@article{zeng_ye_zhang_sun_yong_huang_zhao_liang_kerns_2016, title={Morphological and molecular characterization of Xiphinema species from Shenzhen, China}, volume={53}, ISSN={["1336-9083"]}, DOI={10.1515/helmin-2015-0068}, abstractNote={Summary
               During a nematode biodiversity survey from 2012 to 2014 in Shenzhen, China, ten nematode populations (SZX1301–SZX1310) of Xiphinema were recovered from rhizosphere of different plants, namely Acacia mangium (SZX1306), A. confuse (SZX1309), Blechnum orientale (SZX1301, SZX1302, SZX1307, SZX1308), Litchi chinensis (SZX1304, SZX1310) in Tianxinshan and Gleichenia linearis (SZX1303, SZX1305) in Yangmeikeng environmental monitoring sites. Morphological and molecular profiles of these populations were determined. Three species of Xiphinema, i.e., X. hunanienseWang & Wu, 1992, X. brasilienseLordello, 1951 and X. americanum Cobb, 1913 sensu lato were identified using morphological characters and molecular data of partial 18S and 28S D2–D3 rDNA expansion segments. Four populations (SZX1301–SZX1304) were X. hunaniense, one population (SZX1305) X. brasiliense, and five populations (SZX1306–SZX1310) X. americanum s.l.. Phylogenetic analysis based on sequences of the 28S rDNA D2–D3 expansion segment revealed these three species are all distinct species and supported a close relationship with their corresponding species. This is the first report of X. hunaniense, X. brasiliense and X. americanum s.l. in their hosts except for L. chinensis.}, number={1}, journal={HELMINTHOLOGIA}, author={Zeng, Y. and Ye, W. and Zhang, Z. and Sun, H. and Yong, L. and Huang, Y. and Zhao, K. and Liang, H. and Kerns, J.}, year={2016}, month={Mar}, pages={62–75} }
 @article{ye_zeng_kerns_2015, title={First Report of Trichodorus obtusus on Turfgrass in North Carolina, USA}, volume={99}, ISSN={["1943-7692"]}, DOI={10.1094/pdis-08-14-0830-pdn}, abstractNote={ In May 2014, 11 sandy soil samples were collected at a depth of about 5 to 15 cm from a golf course community in Wilmington, NC, composed of Bermudagrass (Cynodon dactylon) from the fairway, St. Augustinegrass (Stenotaphrum secundatum) from the lawn, and Zoysiagrass (Zoysia japonica) from the tee, all of which showed spotted yellowing and necrosis. Plant-parasitic nematodes were extracted from soil samples by a combination of elutriation and sugar centrifugal-flotation methods at the North Carolina Department of Agriculture and Consumer Services, Nematode Assay Lab, Raleigh, NC. The results revealed the presence of several plant-parasitic nematodes, with a stubby-root nematode (Trichodoridae) present. Population densities of stubby-root nematodes were 10 to 90 (average 50) nematodes per 500 cm3 of soil. This species was clearly different from the parthenogenetic stubby-root nematode Nanidorus minor (Colbran, 1956) Siddiqi, 1974 commonly found in North Carolina because of the presence of males and larger body size. Morphological and molecular analyses of this nematode identified the species as Trichodorus obtusus Cobb, 1913. Morphological features of T. obtusus specimens were examined in glycerol permanent mounts. Males (n = 5) had a ventrally curved spicule, three ventromedian precloacal papillae (one ventromedian cervical papilla anterior to the excretory pore, one pair of lateral cervical pores at the level of the ventromedian cervical papilla), and a tail with a non-thickened terminal cuticle. Males were 860 to 1,120 (average 1,018) μm long, body width 38 to 48 (42) μm, onchiostyle 53 to 60 (56) μm, and spicule 54 to 62 (59) μm. Females (n = 5) had a pore-like vulva, a barrel-shaped vagina, and one or two postadvulvar lateral body pores on each side. Females were 990 to 1,330 (1,148) μm long, body width 43 to 56 (48) μm, onchiostyle 50 to 64 (58) μm, and V 49.0 