo. Tobacco (Nicotiana tabacum cv. Xanthi) leaves were infiltrated with Agrobacterium harboring the individual synthetic promoter-reporter constructs. The infiltrated tobacco leaves were re-infiltrated with biotic (bacterial pathogens) or abiotic (plant defense signal molecules salicylic acid, ethylene and methyl jasmonate) agents 24 and 48 hours after initial agroinfiltration, followed by RFP measurements at relevant time points after treatment. These analyses indicated that the synthetic promoter constructs were capable of conferring the inducibility of the RFP reporter in response to appropriate phytohormones and bacterial pathogens, accordingly.
          
          
            Conclusions
            These observations demonstrate that the Agrobacterium-mediated transient expression is an efficient method for in vivo assays of promoter constructs in less than one week. Our results provide the opportunity to gain further insights into the versatility of the expression system as a potential tool for high-throughput in planta expression screening prior to generating stably transgenic plants for pathogen phytosensing. This system could also be utilized for temporary phytosensing; e.g., not requiring stably transgenic plants.
          }, journal={BMC Biotechnology}, year={2011} }
 @article{mann_king_liu_joyce_percifield_hawkins_lafayette_artelt_burris_mazarei_et al._2011, title={Switchgrass (Panicum virgatum L.) polyubiquitin gene (PvUbi1 and PvUbi2) promoters for use in plant transformation}, volume={11}, ISSN={1472-6750}, url={http://dx.doi.org/10.1186/1472-6750-11-74}, DOI={10.1186/1472-6750-11-74}, abstractNote={The ubiquitin protein is present in all eukaryotic cells and promoters from ubiquitin genes are good candidates to regulate the constitutive expression of transgenes in plants. Therefore, two switchgrass (Panicum virgatum L.) ubiquitin genes (PvUbi1 and PvUbi2) were cloned and characterized. Reporter constructs were produced containing the isolated 5' upstream regulatory regions of the coding sequences (i.e. PvUbi1 and PvUbi2 promoters) fused to the uidA coding region (GUS) and tested for transient and stable expression in a variety of plant species and tissues. PvUbi1 consists of 607 bp containing cis-acting regulatory elements, a 5' untranslated region (UTR) containing a 93 bp non-coding exon and a 1291 bp intron, and a 918 bp open reading frame (ORF) that encodes four tandem, head -to-tail ubiquitin monomer repeats followed by a 191 bp 3' UTR. PvUbi2 consists of 692 bp containing cis-acting regulatory elements, a 5' UTR containing a 97 bp non-coding exon and a 1072 bp intron, a 1146 bp ORF that encodes five tandem ubiquitin monomer repeats and a 183 bp 3' UTR. PvUbi1 and PvUbi2 were expressed in all examined switchgrass tissues as measured by qRT-PCR. Using biolistic bombardment, PvUbi1 and PvUbi2 promoters showed strong expression in switchgrass and rice callus, equaling or surpassing the expression levels of the CaMV 35S, 2x35S, ZmUbi1, and OsAct1 promoters. GUS staining following stable transformation in rice demonstrated that the PvUbi1 and PvUbi2 promoters drove expression in all examined tissues. When stably transformed into tobacco (Nicotiana tabacum), the PvUbi2+3 and PvUbi2+9 promoter fusion variants showed expression in vascular and reproductive tissues. The PvUbi1 and PvUbi2 promoters drive expression in switchgrass, rice and tobacco and are strong constitutive promoter candidates that will be useful in genetic transformation of monocots and dicots.}, number={1}, journal={BMC Biotechnology}, publisher={Springer Nature}, author={Mann, David GJ and King, Zachary R and Liu, Wusheng and Joyce, Blake L and Percifield, Ryan J and Hawkins, Jennifer S and LaFayette, Peter R and Artelt, Barbara J and Burris, Jason N and Mazarei, Mitra and et al.}, year={2011}, month={Jul} }
 @article{karve_liu_willet_torii_shpak_2011, title={The presence of multiple introns is essential for ERECTA expression in Arabidopsis}, volume={17}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-80053176443&partnerID=MN8TOARS}, DOI={10.1261/rna.2825811}, abstractNote={Gene expression in eukaryotes is often enhanced by the presence of introns. Depending on the specific gene, this enhancement can be minor or very large and occurs at both the transcriptional and post-transcriptional levels. The Arabidopsis ERECTA gene contains 27 exons encoding a receptor-like kinase that promotes cell proliferation and inhibits cell differentiation in above-ground plant organs. The expression of ERECTA very strongly depends on the presence of introns. The intronless ERECTA gene does not rescue the phenotype of erecta mutant plants and produces about 500–900 times less protein compared with the identical construct containing introns. This result is somewhat surprising as the region upstream of the ERECTA coding sequence effectively promotes the expression of extraneous genes. Here, we demonstrate that introns are essential for ERECTA mRNA accumulation and, to a lesser extent, for mRNA utilization in translation. Since mRNA produced by intronless ERECTA is degraded at the 3′ end, we speculate that introns increase mRNA accumulation through increasing its stability at least in part. No individual intron is absolutely necessary for ERECTA expression, but rather multiple introns in specific locations increase ERECTA expression in an additive manner. The ability of introns to promote ERECTA expression might be linked to the process of splicing and not to a particular intron sequence.