to 57.5% (53.0%). The morphology agreed with the description of T. obtusus (2). DNA was prepared by squashing a single nematode (n = 3) on a microscope slide and collecting in 50 μl of AE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0). The 18S rDNA region was amplified with the forward primers 18S-G18S4 (5′ GCTTGTCTCAAAGATTAAGCC 3′), SSUF07 (AAAGATTAAGCCATGCATG), and 18S965 (GGCGATCAGATACCGCCCTAGTT) and reverse primers 18S-18P (TGATCCWKCYGCAGGTTCAC), SSUR26 (CATTCTTGGCAAATGCTTTCG), and 18S1573R (TACAAAGGGCAGGGACGTAAT). The 28S D2/D3 region was amplified with the forward primer 28S391a (AGCGGAGGAAAAGAAACTAA) and reverse primer 28S501 (TCGGAAGGAACCAGCTACTA) (4). The resulting 18S (1,547-bp) and 28S D2/D3 (925-bp) sequences were deposited in GenBank under the accession numbers KM276665 and KM276666. The 18S sequence data was 100% homologous with two populations of T. obtusus (JX279930, 898 bp, and JX289834, 897 bp) from South Carolina and one (AY146460, 634 bp) from an unknown source, each with a 1-bp difference in a Blastn search. The 28S D2/D3 sequence data was less than 90% homologous with many Trichodorus species, but no T. obtusus sequence data was available. T. obtusus is known to occur only in the United States and to damage turfgrasses. It is reported in the states of Virginia, Florida, South Carolina, Texas, Iowa, Kansas, Michigan, New York, and South Dakota. This nematode has been reported as a pathogen of bermudagrass in Florida (1) and South Carolina (3), but pathogenicity to St. Augustinegrass and Zoysiagrass is unknown. To our knowledge, this is the first report of T. obtusus on turfgrasses in North Carolina.  References: (1) W. T. Crow and J. K. Welch. Nematropica 34:31, 2004. (2) W. Decraemer. The Family Trichodoridae: Stubby Root and Virus Vector Nematodes. Kluwer Academic Publishers, Dordrecht, The Netherlands, 1995. (3) J. B. Shaver et al. Plant Dis. 97:852, 2013. (4) G. R. Stirling et al. Nematology 15:401, 2013. }, number={2}, journal={PLANT DISEASE}, author={Ye, W. and Zeng, Y. and Kerns, J.}, year={2015}, month={Feb}, pages={291–291} }
 @article{ye_zeng_kerns_2015, title={Molecular Characterisation and Diagnosis of Root-Knot Nematodes (Meloidogyne spp.) from Turfgrasses in North Carolina, USA}, volume={10}, ISSN={["1932-6203"]}, DOI={10.1371/journal.pone.0143556}, abstractNote={Root-knot nematodes (Meloidogyne spp.) are the most common and destructive plant-parasitic nematode group worldwide and adversely influence both crop quality and yield. In this study, a total of 51 root-knot nematode populations from turfgrasses were tested, of which 44 were from North Carolina, 6 from South Carolina and 1 from Virginia. Molecular characterisation was performed on these samples by DNA sequencing on the ribosomal DNA 18S, ITS and 28S D2/D3. Species-specific primers were developed to identify turfgrass root-knot nematode through simplex or duplex PCR. Four species were identified, including M. marylandi Jepson & Golden in Jepson, 1987, M. graminis (Sledge & Golden, 1964) Whitehead, 1968, M. incognita (Kofoid & White, 1919) Chitwood, 1949 and M. naasi Franklin, 1965 through a combined analysis of DNA sequencing and PCR by species-specific primers. M. marylandi has been reported from North Carolina and South Carolina for the first time. Molecular diagnosis using PCR by species-specific primers provides a rapid and cheap species identification approach for turfgrass root-knot nematodes.}, number={11}, journal={PLOS ONE}, author={Ye, Weimin and Zeng, Yongsan and Kerns, James}, year={2015}, month={Nov} }
 @article{zeng_ye_kerns_tredway_martin_martin_2015, title={Molecular Characterization and Phylogenetic Relationships of Plant-Parasitic Nematodes Associated with Turfgrasses in North Carolina and South Carolina, United States}, volume={99}, ISSN={["1943-7692"]}, DOI={10.1094/pdis-10-14-1060-re}, abstractNote={ The near-full-length 18S ribosomal DNA (rDNA) gene and internal transcribed spacer 1 region were amplified and sequenced from 52 nematode populations belonging to 28 representative species in 13 families recovered from turfgrasses in North Carolina (38 populations) and South Carolina (14 populations). This study also included 13 nematode populations from eight other plant hosts from North Carolina for comparison. Nematodes were molecularly characterized and the phylogenetic relationships were explored based on 18S rDNA sequences. Phylogenetic analysis using Bayesian inference was performed using five groups of the plant-parasitic nematode populations Tylenchids, Criconematids, Longidorids, Xiphinematids, and Trichodorids. The 65 nematode populations were clustered correspondingly within appropriate positions of 13 families, including Belonolaimidae, Caloosiidae, Criconematidae, Dolichodoridae, Hemicycliophoridae, Hoplolaimidae, Heteroderidae, Longidoridae, Meloidogynidae, Paratylenchidae, Pratylenchidae, Telotylenchidae, and Trichodoridae. This study confirms previous morphological-based identification of the plant-parasitic nematode species found in turfgrasses and provides a framework for future studies of plant-parasitic nematodes associated with turfgrasses based upon DNA sequences and phylogenetic relationships. }, number={7}, journal={PLANT DISEASE}, author={Zeng, Yongsan and Ye, Weimin and Kerns, James and Tredway, Lane and Martin, Samuel and Martin, Matt}, year={2015}, month={Jul}, pages={982–993} }
 @article{zeng_ye_kerns_2014, title={First report and morphological and molecular characterization of Meloidogyne incognita from Radermachera sinica in China}, volume={44}, number={2}, journal={Nematropica}, author={Zeng, Y. S. and Ye, W. M. and Kerns, J.}, year={2014}, pages={118–129} }
 @article{zeng_ye_yang_huang_zhao_zhang_liang_kerns_2014, title={Morphological and molecular characterization of two isolates of Paratrichodorus porosus from Shenzhen, China}, volume={51}, ISSN={["1336-9083"]}, DOI={10.2478/s11687-014-0248-1}, abstractNote={Abstract
               Studies were conducted to characterize morphological and molecular profiles of two isolates of Paratrichodorus porosus (SZ1 and SZ2) which were recovered from Acacia mangium in Tianxinshan and Gleichenia linearis in Yangmeikeng environmental monitoring sites in Shenzhen, China, respectively. Analysis of morphometric, morphological and molecular characters revealed these two Shenzhen isolates are identical to P. porosus. Measurements of both study isolates lie within the ranges for P. porosus. It is typologically characterized by possessing a clearly swollen body cuticle after fixation, an onchiostyle ventrally curved, 46–58 μm long, a pharyngeal bulb usually with a well developed anterior-dorsal intestinal overlap, a secretoryexcretory pore opening between the nerve ring and anterior end of pharyngeal bulb, 90–110 μm from the anterior end, a reproductive system with didelphic, amphidelphic, without spermathecae, a pore-like vulva in ventral view and occupying 52.0 %–59.5 % of total body length from anterior end, a short and barrel-shaped vagina with small sclerotizations, a pair of ventromedian advulvar body pores located prevulvar and postvulvar, a rounded tail and a subterminal anus in females. The sequence analysis based on partial rDNA 18S gene and 28S D2/D3 expansion segment confirm its identity as P. porosus. This is the first report of P. porosus associated with A. mangium and G. linearis.}, number={4}, journal={HELMINTHOLOGIA}, author={Zeng, Y. and Ye, W. and Yang, L. and Huang, Y. and Zhao, K. and Zhang, Z. and Liang, H. and Kerns, J.}, year={2014}, month={Dec}, pages={323–330} }