}, number={10}, journal={RNA}, author={Karve, R. and Liu, W. and Willet, S.G. and Torii, K.U. and Shpak, E.D.}, year={2011}, pages={1907–1921} }
 @article{shaw_lickey_beck_farmer_liu_miller_siripun_winder_schilling_small_2005, title={The tortoise and the hare II: Relative utility of 21 noncoding chloroplast DNA sequences for phylogenetic analysis}, volume={92}, url={http://www.scopus.com/inward/record.url?eid=2-s2.0-19944430021&partnerID=MN8TOARS}, DOI={10.3732/ajb.92.1.142}, abstractNote={Chloroplast DNA sequences are a primary source of data for plant molecular systematic studies. A few key papers have provided the molecular systematics community with universal primer pairs for noncoding regions that have dominated the field, namely trnL‐trnF and trnK/matK. These two regions have provided adequate information to resolve species relationships in some taxa, but often provide little resolution at low taxonomic levels. To obtain better phylogenetic resolution, sequence data from these regions are often coupled with other sequence data. Choosing an appropriate cpDNA region for phylogenetic investigation is difficult because of the scarcity of information about the tempo of evolutionary rates among different noncoding cpDNA regions. The focus of this investigation was to determine whether there is any predictable rate heterogeneity among 21 noncoding cpDNA regions identified as phylogenetically useful at low levels. To test for rate heterogeneity among the different cpDNA regions, we used three species from each of 10 groups representing eight major phylogenetic lineages of phanerogams. The results of this study clearly show that a survey using as few as three representative taxa can be predictive of the amount of phylogenetic information offered by a cpDNA region and that rate heterogeneity exists among noncoding cpDNA regions.}, number={1}, journal={American Journal of Botany}, author={Shaw, J. and Lickey, E.B. and Beck, J.T. and Farmer, S.B. and Liu, W. and Miller, J. and Siripun, K.C. and Winder, C.T. and Schilling, E.E. and Small, R.L.}, year={2005}, pages={142–166} }
 @article{lihuan_ling_quanshe_wusheng_1999, title={Wild fruit resources and exploitation in Xiaoxing’an Mountains}, volume={10}, ISSN={1007-662X 1993-0607}, url={http://dx.doi.org/10.1007/bf02855475}, DOI={10.1007/bf02855475}, number={1}, journal={Journal of Forestry Research}, publisher={Springer Science and Business Media LLC}, author={Lihuan, Zhuo and Ling, Wang and Quanshe, Chen and Wusheng, Liu}, year={1999}, month={Mar}, pages={31–33} }
 @article{li_zhang_wang_liu_1998, title={Investigation on the Medical Plant Resources of Beizhang Experimental Area in the Upper Reaches of Miyun Reservoir}, volume={2}, journal={Quarterly of Forest By-Product And Speciality in China}, author={Li, G. and Zhang, Y. and Wang, J. and Liu, W.}, year={1998}, pages={45–46} }
 @article{zhang_wang_liu_li_li_1997, title={The preliminary study on the vegetation qualities of Beizhuang experimental area in the upper reaches of Miyun reservoir}, volume={19}, journal={Journal of Beijing Forestry University}, author={Zhang, Y. and Wang, J. and Liu, W. and Li, G. and Li, F.}, year={1997}, pages={39–44} }
 @inbook{zhuo_yang_liu_1994, place={Harbin, P.R. China}, title={Early spring wild herbal flower resources and its utilization in urban landscaping in Heilongjiang Province}, booktitle={New Studies on Forest Management and Forest Resource Exploitation in Northeast China-Zhong Guo Dong Bei Lin Qu (1990-1994)}, publisher={Heilongjiang Science & Technology Press}, author={Zhuo, L. and Yang, W. and Liu, W.}, editor={Yang, Cui Xiao and Wen, Wang QingEditors}, year={1994}, pages={286–290} }
 @inbook{zhuo_liu_yang_1994, place={Harbin, P.R. China}, title={Investigation and utilization of the wild fruit resources in Xiaoxing’an Mountains}, booktitle={New Studies on Forest Management and Forest Resource Exploitation in Northeast China-Zhong Guo Dong Bei Lin Qu (1990-1994)}, publisher={Heilongjiang Science & Technology Press}, author={Zhuo, L. and Liu, W. and Yang, W.}, editor={Yang, Cui Xiano and Wen, Wang QingEditors}, year={1994}, pages={266–270} }